Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1 Cella cultura e fluorescente Etichettatura di cancro ovarico linee cellulari <ol><li> Preparare SKOV3 supporti: McCoy multimediale integrato con 10% di siero fetale bovino (FBS), 0,1 mM L-glutammina, 50 U / ml di penicillina, 50 mg / ml di streptomicina. Mantenere OVCA429 cellule in mezzi essenziale minimo (MEM) supplementato con 10% FBS, 1 mM piruvato di sodio, 0,1 mM L-glutammina, 50 U / ml di penicillina, e 50 mg / ml di streptomicina. </li><li> Propagazione linee cellulari SKOV3 e OVCA429 in un incubatore umidificato a 37 ° C con 5% di CO 2. Crescere le cellule a 40-50% di confluenza. </li><li> Generare cellule che esprimono la proteina fluorescente rossa (RFP) per monitorare la vitalità in vitro e in vivo. <ol><li> Per generare cellule SKOV3 esprimono RFP, aggiungere particelle lentivirali che esprimono RFP e 10 mcg / ml polibrene a SKOV3 media in assenza di penicillina e di streptomicina per 72 ore. </li><li> Dopo 72 ore, selezionare di RFP cellule positive da cellule Fluorescence Attivato Sorting (FACS) come segue: Trypsinize RFP e non RFP cellule che esprimono, centrifugare a 125 xg per 5 minuti, risospendere le cellule a 10 7 cellule / ml in PBS contenente 0,1% di BSA. Su un cell sorter, utilizzare cellule non RFP per determinare i parametri di selezione. Poi raccogliere le cellule che esprimono RFP alta utilizzando un laser 561 nm. </li><li> In alternativa, se il plasmide lentivirale esprime una cassetta di resistenza antibiotica, per selezionare le cellule che esprimono RFP coltivando nel antibiotico appropriato (ad esempio 10 mg / ml blasticidin). NOTA: La quantità di particelle lentivirali che deve essere utilizzato può variare a seconda del lotto e dal tipo di cellula. Lentivirali titolo corretto dovrebbe essere determinato per ciascun tipo di cellula. </li></ol></li></ol> 2. arricchimento di cellule tumorali staminali <ol><li> Trattare SKOV3, SKOV3-RFP, o OVCA429 linee cellulari con 20 mM di cisplatino per 72 ore. ATTENZIONE: Il cisplatino è tossico. Usare indumenti protettivi / guanti ed evitare il contatto con la pelle e le mucose. Non gettare i cisplatinon acque reflue. </li><li> Preparare CSC supporti: siero mezzi DMEM / F12 libera integrato con 5 mcg / ml di insulina, 10 ng / ml di fattore di crescita epidermico umano ricombinante (EGF), 10 ng / ml di base del fattore di crescita dei fibroblasti (bFGF), 12 ng / ml fattore inibitorio di leucemia , e il 0,4% di albumina sierica bovina (BSA). </li><li> Cellule trypsinize. Cultura sopravvivenza delle cellule in CSC media. NOTA: Dopo 2 giorni di coltura sferoidi non aderenti formeranno. </li><li> Modificare i media ogni 2 giorni, raccogliendo i media contenente cellule e centrifugazione a 125 xg per 5 min. Poi risospendere il pellet in mezzi CSC fresco. Controllare le cellule per la vitalità ogni 2 giorni contando le cellule e l&#39;esecuzione di trypan blu. </li><li> Poi raccogliere CSC per ulteriori esperimenti per centrifugazione 129 xg per 5 min e risospendere il pellet in fenolo contenente guanidina thiocynate (RNA), tampone fosfato salino (PBS: 137 mM NaCl, 2.7 mM KCl, e 11,9 mM tampone fosfato, pH 7.4) con 0,1% di BSA (per citometria a flusso), o CSC media per continuarecoltivando le cellule. </li><li> Monitorare morfologia cellulare CSC utilizzando un microscopio ottico a 20X e 40X ingrandimenti. </li></ol> 3. CSC Caratterizzazione mediante analisi di espressione genica di cellule staminali Marcatori <ol><li> Raccogliere 3 preparazioni di CSC attraverso la raccolta di supporti contenenti cellule, centrifugazione a 129 xg per 5 minuti, e risospendere il pellet in una soluzione di acido contenente guanidina thiocynate (altri metodi per l&#39;estrazione di RNA possono essere utilizzati). </li><li> Preparare RNA totale utilizzando TRIzol secondo il protocollo del produttore. Sintetizzare DNA complementare (cDNA) 0,1-1 mg di RNA utilizzando un kit cDNA Reverse Transcription disponibile in commercio. </li><li> Eseguire quantitativa inversione trascritto reazione a catena della polimerasi (QRT-PCR). <ol><li> Make up master mix per ogni set di primer contenenti mix QRT-PCR, primer, e acqua per un totale