Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1. Culture cellulaire et Marquage fluorescent de lignées cellulaires de cancer de l&#39;ovaire <ol><li> Préparer SKOV3 médias: médias McCoy complété avec 10% de sérum de veau fœtal (FBS), 0,1 mM de L-glutamine, 50 U / ml de pénicilline, et 50 pg / ml de streptomycine. Maintenir OVCA429 cellules dans un milieu minimal essentiel (MEM) supplémenté avec 10% de FBS, du pyruvate de sodium 1 mM, 0,1 mM de L-glutamine, 50 U / ml de pénicilline et 50 pg / ml de streptomycine. </li><li> Propager des lignées de cellules SKOV3 et OVCA429 dans un incubateur humidifié à 37 ° C avec 5% de CO 2. Cultiver des cellules à 40-50% de confluence. </li><li> Génération des cellules exprimant la protéine fluorescente rouge (RFP) dans le but de surveiller la viabilité in vitro et in vivo. <ol><li> Pour générer des cellules exprimant RFP SKOV3, ajouter des particules lentiviraux exprimant RFP et 10 ug / ml de polybrène à SKOV3 support en l&#39;absence de pénicilline et de streptomycine pendant 72 heures. </li><li> Après 72 heures, sélectionnez pour DP cellules positives par cellulaire activé par fluorescence Sorting (FACS) comme suit: Trypsiniser DP et non des cellules exprimant RFP, centrifuger à 125 g pendant 5 min, remettre les cellules à 10 7 cellules / ml dans du PBS contenant 0,1% de BSA. Sur un trieur de cellules, en utilisant des cellules non-DP pour déterminer les paramètres de tri. Puis prélever des cellules qui expriment haut DP en utilisant un laser 561 nm. </li><li> Par ailleurs, si le plasmide lentiviral exprime une cassette de résistance aux antibiotiques, sélectionner les cellules de la DP exprimant par culture dans l&#39;antibiotique approprié (par exemple 10 mg / ml blasticidine). REMARQUE: La quantité de particules lentiviraux qui doit être utilisée peut varier en fonction du lot et selon le type de cellule. Lentiviral titre correct doit être déterminée pour chaque type de cellule. </li></ol></li></ol> 2. enrichissement des cellules souches du cancer <ol><li> Traiter SKOV3, SKOV3-DP, ou OVCA429 lignées cellulaires avec 20 uM de cisplatine pendant 72 heures. ATTENTION: Le cisplatine est toxique. Utilisez des gants de protection / des vêtements et éviter tout contact avec peau et des membranes muqueuses. Ne jetez pas de cisplatine in eaux usées. </li><li> Préparer SCC médias: sans sérum milieu DMEM / F12 supplémenté avec 5 pg d&#39;insuline / ml, 10 ng / ml de facteur de croissance épidermique humain recombinant (EGF), 10 ng / base ml de facteur de croissance des fibroblastes (bFGF), 12 ng / ml de facteur inhibiteur de leucémie , et 0,4% d&#39;albumine de sérum bovin (BSA). </li><li> Cellules Trypsiniser. Culture des cellules survivant au SCC médias. NOTE: Après 2 jours de culture sphéroïdes non adhérentes se forment. </li><li> Changer de support tous les 2 jours en recueillant les médias contenant des cellules et centrifugation à 125 g pendant 5 min. Puis remettre le culot dans les médias SCC frais. Vérifiez cellules pour la viabilité tous les 2 jours en comptant les cellules et effectuer exclusion au bleu trypan. </li><li> Puis CCF pour recueillir d&#39;autres expériences par centrifugation 129 x g pendant 5 minutes et remise en suspension du culot dans du phénol contenant du thiocyanate de guanidine (ARN), solution saline tamponnée au phosphate (PBS: NaCl 137 mM, KCl 2,7 mM, et 11,9 mM de tampon phosphate, pH 7,4) avec 0,1% de BSA (pour la cytométrie de flux), ou SCC médias continuentla culture des cellules. </li><li> Surveiller SCC morphologie des cellules à l&#39;aide d&#39;un microscope optique à 20X et 40X grossissement. </li></ol> 3 Caractérisation SCC par l&#39;analyse de l&#39;expression génique de marqueurs de cellules souches <ol><li> Récupérer des trois préparations de CCF en recueillant des milieux contenant des cellules, une centrifugation à 129 g pendant 5 min, et la remise en suspension du culot dans une solution de phénol contenant du thiocyanate de guanidine (d&#39;autres méthodes d&#39;extraction de l&#39;ARN peuvent être utilisés). </li><li> Préparation de l&#39;ARN total en utilisant TRIzol selon le protocole du fabricant. Synthétiser de l&#39;ADN complémentaire (ADNc) de 0,1 à 1 ug d&#39;ARN en utilisant un kit de transcription inverse d&#39;ADNc disponible dans le commerce. </li><li> Effectuer une transcription inverse quantitative réaction en chaîne de la polymérase (QRT-PCR). <ol><li> Maquillage master mix pour chaque ensemble d&#39;amorces contenant mélange QRT-PCR, les amorces, et de l&#39;eau pour un total de 8 pi par échantillon (amorces avec différents fluorophores peuvent être amplifiés dans le même puits). Par exemple, générerun mélange maître pour Oct4-FAM, Nanog-Hex, et GAPDH-CY5. Générer master mix distincts pour Nestin et PROM1. Ajouter 2 ul de matrice d&#39;ADNc par échantillon. NOTE: Pour cette étude, QRT-PCR a été réalisée en utilisant les amorces énumérées dans le tableau 1. </li><li> Effectuer toutes QRT-PCR en double pour chaque échantillon en utilisant un thermocycleur PCR en temps réel capable de détecter de multiples fluorophores. Inclure les contrôles sans matrice. </li><li> Normaliser tige expression génique des cellules à l&#39;expression de GAPDH pour chaque échantillon en utilisant la méthode ΔΔC T. </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" width="746"><colgroup><col /><col /></colgroup><tbody><tr height="21"><td height="63" rowspan="3" style="height:62px;width:111px;"> Oct-4-FAM </td><td style="width:636px;"> L&#39;amorce 1: 5&#39;-CCCAAGGAATAGTCTGTAGAAGTG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-TGCATGAGTCAGTGAACAGG-3 &#39;</td></tr><tr height="21"><td height="21" style="height:21px;"> sonde FAM: 5&#39;-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nanog-HEX </td><td> L&#39;amorce 1: 5&#39;-CCTTCTGCGTCACACCATT-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-AACTCTCCAACATCCTGAACC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> sonde HEX: 5&#39;-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> GAPDH-CY5 </td><td> L&#39;amorce 1: 5&#39;-TGTAGTTGAGGTCAATGAAGGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-ACATCGCTCAGACACCATG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> sonde CY5: 5&#39;-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 &#39; </td><html></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nestine-FAM </td><td> L&#39;amorce 1: 5&#39;-AGGACCTGAGCGATCTGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-CGTTGGAACAGAGGTTGGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> sonde FAM: 5&#39;-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> CD133-HEX </td><td> L&#39;amorce 1: 5&#39;-ACTCTCTCCAACAATCCATTCC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-AAACAATTCACCAGCAACGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> sonde HEX: 5&#39;-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 </td></tr></tbody></table> Tableau 1: Amorces utilisées pour le SCC caractérisation par QRT-PCR. e_title &quot;&gt; 4. Des CSC Analyse de surface cellulaire marqueurs CD117 et CD133 <ol><li> CSC récolte en recueillant les médias contenant des cellules et centrifugation à 125 g pendant 5 min. Ajouter 500 ul d&#39;une solution non-protéolytique détachement des cellules de la débâcle des cellules. Centrifuger les cellules à 125 g pendant 5 min pour éliminer la solution de détachement cellulaire. Ensuite, laver les cellules deux fois avec du PBS froid. </li><li> Incuber dans un milieu de croissance normale pendant 1 heure avant de cellules d&#39;étiquetage. Isoler les cellules pendant 5 min à 129 x g. Remettre en suspension les cellules dans du PBS avec 0,1% de BSA avec un anti-CD133-PE et anti-CD117-FITC. </li><li> Fixer les cellules pendant la nuit dans 1% de paraformaldéhyde. Attention: Paraformaldéhyde est toxique (cancérogène suspecté). Faire dans une hotte et d&#39;utiliser moins d&#39;une semaine. </li><li> Effectuer la cytométrie en flux pour analyser le CD117 (avec un anticorps anti-CD117 conjugué à FITC) et CD133 (avec anti-CD133 conjugué à PE) l&#39;expression de surface cellulaire sur un cytomètre de flux. Recueillir des données sur les cellules de la FL1 (pour FITC) et FL3 (PE) pour les canaux. Générer portes pour les cellules exprimant à la foisFITC et PE. Générer un tracé de points avec 4 quadrants (FITC et PE, FITC + PE, PE FITC +, et + FITC et PE +) et de déterminer le nombre de cellules dans chaque quadrant. </li></ol> 5 Analyse CSC pour les interventions thérapeutiques <ol><li> Plaque de 5000 cellules par puits (SKOV3, SKOV3-DP, SKOV3 SCC et SKOV3-DP CCM) sur des plaques à 96 puits pendant la nuit. </li><li> Traiter avec le cisplatine (0, 1, 10, 100 et 1000 pM) ou le paclitaxel (0, 0,01, 0,1, 1, 10 et 100 uM) pendant 96 heures. </li><li> Effectuer MTT (3-(4,5-diméthylthiazol-2-yl) -2,5-diphényltétrazolium) dosage de la viabilité cellulaire. <ol><li> Plate 5.000 cellules par 100 ul par puits sur une plaque de 96 puits (cellules de la plaque en double et comprennent les médias ne contrôlent puits). </li><li> Après 24 h, ajouter 10 ul de 10 mg / ml de MTT. Incuber à 37 ° C pendant 2-4 heures (jusqu&#39;à ce que les formes précipité). </li><li> Ajouter 100 ul de HCl mM MTT solvant 4, 0,1% de NP-40 dans l&#39;isopropanol. Incuber pendant 15 min dans l&#39;obscurité. </li><li> Lire les plaques à 570 nm sur une plaque reader. </li></ol></li></ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

