Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1. celular Cultura e Labeling fluorescentes de câncer de ovário linhas celulares <ol><li> Prepare mídia SKOV3: meios de McCoy suplementado com 10% soro fetal bovino (FBS), 0,1 mM de L-glutamina, 50 U / ml de penicilina, e 50 ug / ml de estreptomicina. Manter OVCA429 células em meio essencial mínimo (MEM) suplementado com 10% de FBS, piruvato de sódio 1 mM, 0,1 mM de L-glutamina, 50 U / ml de penicilina, e 50 ug / ml de estreptomicina. </li><li> Propagar SKOV3 e OVCA429 linhas celulares numa incubadora humidificada a 37 ° C com 5% de CO 2. Cultivar células de 40-50% de confluência. </li><li> Gerar células que expressam a proteína fluorescente vermelha (RFP), a fim de monitorar a viabilidade in vitro e in vivo. <ol><li> Para gerar células que expressam SKOV3 RFP, adicionar partículas lentivirais expressando RFP e 10 ug / ml de polibreno a mídia SKOV3 na ausência de penicilina e estreptomicina para 72 h. </li><li> Depois de 72 horas, seleccione para RFP células positivas por fluorescência celular ativado Sorting (FACS) como se segue: Trypsinize RFP e não as células que expressam RFP, centrifugar a 125 xg durante 5 min, ressuspender as células em 10 7 células / ml em PBS contendo 0,1% de BSA. Em um classificador de células, as células não utilizar-RFP para determinar os parâmetros de classificação. Em seguida, recolher as células que expressam alta RFP usando um laser de 561 nm. </li><li> Alternativamente, se o plasmídeo lentiviral expressa uma cassete de resistência aos antibióticos, seleccionar as células que expressam RFP por cultura no antibiótico apropriado (tal como 10 mg / ml de blasticidina). NOTA: A quantidade de partículas lentivirais que deve ser utilizada pode variar por lote e por tipo de célula. Titulação adequada lentiviral deve ser determinado para cada tipo de célula. </li></ol></li></ol> 2 Enriquecimento de células-tronco cancerosas <ol><li> Trate SKOV3, SKOV3-RFP, ou OVCA429 linhas de células com 20 mM de cisplatina durante 72 horas. ATENÇÃO: A cisplatina é tóxico. Usar roupa de proteção / luvas e evitar o contato com pele e membranas mucosas. Não descarte a cisplatina in águas residuais. </li><li> Prepare mídia CSC: soro de meio DMEM / F12 livre suplementado com 5 ug / ml de insulina, 10 ng / factor de crescimento epidérmico humano recombinante ml (EGF), 10 ng / factor de crescimento de fibroblastos básico ml (bFGF), 12 ng / ml factor de inibição de leucemia , e 0,4% de albumina de soro bovino (BSA). </li><li> Células Trypsinize. Cultura das células sobreviventes em meios CSC. NOTA: Após 2 dias em cultura de esferóides não aderentes formarão. </li><li> Mudar mídia a cada 2 dias, recolhendo meios contendo as células e centrifugação a 125 xg durante 5 min. Em seguida, ressuspender o sedimento em media CSC fresco. Entrada para a viabilidade de células a cada 2 dias através da contagem de células e a realização de exclusão de azul de tripano. </li><li> Em seguida, recolher CSCs para posteriores experiências por centrifugação 129 x g durante 5 min e ressuspender o sedimento em fenol contendo guanidina thiocynate (ARN), salino tamponado com fosfato (PBS: NaCl 137 mM, KCl 2,7 mM e 11,9 mM de tampão fosfato, pH 7,4) com 0,1% BSA (por citometria de fluxo), ou mídia CSC para continuara cultura das células. </li><li> Monitorar a morfologia das células CSC usando um microscópio de luz em 20X e 40X ampliações. </li></ol> 3. CSC Caracterização via Análise da expressão genética para marcadores Stem Cell <ol><li> Recolhe 3 preparações de CSCs, recolhendo meios contendo as células, centrifugação a 129 xg durante 5 min, e ressuspender o pellet em solução de fenol contendo guanidina thiocynate (podem ser utilizados outros métodos de extracção de RNA). </li><li> Preparar ARN total, utilizando TRIzol de acordo com o protocolo do fabricante. Sintetizar DNA complementar (cDNA) 0,1-1 ug de RNA usando um kit de ADNc A transcrição inversa disponível comercialmente. </li><li> Realizar de transcrição reversa em cadeia da polimerase quantitativa reacção (QRT-PCR). <ol><li> Compo mistura principal para cada conjunto de iniciadores contendo mistura QRT-PCR, os iniciadores, e água para o total de 