di 8 microlitri per campione (primer con differenti fluorofori possono essere amplificati nello stesso bene). Ad esempio, generareuna master mix per Oct4-FAM, Nanog-Hex, e GAPDH-CY5. Generare master mix separati per Nestin e Prom1. Aggiungere 2 ml di cDNA modello per campione. NOTA: Per questo studio, QRT-PCR è stata effettuata utilizzando i primer elencati nella tabella 1. </li><li> Eseguire tutte QRT-PCR in duplice copia per ogni campione con un real time PCR termociclatore in grado di rilevare più fluorofori. Includere controlli senza templato. </li><li> Normalizzare l&#39;espressione genica di cellule staminali di espressione GAPDH per ogni campione utilizzando il metodo ΔΔC T. </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" width="746"><colgroup><col /><col /></colgroup><tbody><tr height="21"><td height="63" rowspan="3" style="height:62px;width:111px;"> Oct-4-FAM </td><td style="width:636px;"> Primer 1: 5&#39;-CCCAAGGAATAGTCTGTAGAAGTG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-TGCATGAGTCAGTGAACAGG-3 &#39;</td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda FAM: 5&#39;-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nanog-HEX </td><td> Primer 1: 5&#39;-CCTTCTGCGTCACACCATT-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-AACTCTCCAACATCCTGAACC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda HEX: 5&#39;-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> GAPDH-CY5 </td><td> Primer 1: 5&#39;-TGTAGTTGAGGTCAATGAAGGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-ACATCGCTCAGACACCATG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda CY5: 5&#39;-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 &#39; </td><html></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nestina-FAM </td><td> Primer 1: 5&#39;-AGGACCTGAGCGATCTGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-CGTTGGAACAGAGGTTGGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda FAM: 5&#39;-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> CD133-HEX </td><td> Primer 1: 5&#39;-ACTCTCTCCAACAATCCATTCC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-AAACAATTCACCAGCAACGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Sonda HEX: 5&#39;-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 </td></tr></tbody></table> Tabella 1. primer utilizzati per la CSC caratterizzazione mediante QRT-PCR. e_title &quot;&gt; 4. CSC Analisi per cellulari di superficie marcatori CD117 e CD133 <ol><li> CSC Harvest raccogliendo supporti contenenti cellule e centrifugazione a 125 xg per 5 min. Aggiungere 500 ml di una soluzione di distacco delle cellule non-proteolitico di break-up cellule. Cellule centrifugare a 125 xg per 5 minuti per rimuovere soluzione distacco delle cellule. Poi lavare le cellule due volte con PBS freddo. </li><li> Incubare in normali terreni di coltura per 1 ora prima di celle di etichettatura. Spin le cellule per 5 min a 129 x g. Risospendere le cellule in PBS con 0,1% BSA anti-CD133-PE e anti-CD117-FITC. </li><li> Fissare le cellule durante la notte in 1% paraformaldeide. Attenzione: Paraformaldeide è tossico (sospetto cancerogeno). Fate in cappa e consumare entro una settimana. </li><li> Eseguire la citometria a flusso per analizzare CD117 (con un anti-CD117 coniugato FITC) e CD133 (con anti-CD133 coniugato PE) espressione di superficie cellulare su un citometro a flusso. Raccogliere dati sulle cellule in FL1 (FITC) e FL3 (PE) per i canali. Generare cancelli per cellule che esprimono entrambiFITC e PE. Genera un diagramma a punti con 4 quadranti (FITC e PE, FITC + PE, PE FITC + e + FITC e PE +) e determinare il numero di cellule in ogni quadrante. </li></ol> 5. Analizzando CSC per la risposta terapeutica <ol><li> Piastra 5.000 cellule per pozzetto (SKOV3, SKOV3-RFP, SKOV3 CSC e SKOV3-RFP CSC) su piastre a 96 pozzetti durante la notte. </li><li> Trattare con cisplatino (0, 1, 10, 100, e 1.000 mM) o paclitaxel (0, 0.01, 0.1, 1, 10, e 100 mM) per 96 ore. </li><li> Eseguire MTT (3 (4,5-dimetiltiazol-2-yl) -2,5-diphenyltetrazolium bromuro) test vitalità cellulare. <ol><li> Piatto 5.000 cellule per 100 ml per pozzetto su una piastra a 96 pozzetti (cellule piastra in duplicato e comprendono Media Control solo pozzi). </li><li> Dopo 24 ore, aggiungere 10 ml di 10 mg / ml di MTT. Incubare a 37 ° C per 2-4 ore (fino a quando forma un precipitato). </li><li> Aggiungere 100 ml di solvente mM HCl MTT 4, 0,1% NP-40 in isopropanolo. Incubare per 15 min a buio. </li><li> Per saperne di piastre a 570 nm su un piatto reader. </li></ol></li></ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

