(-, 15분의 2,010 9,980 5 밀레 N 당. 특별 프로그램 분자 임상 종양)와, 대학 수업의 이탈리아 교육부에서 MF (MFAG 11676)에 암 연구를위한 이탈리아 협회 (AIRC)로부터 MN에 자금을 지원하는 MN에 대한 연구 FIRB 2011 (프로젝트 RBAPIIBYNP).

혈장 또는 혈청에서 마이크로 RNA 분리 참고 : 플라즈마 및 혈청 준비의 miRNA 정량 순환에 중요한 단계이다. 플라즈마 및 혈청 준비를위한 기본 절차는 없습니다. 고려해야 만 중요한 것은 동일한 실험에서 모든 샘플은 동일 흐름을 사용하여 처리 할 수​​ 있어야한다는 것이다. 200 μL의 혈청 또는 혈장에서 시작합니다. 총 RNA를 상업적으로 이용 가능한 키트를 사용하여 혈청 또는 혈장으로부터 분리 될 수있다. 1. (miRNA를 포함) 총 RNA를위한 프로토콜 절연 <ol><li> 얼음에 해동 혈청 / 혈장 샘플. </li><li> 200 μL 혈청 / 플라즈마에 용해 시약 (예., QIAzol)의 1 ML을 추가합니다. </li><li> 텍싱하여 혼합하고 5 분 동안 실온에서 벤치에 균질를 포함하는 튜브를 배치합니다. </li><li> C.에서 합성의 miRNA CEL-은 miR-39-3p의 4.16 nM의 용액 3 μl를 추가 간스. </li><li> 클로로포름 200 μl를 추가합니다. 15 초 동안 적극적으로 튜브를 흔들어. 장소 일2 분 동안 실온에서 벤치에 전자 튜브. </li><li> 4 ° C에서 12,000 XG에 15 분 동안 원심 분리 단계 분리를 구하는 : 위 수성 단계는 RNA가 포함되어 있습니다. </li><li> , 새로운 튜브에 700 μl를 수성 상을 이동하는 흰색 계면 물질의 이동을 피하십시오. </li><li> 100 % 에탄올 1 ML을 추가하고 반전으로 섞는다. </li><li> 피펫은 최대 미니 스핀 컬럼에 시료 700 μL은 2 ㎖의 포집 관에 배치합니다. 15 초 동안 12,000 XG에 뚜껑 원심 분리기를 닫습니다. 흐름 -을 통해 폐기하십시오. </li><li> 나머지 샘플을 사용하여이 단계를 반복합니다. </li><li> 미니 스핀 컬럼에 700 ㎕의 버퍼 RWT 추가 열을 씻어 12,000 XG에 15 초 동안 뚜껑과 원심 분리기를 닫습니다. 흐름 -을 통해 폐기하십시오. </li><li> 미니 스핀 열에 피펫 500 μL 버퍼 RPE. 12,000 rpm에서 15 초 동안 뚜껑과 원심 분리기를 닫습니다. 흐름 -을 통해 폐기하십시오. 다시이 단계를 반복합니다. </li><li> 스핀 열을 건조 2 분 동안 전속력으로 미니 스핀 컬럼을 원심 분리기잔류 에탄올에서 막. </li><li> 컬럼의 막에 새로운 1.5 ml의 수집 관 및 피펫 35 μL의 RNA 분해 효소가없는 물을에 미니​​ 스핀 컬럼을 전송합니다. </li><li> RNA의를 용출 12,000 XG에서 1 분 동안 원심 분리기. </li><li> -80 ° C에서 RNA를 저장합니다. 주 : RNA의 농도를 정확하게 측정 할 수 없기 때문에, 입력 된 금액에 대한 척도로서 고정 볼륨을 사용한다. </li></ol> 2. 마이크로 RNA 역전사 <ol><li> 배 반응 완충액 클레아없는 물 : 역전사 (RT) 시약을 혼합 성분을 해동. 믹스 부드럽게 얼음에 튜브와 장소를 반전. 즉시 사용하기 전에, 냉동고에서 효소 믹스를 제거하고 얼음에 배치합니다. 모든 시약을 스핀. </li><li> 표 1에 설명 된 바와 같이 얼음의 RT 시약 혼합물을 준비한다. 적어도 10 %를 초과하는 조합을 준비한다. </li><li> 피펫으로 반응을 혼합 한 다음 스핀 다운. </li><li> 42 ℃에서 60 분 동안 품어. </li><li> 되돌리기를 열 - 불 활성화95 ℃에서 5 분 자체의 효소. </li><li> 즉시 4 ℃로 냉각. </li><li> -20 ° C에서 cDNA를 저장합니다. </li></ol> 3. cDNA를 희석 <ol><li> 클레아없는 물에서 계획된 ddPCR 반응에 필요한 서식하는 cDNA의 양을 희석. 1:50 1 사이의 cDNA의 반응을 희석 : (500)을 물에 대상 miRNA의 풍부에 따라 다릅니다. -20 ° C에서 희석 된 cDNA를 저장합니다. 