8 mL por amostra (iniciadores com diferentes fluoróforos pode ser amplificada no mesmo poço). Por exemplo, geraruma mistura de mestre para Oct4-FAM, Nanog-Hex, e GAPDH-CY5. Gerar misturas principais separados para Nestin e Prom1. Adicionar 2 mL de modelo de cDNA por amostra. NOTA: Para este estudo, QRT-PCR foi realizada utilizando os iniciadores listados na Tabela 1. </li><li> Realiza toda QRT-PCR em duplicado para cada amostra utilizando um termociclador de PCR em tempo real capazes de detectar vários fluoróforos. Não incluem controles de modelo. </li><li> Normalizar a expressão de genes em células estaminais para a expressão de GAPDH em cada amostra utilizando o método ΔΔC T. </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" width="746"><colgroup><col /><col /></colgroup><tbody><tr height="21"><td height="63" rowspan="3" style="height:62px;width:111px;"> Oct-4-FAM </td><td style="width:636px;"> Iniciador 1: 5&#39;-CCCAAGGAATAGTCTGTAGAAGTG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Iniciador 2: 5&#39;-TGCATGAGTCAGTGAACAGG-3 &#39;</td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda FAM: 5&#39;-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nanog-HEX </td><td> Iniciador 1: 5&#39;-CCTTCTGCGTCACACCATT-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Iniciador 2: 5&#39;-AACTCTCCAACATCCTGAACC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> HEX sonda: 5&#39;-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> GAPDH-CY5 </td><td> Iniciador 1: 5&#39;-TGTAGTTGAGGTCAATGAAGGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Iniciador 2: 5&#39;-ACATCGCTCAGACACCATG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> CY5 sonda: 5&#39;-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 &#39; </td><html></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nestin-FAM </td><td> Iniciador 1: 5&#39;-AGGACCTGAGCGATCTGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Iniciador 2: 5&#39;-CGTTGGAACAGAGGTTGGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda FAM: 5&#39;-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> CD133-HEX </td><td> Iniciador 1: 5&#39;-ACTCTCTCCAACAATCCATTCC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Iniciador 2: 5&#39;-AAACAATTCACCAGCAACGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda HEX: 5&#39;-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 </td></tr></tbody></table> Tabela 1. Os iniciadores utilizados para a caracterização por CSC QRT-PCR. e_title &quot;&gt; 4. CSCs Analisando para a superfície celular marcadores CD117 e CD133 <ol><li> CSCs colheita através da recolha de mídia contendo células e centrifugação a 125 xg por 5 min. Adicionar 500 mL de uma solução não proteolítico descolamento celular para quebrar-se as células. Células centrifugar a 125 xg por 5 min para remover a solução descolamento celular. Em seguida, lave as células duas vezes com PBS frio. </li><li> Incubar em meio normal de crescimento durante 1 h antes de células de rotulagem. Gire as células durante 5 minutos a 129 x g. Ressuspender as células em PBS com BSA a 0,1%, com anti-CD133-PE e anti-CD117-FITC. </li><li> Fixar as células durante a noite em paraformaldeído a 1%. Atenção: O paraformaldeído é tóxico (possivelmente cancerígeno). Faça em extractor de fumo e usar dentro de uma semana. </li><li> Realizar a citometria de fluxo para analisar CD117 (com um anticorpo anti-CD117 conjugado com FITC) e CD133 (com anti-CD133 conjugado com PE) a expressão de superfície celular num citómetro de fluxo. Coletar dados sobre as células do FL1 (para FITC) e FL3 (PE) para os canais. Gerar portas para as células que expressam tantoFITC e PE. Gerar um gráfico de pontos com quatro quadrantes (FITC e PE-, PE-FITC +, + PE FITC e PE e FITC + +) e determinar o número de células em cada quadrante. </li></ol> 5. Analisando CSCs para a resposta terapêutica <ol><li> Placa de 5000 células por poço (SKOV3, SKOV3-RFP, SKOV3 CSC e SKOV3-RFP CSCs) em placas de 96 poços durante a noite. </li><li> Trata-se com cisplatina (0, 1, 10, 100 e 1.000 mM) ou paclitaxel (0, 0,01, 0,1, 1, 10, e 100 ^ M) durante 96 horas. </li><li> Realizar MTT (3 (4,5-dimetiltiazol-2-il) -2,5-) ensaio de viabilidade celular. <ol><li> Placa de 5000 células por 100 ul por cavidade em uma placa de 96 poços (placa de células em duplicado, e incluem meios de controlar apenas poços). </li><li> Após 24 horas, adicionar 10 ul de 10 mg / mL de MTT. Incubar a 37 ° C durante 2-4 horas (até a formação de precipitado). </li><li> Adicionar 100 ul de HCI mM de MTT solvente 4, 0,1% de NP-40 em isopropanol. Incubar durante 15 min no escuro. </li><li> Ler as placas a 570 nm numa placa de reader. </li></ol></li></ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