CSC che sono resistenti alla terapia possono essere responsabili di recidiva dopo il trattamento del tumore primario. Caratterizzazione della CSC può portare a migliori terapie per il cancro ovarico. I parametri critici nella creazione di CSC chemioresistenti utilizzando il protocollo di cui sopra sono cronometrando l&#39;durata del trattamento con la chemioterapia e la concentrazione della chemioterapia. Quando si utilizza il protocollo in Ma et al. si è constatato che dopo 7 giorni di trattamento con cispla...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Name of Reagent/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">McCoy</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">16600-108</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">DMEM / F12 serum free</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td style="width:119px;">11320-033</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Minimal Essential Media</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td>42360032</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Sodium Pyruvate</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/11360070">11360070</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Polybrene</td>
			<td style="width:71px;">Millipore</td>
			<td>TR-1003-G</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Blasticidin</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/R21001">R21001</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:71px;">Atlas Biologicals</td>
			<td style="width:119px;">F-0500-A</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Penicillin-streptomycin&#160;</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15070-063</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Cisplatin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T7402-5MG</td>
			<td style="width:167px;">Caution: Toxic Use precautions</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">pLenti-suCMV-Rsv</td>
			<td style="width:71px;">Gentarget</td>
			<td style="width:119px;">LVP023</td>
			<td style="width:167px;">BSL2 approval needed</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Insulin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Human Recombinant EGF&#160;</td>
			<td style="width:71px;">Cell Signaling Technology</td>
			<td style="width:119px;">8916LC</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">bFGF</td>
			<td style="width:71px;">BD biosciences</td>
			<td style="width:119px;">354060</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="41" rowspan="2" style="height:41px;width:216px;">LIF</td>
			<td rowspan="2" style="width:71px;">Santa Cruz</td>
			<td rowspan="2" style="width:119px;">sc-4988A</td>
			<td rowspan="2" style="width:167px;"></td>
		</tr>
		<tr height="21">
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Bovine Serum Albumin</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">03 116 956 001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">TRIzol</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">High Capacity cDNA Reverse Transcription Kit&#160;&#160;</td>
			<td style="width:71px;">Applied Biosystems</td>
			<td style="width:119px;">4368813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IQ Multiplex Powermix</td>
			<td style="width:71px;">BioRad</td>
			<td style="width:119px;">1725849</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Accumax</td>
			<td style="width:71px;">Millipore</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Primers</td>
			<td style="width:71px;">Integrated DNA Technology</td>
			<td style="width:119px;">individually designed and ordered (see protocol for sequnces)</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Anti-CD133 PE</td>
			<td style="width:71px;">Milenyl</td>
			<td>130-098-826</td>