희석 된 cDNA는 -20 ° C에서 3 개월 이상 안정한 것으로 판명되었다. </li></ol> 4. 물방울 생성 및 PCR 주 : 액적 생성 한 번에 8 개의 샘플들에 대해 수행되어야한다. 기술 복제로 인해 12,15 .A 아니 템플릿 컨트롤 (NTC) 샘플은 모든 판에서 실행되어야합니다이 기술의 높은 재현성에 각각 다른 ddPCR 조건에 대해, 필요하지 않습니다. <ol><li> 해동 마스터 믹스를 평형 (예., EvaGreen 마스터 믹스) 실온에서, 마이크로 RNA 프라이머 세트와 cDNA를. </li><li> 마스터 믹스 번째 믹스oroughly 튜브를 수회 반전. 모든 시약을 스핀 다운. </li><li> 표 2에 기재된 바와 같이 ddPCR 혼합물을 준비한다. 여러 ddPCR 반응이 수행되는 경우, 작동 ddPCR-용액을 섞어 제조. 10 % 이상 초과 믹스를 준비합니다. </li><li> 조립 후 잘 혼합하고 ddPCR 믹스를 스핀 다운. </li><li> ddPCR 12 μL를 96- 웰 PCR 플레이트 또는 PCR 튜브에 혼입 분배. </li><li> 잘 / 각각의 튜브로 희석 cDNA를 템플릿의 8 μl를 추가합니다. </li><li> 홀더에 방울 생성기 카트리지를 삽입합니다. </li><li> 전송 공기를 피하는 웰의 바닥에 기포 조심하면서 방울 생성기 카트리지의 샘플 웰 (중간 행)에 각각 준비된 샘플 20 μL. </li><li> 방울 생성기 오일의 70 μl를 각 유정 (아랫 줄)을 입력합니다. </li><li> 카트리지 홀더 위에 개스킷 후크 및 방울 생성기 삽입. </li><li> 제조 업체의 홍보에 따른 액적 생성을 시작하기 위해 덮개를 닫습니다otocol. 액적 생성이 완료되면, 뚜껑을 열고 일회용 가스켓을 제거합니다. 카트리지의 상단 우물은 물방울이 포함되어 있습니다. </li><li> 96 웰 PCR 플레이트의 한 칼럼에 팔 상부 웰 (액적)의 내용 피펫 천천히 부드럽게 40 μL. </li><li> 즉시 증발을 방지하기 위해 물방울 전사 후 호일 PCR 플레이트를 밀봉. 액적 리더의 바늘과 호환되는 천 공식 박 플레이트 씰을 사용합니다. </li><li> 플레이트를 밀봉 30 분 이내에 열 사이클링 (PCR)를 시작합니다. </li><li> 표 3에 따른 순환 프로토콜을 수행합니다. </li></ol> 5. 물방울 읽기 <ol><li> 액적 리더의 전원을 켭니다. </li><li> 액적 리더에 열 자전거 타는 사람에서 접시를 이동합니다. </li><li> 판 홀더의베이스로 후 PCR 방울을 함유하는 96 웰 PCR 플레이트를 놓는다. </li><li> PCR을 접시에 판 홀더의 상부를 놓습니다. 단단히 모두 분리 탭을 눌러아래 홀더에 PCR 플레이트를 고정합니다. </li><li> 시스템 PC에서 소프트웨어를 시작합니다. <ol><li> 실험 (절대 정량)를 정의하는 설정을 클릭 한 다음 방울​​ 독서를 시작하려면 실행을 클릭합니다. </li><li> 액적 판독이 완료되면, 열기를 클릭하여 데이터를 분석하는 버튼 &quot;분석&quot;. </li><li> 양의 물방울 (올가미 도구) (그림 1B)를 선택하는 분석 소프트웨어에서 2D 진폭 플롯을 사용합니다. </li><li> 긍정적이고 총 방울의 수를 확인하기 위해 이벤트 탭을 사용합니다. 18,000의 총 - 21,000 방울은 일반적으로 probeless ddPCR 달성된다. </li><li> 양의 물방울이 선택되면, 농도 탭에서 수출 .CSV 옵션을 사용하여 miRNA의 농도 값을 내보낼 수 있습니다. </li></ol></li></ol>

