Work in the Buchanan-Wollaston lab on cell-type and developmental stage specific profiling is supported by the AGRON-OMICS project (grant # LSHG-CT-2006-037704) in the 6th Framework Progamme of the European Commission. Work in the Gifford lab on cell-type specific profiling is supported by a BBSRC New Investigator grant (BB/H019502/1).
The KC274 and KC464 Arabidopsis lines were obtained from A.A.R. Webb (University of Cambridge).

1. Protoplast Generation
<ol>
 <li>Harvest leaf material and cut into 1 mm wide strips (Figure 1) with a razor blade. For samples containing more than a single leaf up to 15 leaves can be easily stacked before cutting.</li>
 <li>Immediately transfer leaf strips into a 9 cm round Petri dish containing 20 ml solution A (400 mM mannitol, 20 mM MES hydrate, 20 mM KCl, 10 mM CaCl2, 2 mM MgCl2, 0.1% BSA and 2.5 mM &beta;-mercaptoethanol, pH 5.7) including protoplasting enzymes (1.2% cellulose R-10, 0.6% cellulose RS and 0.4% macerozyme R-10) and RNase and transcriptional inhibitors (1&times;ProtectRNA and 10 &mu;g/ml Actinomycin D); gently separate the leaf strips and vacuum infiltrate for 2 &times; 5 min.</li>
 <li>Place Petri dish on an orbital shaker set to 90 rpm at room temperature and protoplast for 3-4 hr.
 <ol>
 <li>During the incubation the leaf strips should be separated from each other, by use of a set of flat tweezers, at half hourly intervals.</li>
 </ol>
 </li>
 <li>Place a 70 &mu;m cell strainer (Fisher Scientific) in a 50 ml tube and gently filter the protoplasting solution through. This will remove the leaf strips, which will be retained by the sieve while allowing the protoplasts to go through.</li>
 <li>Wash the leaf strips with 4 ml solution A and gently filter through the same sieve.</li>
 <li>Transfer the protoplasts into round bottom tubes and centrifuge the protoplast solution at 300 x g for 5 min to pellet the protoplasts.</li>
 <li>Gently aspirate off as much of the supernatant as possible without disturbing the protoplasts.</li>
 <li>Wash the protoplasts with 5 ml solution A and centrifuge at 300 x g for 5 min. Remove supernatant</li>
 <li>Resuspend the protoplasts in an appropriate volume of solution A, using a Pasteur pipette or a cut-off P1000 tip.</li>
</ol>
2. FACS of Leaf Protoplasts
<ol>
 <li>Immediately before sorting, resuspend the protoplasts using a (non-cut) P1000 tip to avoid protoplasts clumping together.</li>
 <li>Transfer protoplasts to a sorting tube through a 50 &mu;m filcon filter (BD Biosciences) and dilute as appropriate to avoid clogging the nozzle of the cell sorter. The protoplasts are sorted using a 100 &mu;m nozzle at a pressure of 20 psi (sheath) and 21-21.5 psi (sample), a frequency of 39.2 kHz and an event rate of &lt;4000 (these settings are optimal on a BD Influx cell sorter (BD Biosciences). Optimization on other cell sorting machines may need adjustments to these settings).</li>
 <li>GFP positive protoplasts are identified using a 488 nm argon laser and plotting the output from the 580/30 bandpass filter (orange) vs. the 530/40 bandpass filter (green). GFP positive protoplasts will be in the high 530/low 580 population, with non-GFP protoplasts in the low 530/ low 580 population and dead/dying protoplasts and debris in the high 580 population (Figure 2).
 <ol>
 <li>When sorting protoplasts from which RNA will be extracted, protoplasts should be sorted directly into at least 4 volumes of a lysis buffer containing a reducing agent (e.g. &beta;-mercaptoethanol). In addition, the sort time of a single sample should be limited to 20-30 min, and a maximum of two to three samples processed at any one time.</li>
