Name: systemic bacterial infection and immune defense phenotypes in drosophila melanogaster
Uploaded: 2015-05-13T13:00:00.000+00:00
Duration: 10 min 12 s
Description: Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

El procedimiento descrito aquí produce infección rigurosa y de alta calidad de Drosophila melanogaster. Los ejemplos ilustrados se centraron principalmente en la infección con Providencia rettgeri y E. coli, pero el protocolo es altamente adaptable y se puede aplicar a las infecciones con diversas bacterias sobre un rango de condiciones de cría de acogida y de mantenimiento. Los detalles de un enfoque experimental óptima dependerá de la bacteria utilizada para la infección, el genotipo del huésped, y las condiciones experimentales generales. Se recomienda encarecidamente a prueba piloto nuevas condiciones experimentales antes de iniciar los proyectos más ambiciosos. Un buen punto de partida es poner a prueba tres dosis de infección en un rango de 100 veces. Altamente patógenos virulentos son a menudo mejor introdujeron en dosis infecciosas muy bajas, del orden de 10 a 100 células bacterianas por mosca. Patógenos más moderadas pueden ser inyectados con dosis más altas de alrededor de 1.000 bacterias por fly, y los no patógenos pueden ser inyectados con dosis de hasta 10.000 bacterias por mosca. A menudo es instructiva para definir la cinética de nuevas infecciones por el seguimiento de la carga de patógenos, la mortalidad de acogida, y la actividad del sistema inmune a través de una serie de tiempo longitudinal. Dado que la medición de la carga de patógenos y la expresión génica de acogida son ensayos destructivos, es necesario para infectar las moscas distintas desde el principio del experimento para cada punto de tiempo que se va a medir. Al decidir si utilizar pinchazo o inyección a base de microcapilar, es importante tener en cuenta que hay ventajas y limitaciones de cada enfoque. Inyección capilar introduce un volumen de líquido en la marcha, que tanto aumenta la presión de turgencia y modestamente introduce sales u otras moléculas que están suspendidos o disueltos en el vehículo. Inyección capilar también requiere el acceso a un centro de inyección o compra de los equipos necesarios. Pinchazo séptico no requiere equipo e introduce especialmedios insignificantes en la marcha, y es típicamente más eficiente para infectar a un gran número de moscas. Sin embargo, las infecciones pinchazo no permiten el control preciso sobre dosis de infección que se puede lograr con la inyección capilar. El presente protocolo se centró en un aparato de inyección que regula mecánicamente volumen de inyección, pero también hay sistemas de inyección basado en pulsos discretos de aire a presión. 20,21 Estos son típicamente más caros que el aparato ofrece aquí y requieren de calibración del impulso de aire a cada aguja con el fin de asegurar volúmenes de inyección consistentes. Existe un considerable debate, pero muy pocos datos sobre cómo las moscas se convierten sistémicamente infectado con bacterias en el medio silvestre. Algunos investigadores postulan que la mayoría de las infecciones naturales se producen cuando Drosophila ingerir bacterias patógenas y las bacterias son capaces de escapar posteriormente el intestino para establecer una infección sistémica. Sin embargo, hay muy Febacterias w sabe que son capaces de atravesar el intestino de D. melanogaster, y los que sí tienen esta capacidad son altamente letal para las moscas 22,23. Una teoría alternativa es que vuela regularmente sufrir lesiones cuticulares través de escapar de los intentos fallidos de depredación o ataque de ácaros ectoparásitos. Esta hipótesis está apoyada por la recogida frecuente de salvaje D. melanogaster teniendo manchas melanization que son indicativos de heridas cicatrizadas (observaciones no publicadas). Los ácaros se han demostrado para transmitir infecciones bacterianas en Drosophila y 24 heridas dejadas por los ácaros pueden ser secundariamente infectadas por bacterias en las abejas de miel 25. Sin embargo, la frecuencia en la naturaleza de la infección-ácaros impulsado o de otra manera oportunista de D. melanogaster través de las infracciones de la cutícula no se conoce. El protocolo descrito aquí permite la introducción de bacterias directamente en la hemolinfa través de la inyección cuantitativa que evita cualquier barreras epiteliales o Immu de comportamientonidad. Métodos para la alimentación de las bacterias patógenas a D. melanogaster han sido descritos en Vodovar et al. 22 y Nehme et al. 23. Muchas bacterias entomopatógenos representan poco o ningún riesgo para la salud humana, lo que permite a los investigadores a trabajar con ellos cómodamente. Además, muy pocas bacterias tienen la capacidad de infectar a Drosophila en contacto sin intervención experimental, por lo que el riesgo de &quot;epidemia&quot; propagación de la infección bacteriana a través de un laboratorio a través de superficies contaminadas o escaparon moscas es generalmente muy baja. No obstante, es recomendable asegurarse de que las medidas de contención adecuadas en el lugar para evitar que las moscas infectadas se escape y para recuperar cualquier moscas escaparon. El laboratorio debe ser equipado a un nivel de seguridad biológica en consonancia con la de los agentes patógenos que se utiliza, y se debe emplear las mejores prácticas estándar en microbiología. El infecti experimentalen el método descrito aquí permite infecciones de Drosophila melanogaster con cualquier dosis de cualquier bacteria arbitraria. Una vez que la infección se ha establecido, es sencillo para medir la cinética de proliferación o la eliminación de bacterias, el seguimiento de la mortalidad acogida, y para ensayo de inducción del sistema inmune del huésped. Moscas infectadas pueden ser fácilmente sometidos a otros ensayos fenotípicos, incluyendo pruebas de funciones fisiológicas que pueden dar forma o se forma por la infección. Los procedimientos descritos son de bajo costo, requieren relativamente poco equipo especializado, y se aprenden fácilmente, haciéndolos susceptibles para su uso en diversos proyectos a través de una amplitud de laboratorios de investigación y docencia.

