Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1. Zellkultur und Fluoreszenzmarkierung von Eierstockkrebszelllinien <ol><li> Vorbereitung SKOV3 Medien: McCoy Medium mit 10% fötalem Rinderserum (FBS) ergänzt, 0,1 mM L-Glutamin, 50 U / ml Penicillin und 50 ug / ml Streptomycin. Aufrechterhaltung OVCA429 Zellen in minimalem essentiellen Medium (MEM) mit 10% FBS, 1 mM Natriumpyruvat, 0,1 mM L-Glutamin, 50 U / ml Penicillin und 50 ug / ml Streptomycin. </li><li> Ausbreiten SKOV3 und OVCA429 Zelllinien in einem befeuchteten Inkubator bei 37 ° C mit 5% CO 2. Wachsen Zellen zu 40-50% Konfluenz. </li><li> Erzeugen Zellen rot fluoreszierendes Protein (RFP), um die Lebensfähigkeit in vitro und in vivo zu überwachen ausdrückt. <ol><li> SKOV3-Zellen zu exprimieren, zu erzeugen RFP, fügen lentivirale Partikel RFP und 10 ug / ml Polybrene zu SKOV3 Medien exprimiert in Abwesenheit von Penicillin und Streptomycin 72 Stunden. </li><li> Nach 72 h, wählen Sie für RFP-positiven Zellen durch Fluorescence Activated Cell Sorting (FACS) wie folgt: Trypsinize RFP und nicht-RFP-exprimierenden Zellen, Zentrifugieren bei 125 xg für 5 min Die Zellen bei 10 7 Zellen / ml in PBS mit 0,1% BSA. Auf einem Zellsortierer, verwenden Sie nicht-RFP Zellen, um die Sortierparameter zu bestimmen. Dann sammeln Zellen, die hohe RFP mit einem 561-nm-Laser auszudrücken. </li><li> Alternativ, wenn der lentiviralen Plasmid eine antibiotische Resistenz-Kassette drückt, wählen RFP-exprimierenden Zellen durch Kultivieren in dem entsprechenden Antibiotikum (wie beispielsweise 10 mg / ml Blasticidin). HINWEIS: Die Höhe der lentivirale Partikel, die verwendet werden können, und Chargen durch Zelltyp variieren werden muss. Ordnungsgemäße lentiviralen Titer sollte für jeden Zelltyp bestimmen. </li></ol></li></ol> 2. Anreicherung von Krebsstammzellen <ol><li> Gönnen SKOV3, SKOV3-RFP oder OVCA429 Zelllinien mit 20 uM von Cisplatin 72 Stunden. ACHTUNG: Cisplatin ist giftig. Verwenden Sie Schutzkleidung / Schutzhandschuhe und Kontakt mit Haut und Schleimhäuten vermeiden. Sie Cisplatin i entsorgenn Abwasser. </li><li> Vorbereitung CSC Medien: serumfreiem DMEM / F12-Medium mit 5 ug / ml Insulin, 10 ng / ml humanem rekombinantem epidermalem Wachstumsfaktor (EGF), 10 ng / ml basischen Fibroblastenwachstumsfaktor (bFGF), 12 ng / ml Leukemia Inhibitory Factor ergänzt und 0,4% Rinderserumalbumin (BSA). </li><li> Trypsinize Zellen. Kultur überlebenden Zellen in CSC Medien. HINWEIS: Nach 2 Tagen in Kultur nicht haft Sphäroiden wird zu bilden. </li><li> Wechselmedien alle 2 Tage durch Sammeln Medien enthaltenden Zellen und Zentrifugation bei 125 × g für 5 min. Dann das Pellet in frischem CSC Medien. Überprüfen Zellen für die Lebensfähigkeit alle 2 Tage durch Zählen der Zellen und die Durchführung Trypanblauausschluß. </li><li> Dann sammeln CSC für weitere Experimente durch Zentrifugation 129 g für 5 Minuten und Resuspendieren des Pellets in Phenol enthält Guanidinium thiocynate (RNA), Phosphat-gepufferte Salzlösung (PBS: 137 mM NaCl, 2,7 mM KCl, 11,9 mM Phosphatpuffer, pH 7,4) mit 0,1% BSA (für die Durchflusszytometrie) oder CSC Medien weiterKultivieren der Zellen. </li><li> Überwachen CSC Zellmorphologie mit einem Lichtmikroskop bei 20facher und 40facher Vergrößerung. </li></ol> 3. CSC Charakterisierung über Genexpressionsanalyse für Stammzellmarker <ol><li> Sammle 3 Präparationen von CSC durch Sammeln von Medium, das Zellen, Zentrifugieren bei 129 xg für 5 Minuten und Resuspendieren des Pellets in einer Lösung von Phenol, enthaltend Guanidiniumthiocyanat thiocynate (andere Methoden zur RNA-Extraktion verwendet werden können). </li><li> Vorbereitung der Gesamt-RNA unter Verwendung von TRIzol nach dem Protokoll des Herstellers. Synthese von komplementärer DNA (cDNA) von 0,1 bis 1 ug RNA mit einem kommerziell erhältlichen cDNA-Reverse Transkription-Kit. </li><li> Führen quantitative reverse Transkription-Polymerase-Kettenreaktion (qRT-PCR). <ol><li> Make-up Master-Mix für jeden Satz von Primern, welche QRT-PCR-Mix, Primer und Wasser auf insgesamt 8 ul pro Probe (Primer