CSCs que são resistentes à terapia pode ser responsável por recaída após o tratamento do tumor primário. Caracterização dos CSCs podem levar a melhores terapias para o câncer de ovário. Os parâmetros críticos no estabelecimento de CSCs quimiorresistentes utilizando o protocolo anteriormente referido, são cronometrar o tempo de tratamento com a quimioterapia e a concentração de quimioterapia. Ao usar o protocolo em Ma et al. verificou-se que ao fim de 7 dias de tratamento com cisplatina e paclitax...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Name of Reagent/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">McCoy</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">16600-108</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">DMEM / F12 serum free</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td style="width:119px;">11320-033</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Minimal Essential Media</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td>42360032</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Sodium Pyruvate</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/11360070">11360070</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Polybrene</td>
			<td style="width:71px;">Millipore</td>
			<td>TR-1003-G</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Blasticidin</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/R21001">R21001</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:71px;">Atlas Biologicals</td>
			<td style="width:119px;">F-0500-A</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Penicillin-streptomycin&#160;</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15070-063</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Cisplatin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T7402-5MG</td>
			<td style="width:167px;">Caution: Toxic Use precautions</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">pLenti-suCMV-Rsv</td>
			<td style="width:71px;">Gentarget</td>
			<td style="width:119px;">LVP023</td>
			<td style="width:167px;">BSL2 approval needed</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Insulin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Human Recombinant EGF&#160;</td>
			<td style="width:71px;">Cell Signaling Technology</td>
			<td style="width:119px;">8916LC</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">bFGF</td>
			<td style="width:71px;">BD biosciences</td>
			<td style="width:119px;">354060</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="41" rowspan="2" style="height:41px;width:216px;">LIF</td>
			<td rowspan="2" style="width:71px;">Santa Cruz</td>
			<td rowspan="2" style="width:119px;">sc-4988A</td>
			<td rowspan="2" style="width:167px;"></td>
		</tr>
		<tr height="21">
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Bovine Serum Albumin</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">03 116 956 001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">TRIzol</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">High Capacity cDNA Reverse Transcription Kit&#160;&#160;</td>
			<td style="width:71px;">Applied Biosystems</td>
			<td style="width:119px;">4368813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IQ Multiplex Powermix</td>
			<td style="width:71px;">BioRad</td>
			<td style="width:119px;">1725849</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Accumax</td>
			<td style="width:71px;">Millipore</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Primers</td>
			<td style="width:71px;">Integrated DNA Technology</td>
			<td style="width:119px;">individually designed and ordered (see protocol for sequnces)</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Anti-CD133 PE</td>