La mosca de la fruta Drosophila melanogaster es uno de los organismos modelo de primera clase para el estudio de la función y la evolución de la defensa inmune. Drosophila son baratos y fáciles de criar, son altamente susceptibles a la manipulación experimental, y están respaldados por una amplia comunidad científica que ha desarrollado una amplia variedad de herramientas de investigación. Muchos aspectos de la inmunidad innata se conservan entre los insectos y mamíferos, incluyendo la transducción de señales mediada por los receptores Toll-like y NF-kB factores de transcripción de la familia, de señalización JAK / STAT, y las respuestas de la vía JNK. 1,2 La función de estos genes y vías lata ser consultados en el D. melanogaster mediante mutaciones o RNAi caídas que aumentan o vía disminución actividades. 3 - 6 Además, Drosophila se puede utilizar para estudiar las consecuencias fisiológicas de la infección y la enfermedad, incluso en el contexto de la teoría evolutiva historia de vida 7.- 9 Todos estos estudios, sin embargo, dependen de la capacidad de infectar de forma fiable moscas experimentales bajo condiciones de tratamiento definidos. El procedimiento descrito aquí presenta un marco metodológico para la entrega de infecciones bacterianas robustos y repetibles a Drosophila melanogaster y posteriormente medir la gravedad de la infección y la cuantificación de la respuesta inmune del huésped. Drosophila puede ser natural y experimentalmente infectado por una amplia variedad de parásitos y agentes patógenos, incluyendo bacterias, hongos, virus, nematodos y avispas parasitoides. El protocolo actual se centra en la entrega de la infección bacteriana sistémica. Muchas bacterias diferentes se pueden utilizar para infectar las moscas, y la elección del experimentador deben basarse en las cuestiones científicas precisas que nos pidieron. Por ejemplo, los aislados clínicos humanos se pueden emplear para estudiar los mecanismos de virulencia bacteriana 10, o ecológicamente cepas pertinentes pueden ser preferred para el estudio de la evolución. 11 Algunas bacterias son patógenos competentes de D. melanogaster, la proliferación tras la infección y causar la enfermedad de host o la muerte. Otras bacterias se administran eficazmente por el sistema inmune del huésped y borran dentro de unos pocos días. En esta demostración, Providencia rettgeri será utilizado como un patógeno proliferativa que puede causar la mortalidad de acogida y persiste en huéspedes supervivientes. Escherichia coli se utilizará como un no patógeno que se elimina por el sistema inmune del huésped. La infección se estableció mediante la introducción de bacterias directamente en la cavidad del cuerpo de la mosca. Este enfoque evita las barreras epiteliales y comportamientos de protección, lo que permite la investigación de la infección sistémica con independencia del modo natural de transmisión. Hay dos métodos principales para establecer experimentalmente la infección sistémica. En el primero, un nanoinjector y capilares de vidrio tirado agujas se utilizan para inyectar un número preciso debacterias en la marcha. Este método tiene las ventajas de permitir un gran rango dinámico de dosis de infección y de ser cuantitativamente altamente repetible. El segundo enfoque es entregar la infección con un pinchazo séptico. Este enfoque tiene las ventajas de ser rápido y no requiere equipo especial. Una vez establecidas las infecciones, se hace posible medir la carga sistémica patógeno, la mortalidad de acogida, y la actividad inducible sistema inmunológico. Por supuesto, cualquier número de fenotipos adicionales posiblemente podría medirse en D. infectada melanogaster, incluyendo post-infección fecundidad 12, la capacidad de aprendizaje 13, estado metabólico 14, o prácticamente cualquier otro rasgo que se puede imaginar.

