We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

El procedimiento descrito aquí produce infección rigurosa y de alta calidad de Drosophila melanogaster. Los ejemplos ilustrados se centraron principalmente en la infección con Providencia rettgeri y E. coli, pero el protocolo es altamente adaptable y se puede aplicar a las infecciones con diversas bacterias sobre un rango de condiciones de cría de acogida y de mantenimiento. Los detalles de un enfoque experimental óptima dependerá de la bacteria utilizada para la infección, el genotipo del huésped, y las condiciones experimentales generales. Se recomienda encarecidamente a prueba piloto nuevas condiciones experimentales antes de iniciar los proyectos más ambiciosos. Un buen punto de partida es poner a prueba tres dosis de infección en un rango de 100 veces. Altamente patógenos virulentos son a menudo mejor introdujeron en dosis infecciosas muy bajas, del orden de 10 a 100 células bacterianas por mosca. Patógenos más moderadas pueden ser inyectados con dosis más altas de alrededor de 1.000 bacterias por fly, y los no patógenos pueden ser inyectados con dosis de hasta 10.000 bacterias por mosca. A menudo es instructiva para definir la cinética de nuevas infecciones por el seguimiento de la carga de patógenos, la mortalidad de acogida, y la actividad del sistema inmune a través de una serie de tiempo longitudinal. Dado que la medición de la carga de patógenos y la expresión génica de acogida son ensayos destructivos, es necesario para infectar las moscas distintas desde el principio del experimento para cada punto de tiempo que se va a medir. Al decidir si utilizar pinchazo o inyección a base de microcapilar, es importante tener en cuenta que hay ventajas y limitaciones de cada enfoque. Inyección capilar introduce un volumen de líquido en la marcha, que tanto aumenta la presión de turgencia y modestamente introduce sales u otras moléculas que están suspendidos o disueltos en el vehículo. Inyección capilar también requiere el acceso a un centro de inyección o compra de los equipos necesarios. Pinchazo séptico no requiere equipo e introduce especialmedios insignificantes en la marcha, y es típicamente más eficiente para infectar a un gran número de moscas. Sin embargo, las infecciones pinchazo no permiten el control preciso sobre dosis de infección que se puede lograr con la inyección capilar. El presente protocolo se centró en un aparato de inyección que regula mecánicamente volumen de inyección, pero también hay sistemas de inyección basado en pulsos discretos de aire a presión. 20,21 Estos son típicamente más caros que el aparato ofrece aquí y requieren de calibración del impulso de aire a cada aguja con el fin de asegurar volúmenes de inyección consistentes. Existe un considerable debate, pero muy pocos datos sobre cómo las moscas se convierten sistémicamente infectado con bacterias en el medio silvestre. Algunos investigadores postulan que la mayoría de las infecciones naturales se producen cuando Drosophila ingerir bacterias patógenas y las bacterias son capaces de escapar posteriormente el intestino para establecer una infección sistémica. Sin embargo, hay muy Febacterias w sabe que son capaces de atravesar el intestino de D. melanogaster, y los que sí tienen esta capacidad son altamente letal para las moscas 22,23. Una teoría alternativa es que vuela regularmente sufrir lesiones cuticulares través de escapar de los intentos fallidos de depredación o ataque de ácaros ectoparásitos. Esta hipótesis está apoyada por la recogida frecuente de salvaje D. melanogaster teniendo manchas melanization que son indicativos de heridas cicatrizadas (observaciones no publicadas). Los ácaros se han demostrado para transmitir infecciones bacterianas en Drosophila y 24 heridas dejadas por los ácaros pueden ser secundariamente infectadas por bacterias en las abejas de miel 25. Sin embargo, la frecuencia en la naturaleza de la infección-ácaros impulsado o de otra manera oportunista de D. melanogaster través de las infracciones de la cutícula no se conoce. El protocolo descrito aquí permite la introducción de bacterias directamente en la hemolinfa través de la inyección cuantitativa que evita cualquier barreras epiteliales o Immu de comportamientonidad. Métodos para la alimentación de las bacterias patógenas a D. melanogaster han sido descritos en Vodovar et al. 22 y Nehme et al. 23. Muchas bacterias entomopatógenos representan poco o ningún riesgo para la salud humana, lo que permite a los investigadores a trabajar con ellos cómodamente. Además, muy pocas bacterias tienen la capacidad de infectar a Drosophila en contacto sin intervención experimental, por lo que el riesgo de &quot;epidemia&quot; propagación de la infección bacteriana a través de un laboratorio a través de superficies contaminadas o escaparon moscas es generalmente muy baja. No obstante, es recomendable asegurarse de que las medidas de contención adecuadas en el lugar para evitar que las moscas infectadas se escape y para recuperar cualquier moscas escaparon. El laboratorio debe ser equipado a un nivel de seguridad biológica en consonancia con la de los agentes patógenos que se utiliza, y se debe emplear las mejores prácticas estándar en microbiología. El infecti experimentalen el método descrito aquí permite infecciones de Drosophila melanogaster con cualquier dosis de cualquier bacteria arbitraria. Una vez que la infección se ha establecido, es sencillo para medir la cinética de proliferación o la eliminación de bacterias, el seguimiento de la mortalidad acogida, y para ensayo de inducción del sistema inmune del huésped. Moscas infectadas pueden ser fácilmente sometidos a otros ensayos fenotípicos, incluyendo pruebas de funciones fisiológicas que pueden dar forma o se forma por la infección. Los procedimientos descritos son de bajo costo, requieren relativamente poco equipo especializado, y se aprenden fácilmente, haciéndolos susceptibles para su uso en diversos proyectos a través de una amplitud de laboratorios de investigación y docencia.

