Supported by funding from the Italian Association for Cancer Research (AIRC) to MF (MFAG 11676) and to MN (Special Program Molecular Clinical Oncology - 5 per mille n. 9980, 2010/15) and from the Italian Ministry of Instruction, University and Research FIRB 2011 to MN (Project RBAPIIBYNP).

MicroRNA Isolation from Plasma or Serum
Note: Plasma and serum preparation is a relevant step in circulating miRNA quantification. There is no preferred procedure for plasma and serum preparation. The only important thing to consider is that all the samples from the same experiment must be processed using exactly the same workflow. Start from 200 &#181;l serum or plasma. Total RNA can be isolated from serum or plasma using commercially available kits.
1. Protocol for Total RNA (including mi...

<ol>
	<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Argonaute2+complexes+carry+a+population+of+circulating+microRNAs+independent+of+vesicles+in+human+plasma.">Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.</a> Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).</li><li>Skog, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioblastoma+microvesicles+transport+RNA+and+proteins+that+promote+tumour+growth+and+provide+diagnostic+biomarkers.">Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers.</a> Nat Cell Biol. 10, 1470-1476 (2008).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Braicu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomes+as+divine+messengers:+are+they+the+Hermes+of+modern+molecular+oncology.">Exosomes as divine messengers: are they the Hermes of modern molecular oncology.</a> Cell Death Differ. 22, 34-45 (2015).</li><li>Creemers, E. E., Tijsen, A. J., Pinto, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs:+novel+biomarkers+and+extracellular+communicators+in+cardiovascular+disease.">Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease.</a> Circ Res. 110, 483-495 (2012).</li><li>Guay, C., Regazzi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+as+novel+biomarkers+for+diabetes+mellitus.">Circulating microRNAs as novel biomarkers for diabetes mellitus.</a> Nat Rev Endocrinol. 9, 513-521 (2013).</li><li>Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+relevance+of+circulating+cell-free+microRNAs+in+cancer.">Clinical relevance of circulating cell-free microRNAs in cancer.</a> Nat Rev Clin Oncol. 11, 145-156 (2014).</li><li>Moldovan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodological+challenges+in+utilizing+miRNAs+as+circulating+biomarkers.">Methodological challenges in utilizing miRNAs as circulating biomarkers.</a> J Cell Mol Med. 18, 371-390 (2014).</li><li>Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Challenges+in+Using+Circulating+miRNAs+as+Cancer+Biomarkers.">Challenges in Using Circulating miRNAs as Cancer Biomarkers.</a> Biomed Res Int. 2015, 731479 (2015).</li><li>Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+validity+of+circulating+microRNAs+in+oncology:+five+years+of+challenges+and+contradictions.">The validity of circulating microRNAs in oncology: five years of challenges and contradictions.</a> Mol Oncol. 8, 819-829 (2014).</li><li>Witwer, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+MicroRNA+Biomarker+Studies:+Pitfalls+and+Potential+Solutions.">Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions.</a> Clin Chem. 61, 56-63 (2015).</li><li>Miotto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+Circulating+miRNAs+by+Droplet+Digital+PCR:+Comparison+of+EvaGreen-+and+TaqMan-Based+Chemistries.">Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries.</a> Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).</li><li>Ferracin, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+of+cell-free+microRNAs+in+cancer+patients.">Absolute quantification of cell-free microRNAs in cancer patients.</a> Oncotarget. , (2015).</li><li>Mangolini, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+and+prognostic+microRNAs+in+the+serum+of+breast+cancer+patients+measured+by+droplet+digital+PCR.">Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR.</a> Biomarker Research. , (2015).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nat Methods. 10, 1003-1005 (2013).</li><li>Mestdagh, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+quantitative+miRNA+expression+platforms+in+the+microRNA+quality+control+(miRQC)+study.">Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.</a> Nat Methods. 11, 809-815 (2014).</li></ol>

Circulating miRNAs are present in blood at extremely low concentrations and the amount of RNA that can be extracted from plasma and serum samples is low. For this reason, they are difficult to quantify with other techniques such as microarray and RNA sequencing. Moreover, there is a generalized lack of agreement on data normalization and the presence of endogenous &#34;reference&#34; miRNAs in the blood. In this context, a sensitive technology like droplet digital PCR, capable of counting the number of miRNA copies per m...