CSC qui sont résistantes à la thérapie peuvent être tenus responsables de rechute après le traitement de la tumeur primitive. Caractérisation des CSC peut conduire à l&#39;amélioration des thérapies pour le cancer de l&#39;ovaire. Les paramètres critiques dans la mise en place de CCF chimiorésistantes utilisant le protocole ci-dessus sont des chronogrammes de la durée du traitement avec la chimiothérapie et la concentration de la chimiothérapie. Lorsque vous utilisez le protocole de Ma et al. il a...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Name of Reagent/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">McCoy</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">16600-108</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">DMEM / F12 serum free</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td style="width:119px;">11320-033</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Minimal Essential Media</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td>42360032</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Sodium Pyruvate</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/11360070">11360070</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Polybrene</td>
			<td style="width:71px;">Millipore</td>
			<td>TR-1003-G</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Blasticidin</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/R21001">R21001</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:71px;">Atlas Biologicals</td>
			<td style="width:119px;">F-0500-A</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Penicillin-streptomycin&#160;</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15070-063</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Cisplatin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T7402-5MG</td>
			<td style="width:167px;">Caution: Toxic Use precautions</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">pLenti-suCMV-Rsv</td>
			<td style="width:71px;">Gentarget</td>
			<td style="width:119px;">LVP023</td>
			<td style="width:167px;">BSL2 approval needed</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Insulin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Human Recombinant EGF&#160;</td>
			<td style="width:71px;">Cell Signaling Technology</td>
			<td style="width:119px;">8916LC</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">bFGF</td>
			<td style="width:71px;">BD biosciences</td>
			<td style="width:119px;">354060</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="41" rowspan="2" style="height:41px;width:216px;">LIF</td>
			<td rowspan="2" style="width:71px;">Santa Cruz</td>
			<td rowspan="2" style="width:119px;">sc-4988A</td>
			<td rowspan="2" style="width:167px;"></td>
		</tr>
		<tr height="21">
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Bovine Serum Albumin</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">03 116 956 001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">TRIzol</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">High Capacity cDNA Reverse Transcription Kit&#160;&#160;</td>
			<td style="width:71px;">Applied Biosystems</td>
			<td style="width:119px;">4368813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IQ Multiplex Powermix</td>
			<td style="width:71px;">BioRad</td>
			<td style="width:119px;">1725849</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Accumax</td>
			<td style="width:71px;">Millipore</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Primers</td>
			<td style="width:71px;">Integrated DNA Technology</td>
			<td style="width:119px;">individually designed and ordered (see protocol for sequnces)</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Anti-CD133 PE</td>
			<td style="width:71px;">Milenyl</td>
			<td>130-098-826</td>