La mosca de la fruta Drosophila melanogaster es uno de los organismos modelo de primera clase para el estudio de la función y la evolución de la defensa inmune. Drosophila son baratos y fáciles de criar, son altamente susceptibles a la manipulación experimental, y están respaldados por una amplia comunidad científica que ha desarrollado una amplia variedad de herramientas de investigación. Muchos aspectos de la inmunidad innata se conservan entre los insectos y mamíferos, incluyendo la transducción de señales mediada por los receptores Toll-like y NF-kB factores de transcripción de la familia, de señalización JAK / STAT, y las respuestas de la vía JNK. 1,2 La función de estos genes y vías lata ser consultados en el D. melanogaster mediante mutaciones o RNAi caídas que aumentan o vía disminución actividades. 3 - 6 Además, Drosophila se puede utilizar para estudiar las consecuencias fisiológicas de la infección y la enfermedad, incluso en el contexto de la teoría evolutiva historia de vida 7.- 9 Todos estos estudios, sin embargo, dependen de la capacidad de infectar de forma fiable moscas experimentales bajo condiciones de tratamiento definidos. El procedimiento descrito aquí presenta un marco metodológico para la entrega de infecciones bacterianas robustos y repetibles a Drosophila melanogaster y posteriormente medir la gravedad de la infección y la cuantificación de la respuesta inmune del huésped. Drosophila puede ser natural y experimentalmente infectado por una amplia variedad de parásitos y agentes patógenos, incluyendo bacterias, hongos, virus, nematodos y avispas parasitoides. El protocolo actual se centra en la entrega de la infección bacteriana sistémica. Muchas bacterias diferentes se pueden utilizar para infectar las moscas, y la elección del experimentador deben basarse en las cuestiones científicas precisas que nos pidieron. Por ejemplo, los aislados clínicos humanos se pueden emplear para estudiar los mecanismos de virulencia bacteriana 10, o ecológicamente cepas pertinentes pueden ser preferred para el estudio de la evolución. 11 Algunas bacterias son patógenos competentes de D. melanogaster, la proliferación tras la infección y causar la enfermedad de host o la muerte. Otras bacterias se administran eficazmente por el sistema inmune del huésped y borran dentro de unos pocos días. En esta demostración, Providencia rettgeri será utilizado como un patógeno proliferativa que puede causar la mortalidad de acogida y persiste en huéspedes supervivientes. Escherichia coli se utilizará como un no patógeno que se elimina por el sistema inmune del huésped. La infección se estableció mediante la introducción de bacterias directamente en la cavidad del cuerpo de la mosca. Este enfoque evita las barreras epiteliales y comportamientos de protección, lo que permite la investigación de la infección sistémica con independencia del modo natural de transmisión. Hay dos métodos principales para establecer experimentalmente la infección sistémica. En el primero, un nanoinjector y capilares de vidrio tirado agujas se utilizan para inyectar un número preciso debacterias en la marcha. Este método tiene las ventajas de permitir un gran rango dinámico de dosis de infección y de ser cuantitativamente altamente repetible. El segundo enfoque es entregar la infección con un pinchazo séptico. Este enfoque tiene las ventajas de ser rápido y no requiere equipo especial. Una vez establecidas las infecciones, se hace posible medir la carga sistémica patógeno, la mortalidad de acogida, y la actividad inducible sistema inmunológico. Por supuesto, cualquier número de fenotipos adicionales posiblemente podría medirse en D. infectada melanogaster, incluyendo post-infección fecundidad 12, la capacidad de aprendizaje 13, estado metabólico 14, o prácticamente cualquier otro rasgo que se puede imaginar.