<table><tbody><tr><td>Incubator</td><td>Powers Scientific, Inc</td><td>DROS52SD</td><td></td></tr><tr><td>Paintbrush</td><td></td><td></td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Flypads</td><td>FlyStuff</td><td>59-114</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt;</td><td>Airgas</td><td>CD FG50</td><td></td></tr><tr><td>Drosophila rearing mix&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>6 oz Square Bottom Bottles, polypropylene</td><td>Genesee Scientific</td><td>32-130</td><td></td></tr><tr><td>Nosterile Extra Large Cotton Balls</td><td>Fisher brand</td><td>22-456-882</td><td></td></tr><tr><td>Microscope</td><td>Olympus Corporation</td><td>SZ51</td><td></td></tr><tr><td>Drosophila Vials polystyrene</td><td>VWR international</td><td>89092-720</td><td></td></tr><tr><td>Nosterile Large Cotton Balls</td><td>Fisher brand</td><td>22-456-883</td><td></td></tr><tr><td>2 L flask</td><td>VWR international</td><td>89000-370</td><td></td></tr><tr><td>Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm;</td><td>VWR international</td><td>25384-302</td><td></td></tr><tr><td>LB Agar, Miller</td><td>Difco</td><td>244520</td><td></td></tr><tr><td>Innoculing Loop</td><td>VWR international</td><td>80094-488</td><td></td></tr><tr><td>Rainin Clasic Pipettes in various sizes&lt;br/&gt; 0.1 &amp;micro;l to 2 &amp;micro;l,&lt;br/&gt; 2 &amp;micro;l to 20 &amp;micro;l,&lt;br/&gt; 20 &amp;micro;l to 200 &amp;micro;l,&lt;br/&gt; 100 &amp;micro;l to 1,000 &amp;micro;l</td><td>Rainin</td><td>PR-2&lt;br/&gt; PR-20&lt;br/&gt; PR-200&lt;br/&gt; PR-1000</td><td></td></tr><tr><td>Micropipette tips (assorted sizes)</td><td>VWR international</td><td>30128-376&lt;br/&gt; 53503-810&lt;br/&gt; 16466-008</td><td></td></tr><tr><td>Luria Broth Base, Miller</td><td>Difco</td><td>241420</td><td></td></tr><tr><td>Disposable Culture Tubes Borosilicate Glass</td><td>VWR international</td><td>47729-576</td><td></td></tr><tr><td>S-500 Orbital Shaker</td><td>VWR international</td><td>14005-830</td><td></td></tr><tr><td>Centrifuge</td><td>VWR international</td><td>37001-300</td><td></td></tr><tr><td>PBS pH 7.4 10X</td><td>Invitrogen</td><td>70011044</td><td></td></tr><tr><td>SmartSpec 3000 Spectrophotometer</td><td>Bio-Rad</td><td>170-2501</td><td></td></tr><tr><td>Semimicrovolume Cuvettes</td><td>Bio-Rad</td><td>223-9955</td><td></td></tr><tr><td>Vertical Capillary Puller</td><td>Kopf Needle Pipette Puller</td><td></td><td></td></tr><tr><td>3.5&#039;&#039; Replacement glass Capillaries for Nanojet II</td><td>Drummond Sientific Company</td><td>3-000-203-G/X</td><td></td></tr><tr><td>Nanoject II</td><td>Drummond Sientific Company</td><td>3-000-204</td><td></td></tr><tr><td>Forceps</td><td>Fine Science Tools</td><td>11255-20</td><td></td></tr><tr><td>10 ml Syringe</td><td>BD</td><td>309604</td><td></td></tr><tr><td>Mineral Oil, White, light</td><td>Macron Fine Chemicals</td><td>6358-10</td><td></td></tr><tr><td>Minutein pins</td><td>Fine Science Tools</td><td>26002-10</td><td></td></tr><tr><td>1.5 ml&amp;nbsp; Microcentrifuge tubes; Seal Rite</td><td>USA Scientific Inc.</td><td>1615-5500</td><td></td></tr><tr><td>Motorized Pestle; Talboys Laboratory Stirrer</td><td>Troemner</td><td>103</td><td></td></tr><tr><td>Talboys High Throughput Homogenizer</td><td>OPS Diagnostics</td><td>930145</td><td></td></tr><tr><td>5/32&#039;&#039; Grinding Balls</td><td>OPS Diagnostics</td><td>GBSS 156-5000-01</td><td></td></tr><tr><td>Vortex Genie</td><td>Scientific indurstries inc.</td><td>G560</td><td></td></tr><tr><td>Multichannel Pipettor (10 &amp;mu;l - 300 &amp;mu;l)</td><td>Sartorius</td><td>730360</td><td></td></tr><tr><td>WASP2 Whitley Automated Spiral Plater</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>ProtoCOL automated colony counter / plate counter/ plate reader&amp;nbsp;</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>TRIzol</td><td>Life Technologies</td><td>15596-026</td><td></td></tr><tr><td>qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td><td>Bio-Rad</td><td>TLS0801</td><td></td></tr><tr><td>qPCR caps; Optical Flat 8-Cap Strips</td><td>Bio-Rad</td><td>TCS0803</td><td></td></tr><tr><td>RQ1 RNase-Free DNase</td><td>Promega</td><td>m610a</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Promega</td><td>m170b</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1240</td><td></td></tr><tr><td>Oligo-dT</td><td>IDT</td><td></td><td></td></tr><tr><td>&amp;nbsp;SsoAdvanced SYBR Green Supermix</td><td>Bio-Rad</td><td>172-5260</td><td></td></tr><tr><td>CFX Connect Real-Time PCR Detection System</td><td>Bio-Rad</td><td>185-5200</td><td></td></tr><tr><td>RNasin Ribonuclease Inhibitor</td><td>Promega</td><td>N2115</td><td></td></tr></tbody></table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