 <li>For visualization of sorted protoplasts, the protoplasts should be sorted directly into at least 8 volumes of solution A and subsequently collected by centrifugation to concentrate the protoplasts.</li>
 </ol>
 </li>
</ol>
3. Representative Results
This protocol describes a method for obtaining protoplasts from Arabidopsis leaves, which are used for fluorescence activated cell sorting (Figure 1). Protoplast generation in the presence of RNase and transcriptional inhibitors prevents the cells from mounting a transcriptional response. This does have the consequence of giving rise to many dead and dying protoplasts, which have a significant level of autofluorescence. When sorting the protoplasts prepared with this method it is therefore very common to see several distinct populations in graphs of the 580 nm vs. 530 nm fluorescence used for the sorting. Examples of this, together with the sorting gates used in this protocol are shown in Figure 3.
Protoplasts can be sorted into 8 volumes of solution A and collected for visualization to verify the enrichment. Figure 2G shows an example of this using the TP382 line, which expresses GFP in the guard cells.
Examples of yields obtained using this method, both before and after amplification, are shown in Table 1. The amounts obtained are sufficient for amplification using the Ovation Pico WTA System (500 pg-50 ng) and therefore subsequent analysis by either qPCR (Figure 4), next generation sequencing or microarray.
<img alt="Figure 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> 
 Figure 1. Overall workflow for the experiment. 1) Harvest leaves of interest from a GFP expressing Arabidopsis line. 2) Quickly cut into ~1 mm wide strips and immediately transfer these into protoplasting solution and vacuum infiltrate. 3) Incubate for 3-4 hr. 4) Gently filtrate protoplast solution through a 70 &mu;m sieve, transfer to round bottom tubes and pellet protoplasts by centrifugation. 5) Immediately before sorting, resuspend protoplasts and transfer to a sorting tube through a 50 &mu;m filter. 6) Sort GFP positive and GFP negative viable protoplasts. 7) Protoplasts can now be analyzed either visually or using techniques such as qPCR, next generation sequencing or microarray.
<img alt="Figure 2" src="/files/ftp_upload/4214/4214fig2.jpg" /> 
 Figure 2. The KC464, KC274 and TP382 lines used in this study. A) Transverse section of a KC464 leaf showing GFP expression in the adaxial epidermis. B) Protoplasts derived from KC464 leaves. C) Transverse section of a KC274 leaf showing GFP expression in the vasculature. D) Protoplasts derived from KC274 leaves. E) TP382 leaf showing GFP expression in the guard cells. F) Protoplasts derived from TP382 leaves. G) Example of the enrichment obtained by FACS of GFP expressing guard cells in the complex background of leaf cells, showing GFP containing protoplasts from the high 530/low 580 population of protoplasts derived from TP382 leaves. A-F: Confocal microscope images; G: Fluorescence microscope image. Scale bars within images are 50 &mu;m.
<img alt="Figure 3" src="/files/ftp_upload/4214/4214fig3.jpg" /> 