			<td style="width:167px;">Primer/probe sets are light sensitive</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">CD117-Biotin</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">AntiBiotin-FITC</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td>P6148-1KG</td>
			<td style="width:167px;">Caution: Toxic always prepare in hood and make fresh.</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Trypsin</td>
			<td style="width:71px;">Life Technologies</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/25300062">25300062</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)&#160;</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">25200-072</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">EVOS Fl Epifluorescence and Transmitted Light Microscope</td>
			<td>Advanced Microscopy Group</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Biorad CFX96 C1000 System</td>
			<td style="width:71px;">Biorad</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">Beckman Coulter FC500 Flow Cytometer&#160;</td>
			<td style="width:71px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Spectramax 340PC384&#160;</td>
			<td style="width:71px;">Molecular Devices</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

Le cellule staminali tumorali (CSC) sono definiti come un sottoinsieme di ciclismo lento e cellule indifferenziate che si dividono asimmetricamente per generare altamente proliferative, invasive, e le cellule tumorali chemioresistenti. Pertanto, CSC sono una popolazione interessante di cellule a bersaglio terapeutico. CSC si prevede di contribuire a un certo numero di tipi di tumori maligni, compresi quelli nel sangue, cervello, polmoni, tratto gastrointestinale, della prostata e ovaie. Isolare e arricchire una popolazione di cellule tumorali per CSC permetterà ai ricercatori di studiare le proprietà, la genetica, e la risposta terapeutica di CSC. Abbiamo generato un protocollo che arricchisce riproducibile per CSC tumore ovarico da linee cellulari di cancro ovarico (SKOV3 e OVCA429). Linee cellulari sono trattate con 20 mM cisplatino per 3 giorni. Cellule sopravvissute sono isolate e coltivate in un supporto di cellule staminali senza siero contenente citochine e fattori di crescita. Dimostriamo un arricchimento di questi CSC purificati analizzando le cellule isolate per known marcatori di cellule staminali di staminalità Oct 4, Nanog, e Prom1 (CD133) e superficie cellulare espressione di CD177 e CD133. La mostra CSC aumentato chemioresistenza. Questo metodo per l&#39;isolamento di CSC è uno strumento utile per studiare il ruolo di CSC in chemioresistenza e di recidiva del tumore.

Per dimostrare che abbiamo isolato cellule staminali tumorali da linee di cellule di cancro ovarico epiteliale mediante trattamento con cisplatino, in primo luogo abbiamo acquisito le immagini delle linee cellulari prima del trattamento e dopo la selezione. Abbiamo usato la microscopia ottica per catturare immagini di aderenti (non trattato) SKOV3 e OVCA429 cellule e SKOV3 e OVCA429 CSC (Figura 1). CSC appaiono rotondo e non attaccato alle piastre di coltura tissutale (figure 1 e <stron...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Le cellule staminali tumorali (CSC) sono implicati nel tumore recidiva a causa di chemioresistenza. Abbiamo ottimizzato un protocollo per la selezione ed espansione di cellule staminali tumorali da linee cellulari di carcinoma ovarico. Trattando le cellule con il cisplatino chemioterapico e coltura in una cellula staminale promuovere media che arricchiscono per le culture CSC non aderenti.

Arricchimento per chemioresistente Ovarian Cancer Stem Cells da linee cellulari umane

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K Views.  Indiana University School of Medicine.  Le cellule staminali tumorali (CSC) sono implicati nel tumore recidiva a causa di chemioresistenza. Abbiamo ottimizzato un protocollo per la selezione ed espansione di cellule staminali tumorali da linee cellulari di carcinoma ovarico. Trattando le cellule con il cisplatino chemioterapico e coltura in una cellula staminale promuovere media che arricchiscono per le culture CSC non aderenti. 