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14. 
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.

<table >
	
		
		
		
		
	
	<tbody>
		<tr >
			<td >miRNeasy Mini Kit</td>
			<td >Qiagen</td>
			<td >217004</td>
			<td >Columns for total RNA, including miRNA, extraction from serum/plasma</td>
		</tr>
		<tr >
			<td >100 nmole RNA oligo Cel-miR-39-3p</td>
			<td >Integrated DNA Technologies</td>
			<td >Custom</td>
			<td >Sequence: UCACCGGGUGUAAAUCAGCUUG</td>
		</tr>
		<tr >
			<td >Universal cDNA synthesis kit II, 8-64 rxns</td>
			<td >Exiqon</td>
			<td >203301</td>
			<td >Kit for microRNA reverse transcription</td>
		</tr>
		<tr >
			<td >MicroRNA LNA PCR primer set&#160;</td>
			<td >Exiqon</td>
			<td >204000-206xxx and 2100000-21xxxxx</td>
			<td >Primers for miRNA amplification inside droplets</td>
		</tr>
		<tr >
			<td >QX200 droplet generator</td>
			<td >BioRad</td>
			<td >186-4002</td>
			<td >Instrument used for droplet reading</td>
		</tr>
		<tr >
			<td >QX200 droplet reader</td>
			<td >BioRad</td>
			<td >186-4003</td>
			<td >Instrument used for droplet generation</td>
		</tr>
		<tr >
			<td >QuantaSoft software</td>
			<td >BioRad</td>
			<td >186-3007</td>
			<td >Software for data collection and analysis</td>
		</tr>
		<tr >
			<td >PX1 PCR plate sealer</td>
			<td >BioRad</td>
			<td >181-4000</td>
			<td >Plate sealer</td>
		</tr>
		<tr >
			<td >DG8 droplet generator cartridges and gaskets</td>
			<td >BioRad</td>
			<td >186-4008</td>
			<td >Cartridges used to mix sample and oil to generate droplets</td>
		</tr>
		<tr >
			<td >QX200 ddPCR EvaGreen supermix</td>
			<td >BioRad</td>
			<td >186-4033/36</td>
			<td >PCR supermix</td>
		</tr>
		<tr >
			<td >QX200 droplet generator oil for EvaGreen dye</td>
			<td >BioRad</td>
			<td >186-4005</td>
			<td >Oil for droplet generation</td>
		</tr>
	</tbody>
</table>

circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been linked to a disease state and has the potential to be used as disease biomarker. A sensitive and accurate method for circulating microRNA quantification using a dye-based chemistry and droplet digital PCR technology has been recently developed. Specifically, using Locked Nucleic Acid (LNA)-based miRNA-specific primers with a green fluorescent DNA-binding dye in a compatible droplet digital PCR system it is possible to obtain the absolute quantification of specific miRNAs. Here, we describe how performing this technique to assess miRNA amount in biological fluids, such as plasma and serum, is both feasible and effective.

The absolute amount of specific miRNAs per ml of plasma or serum can be determined using a green fluorescent DNA-binding dye and droplet digital PCR technology. Figure 1 presents the process of positive-droplets selection, which determines the final miRNA concentration (copies/&#181;l) in the amplification reaction calculated by the analysis software. The amount of each miRNA in the blood is very different, being some miRNA species more abundant than others. Using a 1:50 ...

Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been ...