mit unterschiedlichen Fluorophore können in der gleichen gut verstärkt werden). Zum Beispiel erzeugenein Master-Mix für Oct4-FAM, Nanog-Hex und GAPDH-CY5. Erzeugen separaten Master Mixes für Nestin und PROM1. Add 2 ul cDNA-Matrize pro Probe. HINWEIS: Für diese Studie qRT-PCR wurde unter Verwendung der in Tabelle 1 aufgelisteten Primer. </li><li> Führen Sie alle QRT-PCR in zweifacher Ausfertigung für jede Probe mit einer Echtzeit-PCR-Thermocycler Aufspüren von mehreren Fluorophore. Enthalten keine Template-Kontrollen. </li><li> Normalisieren Stammzellen Genexpression GAPDH Ausdruck für jede Probe mit der ΔΔC T-Methode. </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" width="746"><colgroup><col /><col /></colgroup><tbody><tr height="21"><td height="63" rowspan="3" style="height:62px;width:111px;"> Oct-4-FAM </td><td style="width:636px;"> Primer 1: 5&#39;-CCCAAGGAATAGTCTGTAGAAGTG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-TGCATGAGTCAGTGAACAGG-3 &#39;</td></tr><tr height="21"><td height="21" style="height:21px;"> FAM-Sonde: 5&#39;-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nanog-HEX </td><td> Primer 1: 5&#39;-CCTTCTGCGTCACACCATT-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-AACTCTCCAACATCCTGAACC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> HEX-Sonde: 5&#39;-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> GAPDH-CY5 </td><td> Primer 1: 5&#39;-TGTAGTTGAGGTCAATGAAGGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-ACATCGCTCAGACACCATG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> CY5 Sonde: 5&#39;-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 &#39; </td><html></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> NESTIN-FAM </td><td> Primer 1: 5&#39;-AGGACCTGAGCGATCTGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-CGTTGGAACAGAGGTTGGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> FAM-Sonde: 5&#39;-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> CD133-HEX </td><td> Primer 1: 5&#39;-ACTCTCTCCAACAATCCATTCC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Primer 2: 5&#39;-AAACAATTCACCAGCAACGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> HEX-Sonde: 5&#39;-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 </td></tr></tbody></table> Tabelle 1. Primer für CSC Charakterisierung von QRT-PCR verwendet. e_title &quot;&gt; 4. Analyse CSCs für Zelloberflächenmarker CD117 und CD133 <ol><li> Ernte CSC durch Sammeln von Medium, das Zellen und Zentrifugation bei 125 × g für 5 min. Fügen Sie 500 ul einer nicht-proteolytischen Zellablösung Lösung Break-up-Zellen. Zentrifuge Zellen bei 125 × g für 5 min, um die Zellentfernungslösung zu entfernen. Dann waschen Sie die Zellen zweimal mit kaltem PBS. </li><li> Inkubieren in normalem Wachstumsmedium für 1 h vor der Markierung Zellen. Spin-down-Zellen für 5 min bei 129 x g. Die Zellen in PBS mit 0,1% BSA mit anti-CD133-PE und anti-CD117-FITC. </li><li> Fix Zellen über Nacht in 1% Para. Achtung: Paraformaldehyd ist giftig (Verdacht auf krebserzeugende Stoffe). Machen in Abzug und innerhalb von einer Woche. </li><li> Führen Durchflusszytometrie auf CD117 (mit einem anti-CD117 FITC konjugiert) und CD133 (mit Anti-CD133 PE konjugiert) Zelloberflächenexpression auf einem Durchflusszytometer analysiert. Sammeln Sie Daten auf Zellen in der FL1 (für FITC) und FL3 (für PE)-Kanäle. Erzeugen Tore für beide Zellen exprimierenFITC und PE. Erzeugen ein Punkt-Diagramm mit 4 Quadranten (FITC- und PE-, FITC + PE, PE FITC- + und + FITC und PE +) und bestimmen Sie die Anzahl der Zellen in jedem Quadranten. </li></ol> 5. Analyse CSCs für therapeutische Reaktion <ol><li> Platte 5000 Zellen pro Well (SKOV3, SKOV3-RFP, SKOV3 CSC und SKOV3-RFP CSCs) auf 96-Well-Platten über Nacht. </li><li> Behandle mit Cisplatin (0, 1, 10, 100 und 1000 um) und Paclitaxel (0, 0,01, 0,1, 1, 10 und 100 uM) für 96 Stunden. </li><li> Führen MTT (3-(4,5-Dimethylthiazol-2-yl) -2,5-diphenyltetrazoliumbromid) Zelllebensfähigkeitstest. <ol><li> Platte 5000 Zellen pro 100 ul pro Well auf einer 96-Well-Platte (Plattenzellen in zweifacher Ausfertigung und gehören Medien nur steuern Brunnen). </li><li> Nach 24 Stunden werden 10 ul 10 mg / ml MTT. Bei 37 ° C für 2-4 Stunden (bis zum Niederschlag). </li><li> 100 l MTT Lösungsmittel 4 mM HCl, 0,1% NP-40 in Isopropanol. Die Proben für 15 min im Dunkeln. </li><li> Lesen Platten bei 570 nm auf einem Teller rEADER. </li></ol></li></ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