<table border="0" cellpadding="0" cellspacing="0" width="815">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Reagent</td>
			<td style="width:239px;">Company&#160;</td>
			<td style="width:177px;">Part Number</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Incubator</td>
			<td style="width:239px;">Powers Scientific, Inc</td>
			<td style="width:177px;">DROS52SD</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Paintbrush</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2 Flypads</td>
			<td style="width:239px;">FlyStuff</td>
			<td style="width:177px;">59-114</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2</td>
			<td style="width:239px;">Airgas</td>
			<td>CD FG50</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila rearing mix&#160;</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">6 oz Square Bottom Bottles, polypropylene</td>
			<td style="width:239px;">Genesee Scientific</td>
			<td style="width:177px;">32-130</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Extra Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-882</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Microscope</td>
			<td style="width:239px;">Olympus Corporation</td>
			<td style="width:177px;">SZ51</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila Vials polystyrene</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">89092-720</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-883</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">2L flask</td>
			<td style="width:239px;">VWR international</td>
			<td>89000-370</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Petri Dishes with Clear Lids, Raised Ridge; 100 . x 15 mm;</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">25384-302</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">LB Agar, Miller</td>
			<td style="width:239px;">Difco</td>
			<td style="width:177px;">244520</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Innoculing Loop</td>
			<td style="width:239px;">VWR international</td>
			<td>80094-488</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:399px;">Rainin Clasic Pipettes in various sizes 
			0.1 &#181;l to 2 &#181;l, 
			2 &#181;l to 20 &#181;l, 
			20 &#181;l to 200 &#181;l, 
			100 &#181;l to 1000</td>
			<td style="width:239px;">Rainin</td>
			<td style="width:177px;">PR-2 
			PR-20 
			PR-200 
			PR-1000</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:399px;">Micropipette tips (assorted sizes)</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">30128-376 
			53503-810 
			16466-008</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Luria Broth Base, Miller</td>
			<td style="width:239px;">Difco</td>
			<td>241420</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Disposable Culture Tubes Borosilicate Glass</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">47729-576</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">S-500 Orbital Shaker</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">14005-830</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">centrifuge</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">37001-300</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">PBS pH 7.4 10x</td>
			<td style="width:239px;">Invitrogen</td>
			<td style="width:177px;">70011044</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">SmartSpec 3000 Spectrophotometer</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">170-2501</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Semimicrovolume Cuvettes</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">223-9955</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vertical Capillary Puller</td>
			<td style="width:239px;">Kopf Needle Pipette Puller</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">3.5&#39;&#39; Replacement glass Capillaries for Nanojet II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-203-G/X</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nanoject II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-204</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Forceps</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">11255-20</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">10mL Syringe</td>
			<td style="width:239px;">BD</td>
			<td style="width:177px;">309604</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mineral Oil, White, light</td>
			<td>Macron Fine Chemicals</td>
			<td>6358-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">minutein pins</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">26002-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">1.5mL&#160; Microcentrifuge tubes; Seal Rite</td>
			<td style="width:239px;">USA Scientific Inc.</td>
			<td style="width:177px;">1615-5500</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Motorized Pestle; Talboys Laboratory Stirrer</td>
			<td style="width:239px;">Troemner</td>
			<td style="width:177px;">103</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Talboys High Throughput Homogenizer</td>
			<td style="width:239px;">OPS Diagnostics</td>
			<td style="width:177px;">930145</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">5/32&#39;&#39; Grinding Balls</td>
			<td>OPS Diagnostics</td>
			<td style="width:177px;">GBSS 156-5000-01</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vortex Genie</td>
			<td style="width:239px;">Scientific indurstries inc.</td>
			<td style="width:177px;">G560</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Multichannel Pipettor (10uL-300uL)</td>
			<td style="width:239px;">Sartorius</td>
			<td>730360</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;"></td>
			<td style="width:239px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">WASP2 Whitley Automated Spiral Plater</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:399px;">ProtoCOL automated colony counter / plate counter/ plate reader&#160;</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">TRIzol</td>
			<td style="width:239px;">Life Technologies</td>
			<td style="width:177px;">15596-026</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TLS0801</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR caps; Optical Flat 8-Cap Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TCS0803</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">RQ1 RNase-Free DNase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m610a</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">M-MLV Reverse Transcriptase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m170b</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">dNTPs</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">U1240</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Oligo-dT</td>
			<td style="width:239px;">IDT</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">&#160;SsoAdvanced SYBR Green Supermix</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">172-5260</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CFX Connect Real-Time PCR Detection System</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">185-5200</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNasin Ribonuclease Inhibitor</td>
			<td>Promega</td>
			<td>N2115</td>
		</tr>
	</tbody>
</table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