			<td style="width:167px;">Primer/probe sets are light sensitive</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">CD117-Biotin</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">AntiBiotin-FITC</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td>P6148-1KG</td>
			<td style="width:167px;">Caution: Toxic always prepare in hood and make fresh.</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Trypsin</td>
			<td style="width:71px;">Life Technologies</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/25300062">25300062</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)&#160;</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">25200-072</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">EVOS Fl Epifluorescence and Transmitted Light Microscope</td>
			<td>Advanced Microscopy Group</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Biorad CFX96 C1000 System</td>
			<td style="width:71px;">Biorad</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">Beckman Coulter FC500 Flow Cytometer&#160;</td>
			<td style="width:71px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Spectramax 340PC384&#160;</td>
			<td style="width:71px;">Molecular Devices</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

cellules souches du cancer (CCM) sont définies comme un sous-ensemble du cyclisme lente et cellules indifférenciées qui se divisent de façon asymétrique pour générer hautement proliférante, envahissante, et les cellules tumorales chimiorésistantes. Par conséquent, les CSC sont une population intéressante de cellules à cibler thérapeutique. CCM sont prédits pour contribuer à un certain nombre de types de tumeurs malignes, y compris celles dans le sang, le cerveau, les poumons, le tractus gastro-intestinal, de la prostate et de l&#39;ovaire. Isoler et enrichir une population de cellules tumorales pour les CSC permettra aux chercheurs d&#39;étudier les propriétés, la génétique, et la réponse thérapeutique des CSC. Nous avons généré un protocole qui enrichit de manière reproductible pour CCM de cancer ovarien de lignées cellulaires de cancer de l&#39;ovaire (SKOV3 et OVCA429). Les lignées cellulaires sont traitées avec 20 uM de cisplatine pendant 3 jours. Les cellules survivantes sont isolées et mises en culture dans un milieu de cellules souches sans sérum contenant des cytokines et des facteurs de croissance. Nous démontrons un enrichissement de ces CSC purifiés par l&#39;analyse des cellules isolées pour known marqueurs de cellules souches Oct4, Nanog, et PROM1 (CD133) et de l&#39;expression de surface cellulaire de CD177 et CD133. L&#39;exposition CSC a augmenté chimiorésistance. Cette méthode pour l&#39;isolement des CSC est un outil utile pour étudier le rôle des CSC dans la chimiorésistance et la tumeur récidive.

Pour démontrer que nous avons isolé CCF de lignées cellulaires de cancer ovarien épithélial en utilisant un traitement à la cisplatine, nous avons fait l&#39;acquisition des images des lignées de cellules avant le traitement et après la sélection. Nous avons utilisé la microscopie optique pour capturer des images de adhérent (non traité) SKOV3 et OVCA429 cellules et SKOV3 et OVCA429 CSC (Figure 1). CCM apparaissent tour et qui n&#39;est pas attaché à des plaques de culture tissulaire <stro...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

cellules souches du cancer (CCM) sont impliqués dans la rechute de la tumeur en raison de la chimiorésistance. Nous avons optimisé un protocole pour la sélection et l&#39;expansion de la CCF de lignées cellulaires de cancer de l&#39;ovaire. En traitant les cellules avec le cisplatine chimiothérapeutique et la mise en culture d&#39;une cellule souche promotion de médias nous enrichir en cultures SCC non adhérentes.

Enrichissement pour chimiorésistantes cancer de l&#39;ovaire des cellules souches à partir de lignées cellulaires humaines

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K vues.  Indiana University School of Medicine.  cellules souches du cancer (CCM) sont impliqués dans la rechute de la tumeur en raison de la chimiorésistance. Nous avons optimisé un protocole pour la sélection et l'expansion de la CCF de lignées cellulaires de cancer de l'ovaire. En traitant les cellules avec le cisplatine chimiothérapeutique et la mise en culture d'une cellule souche promotion de médias nous enrichir en cultures SCC non adhérentes. 