 Figure 3. Typical FACS acquisition dot plots of the output from the 580/30 nm (orange) vs. 530/40 nm (green) bandpass filters (BD Influx cell sorter). The sorting gates shown are those typically used during sorting. A) Dot plot of Col-4 leaf derived protoplasts, protoplasted in the absence of inhibitors, showing a single low 530/low 580 population. B) Dot plot from wt Col-4 leaf derived protoplasts, protoplasted in the presence of inhibitors, showing a shift in the 580 fluorescence due to stress and coloring by the inhibitors. C-E) Dot plots from leaf derived protoplasts from the KC74, KC464 and TP382 lines, respectively, protoplasted in the presence of inhibitors, showing the GFP containing populations in the high 530/low 580 populations. The percentages of the events in the GFP (high 530/low 580) populations are given. <a href="https://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank"> Click here to view larger figure</a>.
<img alt="Figure 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> 
 Figure 4. GFP expression in the representative gated population fractions as shown in Figure 3. Two biological replicates were obtained for each fraction type, amplified using the Ovation Pico WTA System and qPCR using GFP-specific primers (Table 2) was then performed. Values shown are the highest (red), lowest (green) and average relative values. The high 580 population was in this case split in two, low 530/low 580 and high 530/low 580, for which a single biological replicate was used so only the single value is shown. ACT2 (At3g18780) was used as a standard for all samples. Leaf: Whole leaf. Unsorted: Unsorted protoplasts. GFP1: high 530/low 580 and Rest1: low 530/low 580, GFP2: high 530/high 580 and Rest2: low 530/high 580, as described in Figure 3 and the insert. The results are a verification of optical assessments of GFP cell content in the sorted fractions (e.g. Figure 2G). <a href="https://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank"> Click here to view larger figure</a>.
<table border="1">
 <tbody>
 <tr>
 <td>Sample</td>
 <td>No. of leaves </td>
 <td>No. of cells</td>
 <td>RNA yield 
 (ng)</td>
 <td>RNA yield 
 (amplified; ng)</td>
 </tr>
 <tr>
 <td>Whole leaf A 
 Whole leaf B</td>
 <td>1 
 1</td>
 <td>- 
 -</td>
 <td>8001 
 10525</td>
 <td>4623*** 
 4572***</td>
 </tr>
 <tr>
 <td>Unsorted protoplasts A 
 Unsorted protoplasts B</td>
 <td>5 
 5</td>
 <td>- 
 -</td>
 <td>2433 
 2625</td>
 <td>1152*** 
 3321***</td>
 </tr>
 <tr>
 <td>GFP1 A 
 Rest1 A</td>
 <td>15</td>
 <td>6039 (0.39%*) 
 55389 (6.40%*)</td>
 <td>-** 
 -**</td>
 <td>861 
 489</td>
 </tr>
 <tr>
 <td>GFP1 B 
 Rest1 B</td>
 <td>15</td>
 <td>10783 (0.63%*) 
 57040 (7.49%*)</td>
 <td>-** 
 -**</td>
 <td>537 
 420</td>
 </tr>
 <tr>
 <td>GFP2 
 Rest2</td>
 <td>15</td>
 <td>18337 (1.49%*) 
 62405 (73.49%*)</td>
 <td>-** 
 -**</td>
 <td>360 
 411</td>
 </tr>
 </tbody>
</table>
Table 1. Samples collected using FACS and analysed with qPCR to determine which fraction contained live GFP-expressing protoplasts. Also included in this table is the total RNA yield in ng before and after amplification with the Ovation Pico WTA System (NuGen). GFP1, GFP2, Rest1 and Rest2 fractions are as shown in the insert in Figure 4. *The percentage of cells of the total cell sort run is given in parentheses beside the number of cells in the fraction. These percentages are not correlated to each other for each sample as the FACS sort runs for 'Rest' fractions were stopped earlier than for GFP fractions due to the much greater number of Rest cells collected. **50 ng used as input for amplification reactions, as per manufacturer's protocol.
<table border="1">
 <tbody>
 <tr>
 <td>Primer</td>
 <td>Sequence</td>
 </tr>
 <tr>
 <td>mGFP5-ER.fw</td>
 <td>GCCTGAGGGATACGTGCAGGAGA</td>
 </tr>
 <tr>
 <td>mGFP5-ER.rv</td>
 <td>TGGCGGGTCTTGAAGTTGGCT</td>
 </tr>
 <tr>
 <td>ACT2.fw</td>
 <td>GCCATCCAAGCTGTTCTCTC</td>
 </tr>
 <tr>
 <td>ACT2.rv</td>
 <td>GCCATCCAAGCTGTTCTCTC</td>
 </tr>
 </tbody>
</table>
Table 2. qPCR primers.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