The overall goal of this procedure is to quantify circulating microRNAs and biological fluids, such as plasma or serum, using droplet digital PCR technology. The method can help answer question in the biomarket field. By identifying diagnostic and prognostic, biomarketing cancer.The main advantage of this technique is at the high sensitivity. It can be used to quantify also the less abundant microRNAs without requiring an androgynous reference gene. Implication of this method extend toward cancer diagnostic because it has the potential to identify people with early stage cancer.It can also be applied to other diseases such as neurological or cardiac disorders. Generally, individuals need to pay attention to the manipulation of droplets before thermal cycling step to avoid their disruption. Hence, a visual demonstration of the droplet generation is critical because the droplets can be destroyed by careless manipulation or too fast pipetting.Begin this procedure by isolating plasma or serum microRNAs. Then reverse transcribing and diluting them as described in the accompanying document. Remove the EvaGreen master mix microRNA primer set and cDNA from the freezer and allow them to thaw at room temperature.After it has thawed, invert the master mix tube several times. And then spin down all of the reagents. Prepare a droplet digital, or ddPCR mix working solution according to the instructions in the accompanying document.Prepare enough for up to eight samples with a no-template control for each condition plus an excess of 10%Once assembled, thoroughly mix and spin down the ddPCR mix. Note that technical replicates are not required due to the high-reproducibility of this technology. After the spin, dispense 12 microliters of ddPCR mix into each well of a 96-well PCR plate.Add eight microliters of diluted cDNA template to each well. Then insert the droplet generator cartridge into the cartridge holder. To the middle row of the droplet generator cartridge, carefully transfer 20 microliters of each prepared sample.Avoid introducing air bubbles to the bottom of the well. Fill each of the oil wells in the bottom row with 70 microliters of droplet generator oil. Hook the gasket over the cartridge holder.Insert into the droplet generator and close the lid to start the droplet generation. When the droplet generation has finished, open the lid, remove the cartridge from the droplet generator, and remove the disposable gasket. The top wells of the cartridge contain the droplets.Slowly and smoothly transfer 40 microliters from each of the eight top wells into a single column of a 96-well PCR plate. Immediately seal the plate with foil to avoid evaporation. Within 30 minutes of sealing the plate, begin thermal cycling using the PCR protocol described in table three of the accompanying document.Power on the droplet reader. Then move the plate from the thermal cycler to the droplet reader. Place the 96-well PCR plate containing the post-PCR droplets into the base of the plate holder in the droplet reader.Place the top of the plate holder on the PCR plate. Firmly press both release tabs down to secure the PCR plate in the holder. Start the QuantaLife software from the system PC.Click Setup and open the template data file which has information about the samples, target genes, and assays.From the left-side navigation bar, select Run. A Run Options window will appear. From the Dye Set menu, select EVA, and click OK to start the droplet reading.Once the run is complete, use the 2D Amplitude plot in the analysis software to select the positive droplets. To select the positive droplets, use the lasso tool from the left-side navigation bar. Next, click on the Events tab to check the number of positive and total droplets.A total number of 18, 000 droplets are usually achieved with probeless ddPCR. Then click on the Concentration tab to visualize the final sample of concentration. Finally use the Export.CSV to export the microRNA concentration values. The mRNA miR-181a-5p was quantified in two plasma samples, S1 and S2, using 0.5 and one microliter primer concentration at annealing temperatures of 58 and 60 degrees Celsius. This figure presents the copies of microRNA per microliter in the amplification reaction for each condition.PCR positive droplets for each sample are shown in blue, and negative droplets are shown in black. As can be seen here, the control sample has no positive droplets as expected. Performing the PCR at 60 degrees Celsius with using either a 0.5 or one microliter of primer resulted in a better separation of positive and negative droplets.In this figure, the error bars represent the Poisson 95%confidence interval. And here, the number of positive droplets shown in blue, are compared to the total number of droplets, shown in green. Taken together, these data demonstrate that the droplet digital PCR can be used to determine the absolute number of copies of microRNA per microliter of a biological fluid.After watching this video, you should have a good understanding on how to perform a mRNA quantification using droplet digital PCR. Once mastered, 96 samples can be analyzed in just a few hours, which is an optimal output for a clinical setting. After each development, this technique pave the way to the field of liquid biopsy to explore microRNA and other nucleic acid as disease biomarkers.

circulating-microrna-quantification-using-dna-binding-dye-chemistry

Research

JoVE Journal

Bioengineering

8.5K vues.  University of Bologna. The overall goal of this procedure is to quantify circulating microRNAs and biological fluids, such as plasma or serum, using droplet digital PCR technology. The method can help answer question in the biomarket field. By identifying diagnostic and prognostic, biomarketing cancer.The main advantage of this technique is at the high sensitivity. It can be used to quantify also the less abundant microRNAs without requiring an androgynous reference gene. Implication of this method extend to...