La mosca de la fruta Drosophila melanogaster es uno de los organismos modelo de primera clase para el estudio de la función y la evolución de la defensa inmune. Muchos aspectos de la inmunidad innata se conservan entre insectos y mamíferos, y desde Drosophila puede ser fácilmente manipulado genéticamente y experimentalmente, que son de gran alcance para el estudio de la función del sistema inmune y las consecuencias fisiológicas de la enfermedad. El procedimiento ha demostrado aquí permite la infección de las moscas por la introducción de bacterias directamente en la cavidad del cuerpo, por encima de las barreras epiteliales y formas más pasivas de defensa y permitiendo enfoque en la infección sistémica. El procedimiento incluye protocolos para las tasas de mortalidad de medición anfitrión, la carga de patógenos sistémica, y el grado de inducción del sistema inmune del huésped. Este procedimiento de infección es barato, robusto y cuantitativamente repetible, y se puede utilizar en estudios de genética funcional, la historia evolutiva, la vida y la fisiología.

Esta sección ilustra los resultados que se pueden obtener después de la infección bacteriana de Drosophila melanogaster. Figura 1 muestra que dosis de infección varía con la densidad óptica de la suspensión bacteriana utilizada para la inyección, y que la dosis administrada puede ser estimado de manera fiable por homogeneización y el chapado vuela inmediatamente después de la inyección . Como se ilustra en la Figura 2, diferentes patógenos pueden causar diferentes niveles de mortalidad host (Figura 2A) y la mortalidad huésped puede ser (Figura 2B) dependiente de la dosis. Es importante destacar que este protocolo permite diferentes tipos de infecciones que deben alcanzarse: Providencia rettgeri puede causar una infección crónica, subletal que persiste durante 20 días o más (Figura 3A). Sin embargo, otras bacterias como Escerichia coli mayormente se borrarán por la mosca de acogida dentro de seis horas después de la infección (Figura 3B). La inducción de los sys inmunesTEM se puede estimar a través de aislamiento de ARN y posterior qRT-PCR de los transcritos de péptidos antibacterianos (Figura 4A y B). Análogamente pero menos cuantitativamente, las moscas que expresan GFP bajo el control de promotores de genes de péptido antimicrobiano puede ser utilizado para visualizar la inducción del sistema inmune (Figura 4C). <img alt="Figura 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> . Figura 1: Determinación de la dosis infecciosa Las moscas fueron inyectados con 50 nl de suspensiones bacterianas que cubren una gama de densidades ópticas (0,0001 a 0,05). Las moscas fueron inmediatamente homogeneizada y se sembraron para determinar el número de bacterias introducido por la inyección. Carga bacteriana inicial se correlaciona fuertemente con OD inicial inyectada (r 2 = 0,96) <img alt="Figura 2" src="/files/ftp_upload/52613/52613fig2.jpg" /> <strong&gt; Figura 2:. supervivencia después de la inyección con patógenos bacterianos Cinco a siete machos viejos día se inyectaron con 50 nl de cualquiera de suspensión bacteriana o medios estériles y se controló para la supervivencia. (A) Tipo de moscas salvajes fueron inyectados con aproximadamente 5.000 bacterias de de una de las tres especies diferentes. La tasa de mortalidad huésped depende en gran medida de las especies bacterianas usadas para la infección. (B) Tipo moscas salvajes fueron inyectados con tres dosis diferentes de Enterococcous faecalis - 50, 500, y 5000 bacterias por mosca. Las moscas mueren más rápidamente cuando se infectan con dosis más altas infecciosas (C) Un mutante sistema inmune y su línea de control