La mosca de la fruta Drosophila melanogaster es uno de los organismos modelo de primera clase para el estudio de la función y la evolución de la defensa inmune. Muchos aspectos de la inmunidad innata se conservan entre insectos y mamíferos, y desde Drosophila puede ser fácilmente manipulado genéticamente y experimentalmente, que son de gran alcance para el estudio de la función del sistema inmune y las consecuencias fisiológicas de la enfermedad. El procedimiento ha demostrado aquí permite la infección de las moscas por la introducción de bacterias directamente en la cavidad del cuerpo, por encima de las barreras epiteliales y formas más pasivas de defensa y permitiendo enfoque en la infección sistémica. El procedimiento incluye protocolos para las tasas de mortalidad de medición anfitrión, la carga de patógenos sistémica, y el grado de inducción del sistema inmune del huésped. Este procedimiento de infección es barato, robusto y cuantitativamente repetible, y se puede utilizar en estudios de genética funcional, la historia evolutiva, la vida y la fisiología.

Esta sección ilustra los resultados que se pueden obtener después de la infección bacteriana de Drosophila melanogaster. Figura 1 muestra que dosis de infección varía con la densidad óptica de la suspensión bacteriana utilizada para la inyección, y que la dosis administrada puede ser estimado de manera fiable por homogeneización y el chapado vuela inmediatamente después de la inyección . Como se ilustra en la Figura 2, diferentes patógenos pueden causar diferentes niveles de mortalidad host (Figura 2A) y la mortalidad huésped puede ser (Figura 2B) dependiente de la dosis. Es importante destacar que este protocolo permite diferentes tipos de infecciones que deben alcanzarse: Providencia rettgeri puede causar una infección crónica, subletal que persiste durante 20 días o más (Figura 3A). Sin embargo, otras bacterias como Escerichia coli mayormente se borrarán por la mosca de acogida dentro de seis horas después de la infección (Figura 3B). La inducción de los sys inmunesTEM se puede estimar a través de aislamiento de ARN y posterior qRT-PCR de los transcritos de péptidos antibacterianos (Figura 4A y B). Análogamente pero menos cuantitativamente, las moscas que expresan GFP bajo el control de promotores de genes de péptido antimicrobiano puede ser utilizado para visualizar la inducción del sistema inmune (Figura 4C). <img alt="Figura 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> . Figura 1: Determinación de la dosis infecciosa Las moscas fueron inyectados con 50 nl de suspensiones bacterianas que cubren una gama de densidades ópticas (0,0001 a 0,05). Las moscas fueron inmediatamente homogeneizada y se sembraron para determinar el número de bacterias introducido por la inyección. Carga bacteriana inicial se correlaciona fuertemente con OD inicial inyectada (r 2 = 0,96) <img alt="Figura 2" src="/files/ftp_upload/52613/52613fig2.jpg" /> <strong&gt; Figura 2:. supervivencia después de la inyección con patógenos bacterianos Cinco a siete machos viejos día se inyectaron con 50 nl de cualquiera de suspensión bacteriana o medios estériles y se controló para la supervivencia. (A) Tipo de moscas salvajes fueron inyectados con aproximadamente 5.000 bacterias de de una de las tres especies diferentes. La tasa de mortalidad huésped depende en gran medida de las especies bacterianas usadas para la infección. (B) Tipo moscas salvajes fueron inyectados con tres dosis diferentes de Enterococcous faecalis - 50, 500, y 5000 bacterias por