No conflicts of interest declared.

We have described a method that allows the use of Arabidopsis plants expressing GFP in the leaves for protoplast generation and subsequent cell sorting using FACS. This method yields sufficient amounts of RNA to be used for amplification and therefore subsequent analysis by either qPCR or microarray. The fractions sorted are highly enriched for GFP-containing cells, as demonstrated by qPCR (Figure 2).
To achieve high yields of live protoplasts it is critical to work rapidly during the initial steps of the procedure, until the leaf strips have been vacuum infiltrated with the inhibitor-containing protoplast solution. In addition, when generating 1 mm leaf strips it is very important to slice or cut the leaves rather than 'chop' or mash them, as this leads to excessive damage and thus a lower protoplast yield.
A critical difference between the method described here and other published methods is the use of RNase inhibitors and transcriptional inhibitors. Most methods are developed for Arabidopsis roots, from which protoplasts can be generated more easily. However, when working with leaves, excepting mesophyll, it is necessary to increase the protoplast generation time. Therefore it is important to include these inhibitors to protect against changes in gene expression as a result of the protoplast generation treatment itself (data not shown). However, the presence of the inhibitors leads to an inability to mount a transcription response, either by switching genes on or off, which is likely to make the protoplasts more vulnerable as this leads to a loss of plasticity with which to counter the stresses of the protoplasting procedure.
We have used the method described here successfully with a number of GFP- expressing Arabidopsis lines. Importantly, we have used this method with GFP lines expressing GFP either strongly in the nucleus, or much more weakly in a non-localized/diffuse cytosolic manner, as is the case with the KC464 and KC274 lines used here. Both types of lines are compatible with the method and yield highly enriched fractions of GFP-expressing protoplasts (Figure 2 and 3). The method could be easily adapted to other fluorophores, although the fluorophore must be selected for fluorescence that is significantly different from the autofluorescence of dead/dying cells in order to preserve the ability to select live cells.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent</td>
 <td>Company</td>
 <td>Catalogue number</td>
 </tr>
 <tr>
 <td>Cellulase R-10</td>
 <td>Melford</td>
 <td>C8001</td>
 </tr>
 <tr>
 <td>Cellulase RS</td>
 <td>Melford</td>
 <td>C8003</td>
 </tr>
 <tr>
 <td>Macerozyme R-10</td>
 <td>Melford</td>
 <td>M8002</td>
 </tr>
 <tr>
 <td>BSA</td>
 <td>Sigma-Aldrich</td>
 <td>A3912</td>
 </tr>
 <tr>
 <td>ProtectRNA</td>
 <td>Sigma-Aldrich</td>
 <td>R7397</td>
 </tr>
 <tr>
 <td>Actinomycin D</td>
 <td>Sigma-Aldrich</td>
 <td>A1410</td>
 </tr>
 <tr>
 <td>70 &mu;m cell strainer</td>
 <td>Fisher</td>
 <td>FB35181</td>
 </tr>
 <tr>
 <td>50 &mu;m filcon cup-type filters</td>
 <td>BD Biosciences</td>
 <td>340630</td>
 </tr>
 </tbody>
</table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the Arabidopsis leaf is a complex organ made up of many different cell types and several structures. At the same time, the growing leaf contains cells at different stages of development, with the cells furthest from the petiole being the first to stop expanding and undergo senescence1. Different cells within the leaf are therefore dividing, elongating or differentiating; active, stressed or dead; and/or responding to stimuli in sub-sets of their cellular type at any one time. This makes genomic study of the leaf challenging: for example when analyzing expression data from whole leaves, signals from genetic networks operating in distinct cellular response zones or cell types will be confounded, resulting in an inaccurate profile being generated.
To address this, several methods have been described which enable studies of cell specific gene expression. These include laser-capture microdissection (LCM)2 or GFP expressing plants used for protoplast generation and subsequent fluorescence activated cell sorting (FACS)3,4, the recently described INTACT system for nuclear precipitation5 and immunoprecipitation of polysomes6.
FACS has been successfully used for a number of studies, including showing that the cell identity and distance from the root tip had a significant effect on the expression profiles of a large number of genes3,7. FACS of GFP lines have also been used to demonstrate cell-specific transcriptional regulation during root nitrogen responses and lateral root development8, salt stress9 auxin distribution in the root10 and to create a gene expression map of the Arabidopsis shoot apical meristem11. Although FACS has previously been used to sort Arabidopsis leaf derived protoplasts based on autofluorescence12,13, so far the use of FACS on Arabidopsis lines expressing GFP in the leaves has been very limited4. In the following protocol we describe a method for obtaining Arabidopsis leaf protoplasts that are compatible with FACS while minimizing the impact of the protoplast generation regime. We demonstrate the method using the KC464 Arabidopsis line, which express GFP in the adaxial epidermis14, the KC274 line, which express GFP in the vascular tissue14 and the TP382 Arabidopsis line, which express a double GFP construct linked to a nuclear localization signal in the guard cells (data not shown; Figure 2). We are currently using this method to study both cell-type specific expression during development and stress, as well as heterogeneous cell populations at various stages of senescence.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