CSCs, die therapieresistent sind, können nach der Behandlung des Primärtumors verantwortlich für den Rückfall sein. Charakterisierung von CSCs zu verbesserten Therapien für Eierstockkrebs führen. Die kritischen Parameter in der Einrichtung chemoresistentem KSZ Verwendung des obigen Protokolls sind Zeit die Länge der Behandlung mit Chemotherapie und die Konzentration der Chemotherapie. Wenn unter Verwendung des Protokolls in Ma et al. es wurde festgestellt, daß nach 7 Tagen der Behandlung mit Cisplatin u...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Name of Reagent/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">McCoy</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">16600-108</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">DMEM / F12 serum free</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td style="width:119px;">11320-033</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Minimal Essential Media</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td>42360032</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Sodium Pyruvate</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/11360070">11360070</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Polybrene</td>
			<td style="width:71px;">Millipore</td>
			<td>TR-1003-G</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Blasticidin</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/R21001">R21001</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:71px;">Atlas Biologicals</td>
			<td style="width:119px;">F-0500-A</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Penicillin-streptomycin&#160;</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15070-063</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Cisplatin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T7402-5MG</td>
			<td style="width:167px;">Caution: Toxic Use precautions</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">pLenti-suCMV-Rsv</td>
			<td style="width:71px;">Gentarget</td>
			<td style="width:119px;">LVP023</td>
			<td style="width:167px;">BSL2 approval needed</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Insulin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Human Recombinant EGF&#160;</td>
			<td style="width:71px;">Cell Signaling Technology</td>
			<td style="width:119px;">8916LC</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">bFGF</td>
			<td style="width:71px;">BD biosciences</td>
			<td style="width:119px;">354060</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="41" rowspan="2" style="height:41px;width:216px;">LIF</td>
			<td rowspan="2" style="width:71px;">Santa Cruz</td>
			<td rowspan="2" style="width:119px;">sc-4988A</td>
			<td rowspan="2" style="width:167px;"></td>
		</tr>
		<tr height="21">
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Bovine Serum Albumin</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">03 116 956 001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">TRIzol</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">High Capacity cDNA Reverse Transcription Kit&#160;&#160;</td>
			<td style="width:71px;">Applied Biosystems</td>
			<td style="width:119px;">4368813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IQ Multiplex Powermix</td>
			<td style="width:71px;">BioRad</td>
			<td style="width:119px;">1725849</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Accumax</td>
			<td style="width:71px;">Millipore</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Primers</td>
			<td style="width:71px;">Integrated DNA Technology</td>
			<td style="width:119px;">individually designed and ordered (see protocol for sequnces)</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Anti-CD133 PE</td>