mosca. Las moscas mueren más rápidamente cuando se infectan con dosis más altas infecciosas (C) Un mutante sistema inmune y su línea de control isogénicas de tipo salvaje fueron inyectados con aproximadamente 500 Burkholderia cepacia. Una comparación por parejas Log-Rank muestra que la mosca de tipo salvaje sobrevive a la infección significativamente mejor que el mutante (χ 2 = 59,02, df = 1, p &lt;0,0001). Figura 3:. Carga bacteriana después de la inyección Las moscas fueron inyectados con aproximadamente (A) 5000 P. rettgeri (B) 3400 E. coli. La carga bacteriana se determinó inmediatamente después de la inyección y en varios puntos de tiempo posteriores. Cada punto de datos representa la carga bacteriana de una sola mosca. E. coli se elimina rápidamente de anfitriones impugnados mientras que P. rettgeri persiste durante el resto de la vida del anfitrión ,. <img alt="Figura 4" src="/files/ftp_upload/52613/52613fig4.jpg" /> Figura 4: Inducción de la expresión génica inmune después de la inyección. Las moscas (A) se inyectaron con 50 nl de P. PBS rettgeri o estéril, ya sea en el abdomen o el tórax, o se dejaron sin manipular aparte de CO <sub&gt; 2 anestesia. Seis horas después de la infección, las moscas fueron recolectados para el aislamiento de ARN y la expresión de la Diptericin Un gen se determinó utilizando qRT-PCR. (A) Los niveles de expresión se representan gráficamente como la relación de Diptericin Una transcripción de transcripción rp49 y ampliarse de manera que el control de CO 2 se define como tener un nivel de expresión de 1. Las barras representan la media y el error estándar de las proporciones de cada condición (n = 4). Niveles (B) de expresión se grafican como ΔΔCT 2 con el valor promedio de C T de CO 2 de control de moscas aesthesia utilizados como la condición no inducido estándar. Las barras representan el error medio y estándar de ΔΔC T de cada condición (n = 4). Mientras que no hay diferencia en la inducción de la transcripción debido a sitio de la inyección, la comparación de los paneles A y B muestra cómo el método ΔΔC T potencialmente puede sobreestimar los niveles de inducción. (C) Moscas que expresan GFP bajo el control del Diptericin Un promotor se inyectaron con 50 nl de P. rettgeri (OD = 0,1) y luego fotografiada 7 días más tarde. El panel de GFP muestra la expresión de GFP en el cuerpo la grasa abdominal de moscas infectadas, lo que indica la activación de la Diptericin Un promotor en las moscas infectadas por bacterias, pero no los controles con inyección de medios de comunicación. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gene </td><td> Adelante </td><td> Reverse </td></tr><tr><td> rp49 (también llamado RPL32) </td><td> 5 &#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5 &#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> Diptericin A </td><td> 5 &#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5 &#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Drosomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5 &#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensina </td><td> 5 &#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5 &#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> Attacin A </td><td> 5 &#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5 &#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5 &#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5 &#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> Tabla 1: Los cebadores para QRT-PCR.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