isogénicas de tipo salvaje fueron inyectados con aproximadamente 500 Burkholderia cepacia. Una comparación por parejas Log-Rank muestra que la mosca de tipo salvaje sobrevive a la infección significativamente mejor que el mutante (χ 2 = 59,02, df = 1, p &lt;0,0001). Figura 3:. Carga bacteriana después de la inyección Las moscas fueron inyectados con aproximadamente (A) 5000 P. rettgeri (B) 3400 E. coli. La carga bacteriana se determinó inmediatamente después de la inyección y en varios puntos de tiempo posteriores. Cada punto de datos representa la carga bacteriana de una sola mosca. E. coli se elimina rápidamente de anfitriones impugnados mientras que P. rettgeri persiste durante el resto de la vida del anfitrión ,. <img alt="Figura 4" src="/files/ftp_upload/52613/52613fig4.jpg" /> Figura 4: Inducción de la expresión génica inmune después de la inyección. Las moscas (A) se inyectaron con 50 nl de P. PBS rettgeri o estéril, ya sea en el abdomen o el tórax, o se dejaron sin manipular aparte de CO <sub&gt; 2 anestesia. Seis horas después de la infección, las moscas fueron recolectados para el aislamiento de ARN y la expresión de la Diptericin Un gen se determinó utilizando qRT-PCR. (A) Los niveles de expresión se representan gráficamente como la relación de Diptericin Una transcripción de transcripción rp49 y ampliarse de manera que el control de CO 2 se define como tener un nivel de expresión de 1. Las barras representan la media y el error estándar de las proporciones de cada condición (n = 4). Niveles (B) de expresión se grafican como ΔΔCT 2 con el valor promedio de C T de CO 2 de control de moscas aesthesia utilizados como la condición no inducido estándar. Las barras representan el error medio y estándar de ΔΔC T de cada condición (n = 4). Mientras que no hay diferencia en la inducción de la transcripción debido a sitio de la inyección, la comparación de los paneles A y B muestra cómo el método ΔΔC T potencialmente puede sobreestimar los niveles de inducción. (C) Moscas que expresan GFP bajo el control del Diptericin Un promotor se inyectaron con 50 nl de P. rettgeri (OD = 0,1) y luego fotografiada 7 días más tarde. El panel de GFP muestra la expresión de GFP en el cuerpo la grasa abdominal de moscas infectadas, lo que indica la activación de la Diptericin Un promotor en las moscas infectadas por bacterias, pero no los controles con inyección de medios de comunicación. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gene </td><td> Adelante </td><td> Reverse </td></tr><tr><td> rp49 (también llamado RPL32) </td><td> 5 &#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5 &#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> Diptericin A </td><td> 5 &#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5 &#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Drosomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5 &#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensina </td><td> 5 &#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5 &#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> Attacin A </td><td> 5 &#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5 &#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5 &#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5 &#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> Tabla 1: Los cebadores para QRT-PCR.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

La infección bacteriana sistémica y Defensa Inmune fenotipos en<em&gt; Drosophila melanogaster</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.3K vistas.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Video: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