A method for producing Arabidopsis leaf protoplasts that are compatible with fluorescence activated cell sorting (FACS), allowing for studies of specific cell populations. This method is compatible with any Arabidopsis line that expresses GFP in a subset of cells.

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

15.1K vues.  University of Warwick. Procédé de fabrication d' Arabidopsis Protoplastes de feuilles qui sont compatibles avec le tri cellulaire activé par fluorescence (FACS), ce qui permet l'étude des populations cellulaires spécifiques. Cette méthode est compatible avec n'importe quel Arabidopsis Line qui exprime la GFP dans un sous-ensemble de cellules.

Vidéo: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling. These proteins display a diverse array of cellular functions including nuclear import/export of RNA and protein, transcriptional regulation, and apoptosis. Interestingly, major cellular reorganizations including cell division, differentiation and transformation, often involve such activities3,4,8,10. The detailed study of these proteins and their respective regulatory mechanisms can be challenging as the stimulation for these localization changes can be elusive, and the movements themselves can be quite dynamic and difficult to track. Studies involving cellular oncogenesis, for example, continue to benefit from understanding pathways and protein activities that differ between normal primary cells and transformed cells6,7,11,12. As many proteins show altered localization during transformation or as a result of transformation, methods to efficiently characterize these proteins and the pathways in which they participate stand to improve the understanding of oncogenesis and open new areas for drug targeting.
Here we present a method for the analysis of protein trafficking and shuttling activity between primary and transformed mammalian cells. This method combines the generation of heterokaryon fusions with fluorescence microscopy to provide a flexible protocol that can be used to detect steady-state or dynamic protein localizations. As shown in Figure 1, two separate cell types are transiently transfected with plasmid constructs bearing a fluoroprotein gene attached to the gene of interest. After expression, the cells are fused using polyethylene glycol, and protein localizations may then be imaged using a variety of methods. The protocol presented here is a fundamental approach to which specialized techniques may be added.

A flexible and efficient method for the characterization of cell type-specific protein localization and nucleocytoplasmic shuttling is described. This heterokaryon approach uses fluorescently-labeled fusion proteins to image protein localizations after cell fusion. The protocol is amenable to steady-state localizations or more dynamic determinations based on live cell imaging.

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the mechanisms are not well understood. To investigate coral response to stressors, we need tools for analyzing cellular responses. In particular, we need tools that facilitate the application of functional assays to better understand how cell populations are reacting to stress. In the current study, we use fluorescence-activated cell sorting (FACS) to isolate and separate different cell populations in stony corals. This protocol includes: (1) the separation of coral tissues from the skeleton, (2) creation of a single cell suspension, (3) labeling the coral cells using various markers for flow cytometry, and (4) gating and cell sorting strategies. This method will enable researchers to work on corals at the cellular level for analysis, functional assays, and gene expression studies of different cell populations.

Corals create biodiverse ecosystems important for both humans and marine organisms. However, we still do not understand the full potential and function of many coral cells. Here, we present a protocol developed for the isolation, labeling, and separation of stony coral cell populations.

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...