La infección bacteriana sistémica y Defensa Inmune fenotipos en<em&gt; Drosophila melanogaster</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.5K vistas.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Video: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Una introducción a las avispas parasitarias de<em&gt; Drosophila</em&gt; Y la respuesta inmune antiparasitario

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Investigación

Inmunología e Infección

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is a model for understanding microbial interactions with animal hosts, facilitated by approaches to rear large sample sizes of Drosophila under microorganism-free (axenic) conditions, or with defined microbial communities (gnotobiotic). This work outlines a method for collection of Drosophila embryos, hypochlorite dechorionation and sterilization, and transfer to sterile diet. Sterilized embryos are transferred to sterile diet in 50 ml centrifuge tubes, and developing larvae and adults remain free of any exogenous microbes until the vials are opened. Alternatively, flies with a defined microbiota can be reared by inoculating sterile diet and embryos with microbial species of interest. We describe the introduction of 4 bacterial species to establish a representative gnotobiotic microbiota in Drosophila. Finally, we describe approaches for confirming bacterial community composition, including testing if axenic Drosophila remain bacteria-free into adulthood.

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

A method for rearing Drosophila melanogaster under axenic and gnotobiotic conditions is presented. Fly embryos are dechorionated in sodium hypochlorite, transferred aseptically to sterile diet, and reared in closed containers. Inoculating diet and embryos with bacteria leads to gnotobiotic associations, and bacterial presence is confirmed by plating whole-body Drosophila homogenates.

La cría de la mosca de la fruta<em&gt; Drosophila melanogaster</em&gt; Bajo axénicos y Condiciones gnotobióticos

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is ...

Biología del Desarrollo

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

Medición cuantitativa de la respuesta inmune y del sueño en<em&gt; Drosophila</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

Extracción de hemocitos de larvas de Drosophila melanogaster para infección microbiana y análisis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Establecimiento de la infección Viral y análisis de la interacción huésped-Virus en Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are the main branches of innate immunity, and many of the factors regulating these responses are evolutionarily conserved between invertebrates and mammals. Phagocytosis, the central component of cellular innate immunity, is carried out by specialized blood cells of the immune system. The fruit fly, Drosophila melanogaster, has emerged as a powerful genetic model to investigate the molecular mechanisms and physiological impacts of phagocytosis in whole animals. Here we demonstrate an injection-based in vivo phagocytosis assay to quantify the particle uptake and destruction by Drosophila blood cells, hemocytes. The procedure allows researchers to precisely control the particle concentration and dose, making it possible to obtain highly reproducible results in a short amount of time. The experiment is quantitative, easy to perform, and can be applied to screen for host factors that influence pathogen recognition, uptake, and clearance.

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

This protocol describes an in vivo phagocytosis assay in adult Drosophila melanogaster to quantify phagocyte recognition and clearance of microbial infections.

Evaluar el Cellular la respuesta inmune de la mosca de la fruta, Drosophila melanogasterutilizando un ensayo de fagocitosis en Vivo

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are ...

Drosophila melanogaster Larva Injection Protocol

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly and raise ethical issues. Unconventional models are notoriously cheap, easy to handle and culture, and do not take much space. They are genetically amenable and possess complete genome sequences, and their use presents no ethical considerations. The fruit fly Drosophila melanogaster, for instance, has provided great insights into a variety of behavior, development, metabolism, and immunity research. More specifically, D. melanogaster adult flies and larvae possess several innate defense reactions that are shared with vertebrate animals. The mechanisms regulating immune responses have been mostly revealed through genetic and molecular studies in the D. melanogaster model. Here a novel larval injection technique is provided, which will further promote investigations of innate immune processes in D. melanogaster larvae and explore the pathogenesis of a wide range of microbial infections.