Siete pasos para células estrelladas

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Investigación

Inmunología e Infección

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of Listeria, which results in systemic infection2. After injection, Listeria quickly disseminates to the spleen and liver due to uptake by CD8&alpha;+ dendritic cells and Kupffer cells3,4. Once phagocytosed, various bacterial proteins enable Listeria to escape the phagosome, survive within the cytosol, and infect neighboring cells5. During the first three days of infection, different innate immune cells (e.g. monocytes, neutrophils, NK cells, dendritic cells) mediate bactericidal mechanisms that minimize Listeria proliferation. CD8+ T cells are subsequently recruited and responsible for the eventual clearance of Listeria from the host, typically within 10 days of infection6.
Successful clearance of Listeria from infected mice depends on the appropriate onset of host immune responses6	. There is a broad range of sensitivities amongst inbred mouse strains7,8. Generally, mice with increased susceptibility to Listeria infection are less able to control bacterial proliferation, demonstrating increased bacterial load and/or delayed clearance compared to resistant mice. Genetic studies, including linkage analyses and knockout mouse strains, have identified various genes for which sequence variation affects host responses to Listeria infection6,8-14. Determination and comparison of infection kinetics between different mouse strains is therefore an important method for identifying host genetic factors that contribute to immune responses against Listeria. Comparison of host responses to different Listeria strains is also an effective way to identify bacterial virulence factors that may serve as potential targets for antibiotic therapy or vaccine design.
We describe here a straightforward method for measuring bacterial load (colony forming units [CFU] per tissue) and preparing single-cell suspensions of the liver and spleen for FACS analysis of immune responses in Listeria-infected mice. This method is particularly useful for initial characterization of Listeria infection in novel mouse strains, as well as comparison of immune responses between different mouse strains infected with Listeria. We use the Listeria monocytogenes EGD strain15 that, when cultured on blood agar, exhibits a characteristic halo zone around each colony due to &beta;-hemolysis1 (Figure 1). Bacterial load and immune responses can be determined at any time-point after infection by culturing tissue homogenate on blood agar plates and preparing tissue cell suspensions for FACS analysis using the protocols described below. We would note that individuals who are immunocompromised or pregnant should not handle Listeria, and the relevant institutional biosafety committee and animal facility management should be consulted before work commences.

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes is a model organism for studying immune responses and genetic susceptibility to intracellular bacteria in mice. This method enables one to measure bacterial load and generate single-cell suspensions of the liver and spleen from mice for FACS analysis to determine changes in immune cells due to Listeria infection.

La medición de la carga bacteriana y la respuesta inmune en ratones infectados con Listeria monocytogenes</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

La introducción de la tensión de cizallamiento en el Estudio de la adhesión bacteriana

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Una introducción a las avispas parasitarias de<em&gt; Drosophila</em&gt; Y la respuesta inmune antiparasitario

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Flow Cytometric Isolation of Primary Murine Type II Alveolar Epithelial Cells for Functional and Molecular Studies

Throughout the last years, the contribution of alveolar type II epithelial cells (AECII) to various aspects of immune regulation in the lung has been increasingly recognized. AECII have been shown to participate in cytokine production in inflamed airways and to even act as antigen-presenting cells in both infection and T-cell mediated autoimmunity 1-8. Therefore, they are especially interesting also in clinical contexts such as airway hyper-reactivity to foreign and self-antigens as well as infections that directly or indirectly target AECII. However, our understanding of the detailed immunologic functions served by alveolar type II epithelial cells in the healthy lung as well as in inflammation remains fragmentary. Many studies regarding AECII function are performed using mouse or human alveolar epithelial cell lines 9-12. Working with cell lines certainly offers a range of benefits, such as the availability of large numbers of cells for extensive analyses. However, we believe the use of primary murine AECII allows a better understanding of the role of this cell type in complex processes like infection or autoimmune inflammation. Primary murine AECII can be isolated directly from animals suffering from such respiratory conditions, meaning they have been subject to all additional extrinsic factors playing a role in the analyzed setting. As an example, viable AECII can be isolated from mice intranasally infected with influenza A virus, which primarily targets these cells for replication 13. Importantly, through ex vivo infection of AECII isolated from healthy mice, studies of the cellular responses mounted upon infection can be further extended.
Our protocol for the isolation of primary murine AECII is based on enzymatic digestion of the mouse lung followed by labeling of the resulting cell suspension with antibodies specific for CD11c, CD11b, F4/80, CD19, CD45 and CD16/CD32. Granular AECII are then identified as the unlabeled and sideward scatter high (SSChigh) cell population and are separated by fluorescence activated cell sorting 3.
In comparison to alternative methods of isolating primary epithelial cells from mouse lungs, our protocol for flow cytometric isolation of AECII by negative selection yields untouched, highly viable and pure AECII in relatively short time. Additionally, and in contrast to conventional methods of isolation by panning and depletion of lymphocytes via binding of antibody-coupled magnetic beads 14, 15, flow cytometric cell-sorting allows discrimination by means of cell size and granularity. Given that instrumentation for flow cytometric cell sorting is available, the described procedure can be applied at relatively low costs. Next to standard antibodies and enzymes for lung disintegration, no additional reagents such as magnetic beads are required. The isolated cells are suitable for a wide range of functional and molecular studies, which include in vitro culture and T-cell stimulation assays as well as transcriptome, proteome or secretome analyses 3, 4.