			<td style="width:71px;">Milenyl</td>
			<td>130-098-826</td>
			<td style="width:167px;">Primer/probe sets are light sensitive</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">CD117-Biotin</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">AntiBiotin-FITC</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td>P6148-1KG</td>
			<td style="width:167px;">Caution: Toxic always prepare in hood and make fresh.</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Trypsin</td>
			<td style="width:71px;">Life Technologies</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/25300062">25300062</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)&#160;</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">25200-072</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">EVOS Fl Epifluorescence and Transmitted Light Microscope</td>
			<td>Advanced Microscopy Group</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Biorad CFX96 C1000 System</td>
			<td style="width:71px;">Biorad</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">Beckman Coulter FC500 Flow Cytometer&#160;</td>
			<td style="width:71px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Spectramax 340PC384&#160;</td>
			<td style="width:71px;">Molecular Devices</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

Krebsstammzellen (CSCs) als Teilmenge von langsamen Radfahren und undifferenzierte Zellen, die asymmetrisch zu teilen, um hoch proliferativen, invasive erzeugen und chemoresistenten Tumorzellen definiert. Daher sind KSZ eine attraktive Population von Zellen therapeutisch zu zielen. KSZ wird vorhergesagt, zu einer Anzahl von Arten von Malignitäten einschließlich derjenigen im Blut, Gehirn, Lunge, Magen, Darm, Prostata und des Eierstocks bei. Isolierung und Anreicherung einer Tumorzellpopulation für CSCs ermöglichen es den Forschern, die Eigenschaften, Genetik und therapeutische Reaktion von CSCs studieren. Wir erzielten ein Protokoll, das reproduzierbar bereichert für Eierstockkrebs Eierstockkrebs von CSCs Zelllinien (SKOV3 und OVCA429). Zelllinien werden mit 20 uM Cisplatin für 3 Tage behandelt. Überlebende Zellen werden isoliert und kultiviert in serumfreiem Medium, das Stammzell Zytokinen und Wachstumsfaktoren. Wir zeigen eine Anreicherung dieser gereinigten CSCs durch die Analyse der isolierten Zellen für known Stammzellmarker Oct4, Nanog und PROM1 (CD133) und Zelloberflächenexpression von CD177 und CD133. Die CSCs eine erhöhte Chemoresistenz. Diese Methode zur Isolierung von CSCs ist ein nützliches Werkzeug für die Untersuchung der Rolle von CSCs in Chemoresistenz und Tumorrückfall.

Um zu zeigen, dass wir isoliert KSZ von epithelialen Eierstockkrebszelllinien unter Verwendung von Cisplatin-Behandlung wir zunächst aufgenommenen Bildern der Zelllinien vor der Behandlung und nach der Selektion. Wir haben die Lichtmikroskopie, um Bilder von adhärenten (unbehandelt) und SKOV3 OVCA429 Zellen und SKOV3 und OVCA429 CSCs (Abbildung 1) zu erfassen. CSCs rund und nicht erscheinen, um die Gewebekulturplatten befestigt (Abbildungen 1 und 2). Wir zeigen weiter...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Krebsstammzellen (CSCs) in Tumorrückfall durch Chemoresistenz beteiligt ist. Wir haben ein Protokoll für die Auswahl und den Ausbau von CSCs von Eierstock-Krebszelllinien optimiert. Durch die Behandlung mit dem Chemo Zellen Cisplatin und Kultivierung in einer Stammzelle Förderung der Medien bereichern wir für nicht haft CSC Kulturen.

Bereicherung für chemoresistenten Eierstockkrebs Stammzellen aus menschlichen Zelllinien

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K Aufrufe.  Indiana University School of Medicine.  Krebsstammzellen (CSCs) in Tumorrückfall durch Chemoresistenz beteiligt ist. Wir haben ein Protokoll für die Auswahl und den Ausbau von CSCs von Eierstock-Krebszelllinien optimiert. Durch die Behandlung mit dem Chemo Zellen Cisplatin und Kultivierung in einer Stammzelle Förderung der Medien bereichern wir für nicht haft CSC Kulturen. 