			<td style="width:71px;">Milenyl</td>
			<td>130-098-826</td>
			<td style="width:167px;">Primer/probe sets are light sensitive</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">CD117-Biotin</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">AntiBiotin-FITC</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td>P6148-1KG</td>
			<td style="width:167px;">Caution: Toxic always prepare in hood and make fresh.</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Trypsin</td>
			<td style="width:71px;">Life Technologies</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/25300062">25300062</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)&#160;</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">25200-072</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">EVOS Fl Epifluorescence and Transmitted Light Microscope</td>
			<td>Advanced Microscopy Group</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Biorad CFX96 C1000 System</td>
			<td style="width:71px;">Biorad</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">Beckman Coulter FC500 Flow Cytometer&#160;</td>
			<td style="width:71px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Spectramax 340PC384&#160;</td>
			<td style="width:71px;">Molecular Devices</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

Células-tronco cancerosas (CSCS) são definidos como um subconjunto de ciclismo lento e células indiferenciadas que se dividem de forma assimétrica para gerar altamente proliferativa, invasiva e células tumorais quimiorresistentes. Portanto, CSCs são uma população de células atraente para direcionar terapeuticamente. CSCs são previstos para contribuir para um número de tipos de tumores, incluindo os do sangue, cérebro, pulmão, tracto gastrointestinal, próstata, ovário. Isolando e enriquecendo a população de células tumorais para CSCs irá permitir aos pesquisadores estudar as propriedades, genética e resposta terapêutica dos CSCs. Geramos um protocolo que enriquece reprodutível para CSCs câncer de ovário de linhas celulares de cancro do ovário (SKOV3 e OVCA429). As linhas de células são tratadas com 20 pM de cisplatina durante 3 dias. As células sobreviventes são isoladas e cultivadas em meios de células-tronco isento de soro contendo citoquinas e factores de crescimento. Nós demonstramos um enriquecimento dessas CSCs purificados por análise das células isoladas, para known marcadores de células estaminais Oct4, nanog, e Prom1 (CD133) e a expressão da superfície das células de CD177 e CD133. A exposição CSCs aumento chemoresistance. Este método de isolamento de CSCs é uma ferramenta útil para o estudo do papel das CSCs na quimiorresistência de tumor e de recaídas.

Para demonstrar que isolámos CSCs de linhas celulares de cancro de ovário epitelial utilizando o tratamento com cisplatina, que em primeiro lugar as imagens adquiridas das linhas de células antes do tratamento e após selecção. Nós usamos a microscopia de luz para capturar imagens de aderente (não tratada) SKOV3 e OVCA429 células e SKOV3 e OVCA429 CSCs (Figura 1). CSCs aparecem redonda e não ligado às placas de cultura de tecidos (Figuras 1 e 2). Mostramos tam...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Células-tronco cancerosas (CSCs) estão implicados na reincidência do tumor devido a chemoresistance. Nós otimizamos um protocolo para a seleção e expansão dos CSCs de linhas celulares de cancro do ovário. Ao tratar as células com a cisplatina quimioterapêutico e a cultura de uma célula-tronco nos meios de promoção para enriquecer culturas CSC não aderentes.

Enriquecimento para resistente à quimioterapia do cancro do ovário células-tronco de linhas de células humanas

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K visualizações.  Indiana University School of Medicine.  Células-tronco cancerosas (CSCs) estão implicados na reincidência do tumor devido a chemoresistance. Nós otimizamos um protocolo para a seleção e expansão dos CSCs de linhas celulares de cancro do ovário. Ao tratar as células com a cisplatina quimioterapêutico e a cultura de uma célula-tronco nos meios de promoção para enriquecer culturas CSC não aderentes. 