We describe the rapid isolation of primary murine type II alveolar epithelial cells (AECII) by flow cytometric negative selection. These AECII show high viability and purity and are suitable for a wide range of functional and molecular studies regarding their role in respiratory conditions such as autoimmune or infectious diseases.

Citometría de flujo El aislamiento de células primarias murino tipo II alveolares epiteliales de Estudios funcionales y moleculares

Throughout  the last years, the contribution of alveolar type II epithelial cells (AECII)  to various aspects of immune regulation in the lung has been ...

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

Medición cuantitativa de la respuesta inmune y del sueño en<em&gt; Drosophila</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend themselves against pathogen attack. The contribution of a specific Arabidopsis gene to the overall plant immune response can be specifically and quantitatively assessed by assaying the pathogen growth within the infected tissue. For over three decades, the hemibiotrophic bacterium Pseudomonas syringae pv. maculicola ES4326 (Psm ES4326) has been widely applied as the model pathogen to investigate the molecular mechanisms underlying the Arabidopsis immune response. To deliver pathogens into the leaf tissue, multiple inoculation methods have been established, e.g., syringe infiltration, dip inoculation, spray, vacuum infiltration, and flood inoculation. The following protocol describes an optimized syringe infiltration method to deliver virulent Psm ES4326 into leaves of adult soil-grown Arabidopsis plants and accurately screen for enhanced disease susceptibility (EDS) towards this pathogen. In addition, this protocol can be supplemented with multiple pre-treatments to further dissect specific immune defects within different layers of plant defense, including Salicylic Acid (SA)-Triggered Immunity (STI) and MAMP-Triggered Immunity (MTI).

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

Quantification of pathogen growth is a powerful tool to characterize various Arabidopsis thaliana (hereafter: Arabidopsis) immune responses. The method described here presents an optimized syringe infiltration assay to quantify the Pseudomonas syringae pv. maculicola ES4326 growth in adult Arabidopsis leaves.

Ensayo de infiltración bacteriana de la hoja por Fine Caracterización de las respuestas de defensa de la planta utilizando el<em&gt; Thaliana-Pseudomonas syringae Arabidopsis</em&gt; Patosistema

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend ...

The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies

The intestine displays an architecture of repetitive crypt structures consisting of different types of epithelial cells, lamina propia containing immune cells, and stroma. All of these heterogeneous cells contribute to intestinal homeostasis and participate in antimicrobial host defense. Therefore, identifying a surrogate model for studying immune response and antimicrobial activity of the intestine in an in vitro setting is extremely challenging. In vitro studies using immortalized intestinal epithelial cell lines or even primary crypt organoid culture do not represent the exact physiology of normal intestine and its microenvironment. Here, we discuss a method of culturing mouse colon tissue in a culture dish and how this ex vivo organ culture system can be implemented in studies related to antimicrobial host defense responses. In representative experiments, we showed that colons in organ culture express antimicrobial peptides in response to exogenous IL-1&#946; and IL-18. Further, the antimicrobial effector molecules produced by the colon tissues in the organ culture efficiently kill Escherichia coli in vitro. This approach, therefore, can be utilized to dissect the role of pathogen- and danger-associated molecular patterns and their cellular receptors in regulating intestinal innate immune responses and antimicrobial host defense responses.

The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies

The ex vivo organ culture allows investigation of biological processes in the context of the intact tissue architecture. Here, we introduce a method of ex vivo culture of the mouse colon, which can be used to study innate immunity and antimicrobial host defense in the intestine.

los<em&gt; Ex Vivo</em&gt; Colon Organo cultura y su uso en estudios de defensa antimicrobiana de host

The intestine displays an architecture of repetitive crypt structures consisting of different types of epithelial cells, lamina propia containing immune ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

Extracción de hemocitos de larvas de Drosophila melanogaster para infección microbiana y análisis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Establecimiento de la infección Viral y análisis de la interacción huésped-Virus en Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...