Drosophila melanogaster Larva Injection Protocol

Drosophila melanogaster adult flies have been extensively utilized as model organisms to investigate the molecular mechanisms underlying host antimicrobial innate immune responses and microbial infection strategies. To promote the D. melanogaster larva stage as an additional or alternative model system, a larval injection technique is described.

Drosophila melanogaster Protocolo de inyección de larvas

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly ...

Oral Bacterial Infection and Shedding in Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic infections, there has been a recent increase of interest in the mechanisms of gut immunocompetence to pathogens, which require methods to orally infect flies. Here we present a protocol to orally expose individual flies to an opportunistic bacterial pathogen (Pseudomonas aeruginosa) and a natural bacterial pathogen of D. melanogaster (Pseudomonas entomophila). The goal of this protocol is to provide a robust method to expose male and female flies to these pathogens. We provide representative results showing survival phenotypes, microbe loads, and bacterial shedding, which is relevant for the study of heterogeneity in pathogen transmission. Finally, we confirm that Dcy mutants (lacking the protective peritrophic matrix in the gut epithelium) and Relish mutants (lacking a functional immune deficiency (IMD) pathway), show increased susceptibility to bacterial oral infection. This protocol, therefore, describes a robust method to infect flies using the oral route of infection, which can be extended to the study of a variety genetic and environmental sources of variation in gut infection outcomes and bacterial transmission.

Oral Bacterial Infection and Shedding in Drosophila melanogaster

This protocol describes methods to orally expose and infect the fruit fly Drosophila melanogaster with bacterial pathogens, and to measure the number of infectious bacteria shed following gut infection. We further describe the effect of immune mutants on fly survival following oral bacterial infection.

Oral infección bacteriana y vertimiento en Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic ...

Biología

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to recognize a wide range of particles and destroy microbial pathogens. As organisms age, this process begins to decline, yet little is known about the underlying mechanisms or the genetic basis of immunosenescence. Here, an injection based in vivo phagocytosis assay is used to assess age related changes in different aspects of phagocytosis, such as binding, engulfment, and degradation of internalized particles, by quantifying phagocytic events in hemocytes in adult Drosophila. Drosophila melanogaster has become an ideal model to investigate age related changes in innate immune function for many reasons. For one, many genetic components and functions of the innate immune response, including phagocytosis, are evolutionarily conserved between Drosophila and mammals. Because of that, results obtained from using this protocol are likely to be widely relevant to understanding the age related changes in immune function in a variety of organisms. Additionally, we note that this method provides quantitative estimates of hemocyte phagocytic ability, which could be useful for a variety of research topics, and need not be limited to studies of aging.

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

This protocol describes an in vivo assay of phagocytosis used to assess and quantify the ability of young and aged Drosophila melanogaster hemocytes to phagocytose bacteria.

Evaluación de la capacidad fagocítica específica por edad de los hemocitos de Drosophila melanogaster adultos utilizando un ensayo de fagocitosia In Vivo

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to ...

Infecting Flies with Bacterial Suspension Using a Nanoinjector

Source: Khalil, S. et al., <a href="https://app.jove.com/v/52613">Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.</a>&#160;J. Vis. Exp.&#160; (2015)
This video demonstrates the nano-injection of bacterial suspension into the fly body cavity, resulting in bacterial multiplication and infection. The fly&#39;s immune response clears some bacteria, while others escape immune clearance and survive within the host causing an infection.

Infección de moscas con suspensión bacteriana mediante un nanoinyector

Source: Khalil, S. et al., Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.&#160;J. Vis. Exp.&#160; (2015)
This ...

La infección bacteriana sistémica y Defensa Inmune fenotipos en

Resumen

Explorar más videos

Capítulos en este video

Una introducción a las avispas parasitarias de

La cría de la mosca de la fruta

Medición cuantitativa de la respuesta inmune y del sueño en