<ol>
	<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Argonaute2+complexes+carry+a+population+of+circulating+microRNAs+independent+of+vesicles+in+human+plasma.">Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.</a> Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).</li><li>Skog, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioblastoma+microvesicles+transport+RNA+and+proteins+that+promote+tumour+growth+and+provide+diagnostic+biomarkers.">Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers.</a> Nat Cell Biol. 10, 1470-1476 (2008).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Braicu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomes+as+divine+messengers:+are+they+the+Hermes+of+modern+molecular+oncology.">Exosomes as divine messengers: are they the Hermes of modern molecular oncology.</a> Cell Death Differ. 22, 34-45 (2015).</li><li>Creemers, E. E., Tijsen, A. J., Pinto, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs:+novel+biomarkers+and+extracellular+communicators+in+cardiovascular+disease.">Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease.</a> Circ Res. 110, 483-495 (2012).</li><li>Guay, C., Regazzi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+as+novel+biomarkers+for+diabetes+mellitus.">Circulating microRNAs as novel biomarkers for diabetes mellitus.</a> Nat Rev Endocrinol. 9, 513-521 (2013).</li><li>Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+relevance+of+circulating+cell-free+microRNAs+in+cancer.">Clinical relevance of circulating cell-free microRNAs in cancer.</a> Nat Rev Clin Oncol. 11, 145-156 (2014).</li><li>Moldovan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodological+challenges+in+utilizing+miRNAs+as+circulating+biomarkers.">Methodological challenges in utilizing miRNAs as circulating biomarkers.</a> J Cell Mol Med. 18, 371-390 (2014).</li><li>Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Challenges+in+Using+Circulating+miRNAs+as+Cancer+Biomarkers.">Challenges in Using Circulating miRNAs as Cancer Biomarkers.</a> Biomed Res Int. 2015, 731479 (2015).</li><li>Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+validity+of+circulating+microRNAs+in+oncology:+five+years+of+challenges+and+contradictions.">The validity of circulating microRNAs in oncology: five years of challenges and contradictions.</a> Mol Oncol. 8, 819-829 (2014).</li><li>Witwer, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+MicroRNA+Biomarker+Studies:+Pitfalls+and+Potential+Solutions.">Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions.</a> Clin Chem. 61, 56-63 (2015).</li><li>Miotto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+Circulating+miRNAs+by+Droplet+Digital+PCR:+Comparison+of+EvaGreen-+and+TaqMan-Based+Chemistries.">Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries.</a> Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).</li><li>Ferracin, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+of+cell-free+microRNAs+in+cancer+patients.">Absolute quantification of cell-free microRNAs in cancer patients.</a> Oncotarget. , (2015).</li><li>Mangolini, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+and+prognostic+microRNAs+in+the+serum+of+breast+cancer+patients+measured+by+droplet+digital+PCR.">Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR.</a> Biomarker Research. , (2015).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nat Methods. 10, 1003-1005 (2013).</li><li>Mestdagh, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+quantitative+miRNA+expression+platforms+in+the+microRNA+quality+control+(miRQC)+study.">Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.</a> Nat Methods. 11, 809-815 (2014).</li></ol>

The authors have nothing to disclose.

순환의 miRNAs는 매우 낮은 농도에서 혈액 내 존재하는 혈장 및 혈청 샘플에서 추출 할 수있는 RNA의 양이 적다. 이 때문에, 그것들은 마이크로 어레이 및 RNA 서열 분석과 같은 다른 기술을 정량화하기 어렵다. 또한, 데이터의 정규화 계약 일반화 부족 혈중 내인성 &quot;참조&quot;의 miRNAs의 존재가있다. 이러한 맥락에서, 혈청 또는 혈장해도 매우 낮은 1 ㎖ 당 miRNA의 매수를 카운트 할 수있는 액적 디지?...

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14. 
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.

<table >
	
		
		
		
		
	
	<tbody>
		<tr >
			<td >miRNeasy Mini Kit</td>
			<td >Qiagen</td>
			<td >217004</td>
			<td >Columns for total RNA, including miRNA, extraction from serum/plasma</td>
		</tr>
		<tr >
			<td >100 nmole RNA oligo Cel-miR-39-3p</td>
			<td >Integrated DNA Technologies</td>
			<td >Custom</td>
			<td >Sequence: UCACCGGGUGUAAAUCAGCUUG</td>
		</tr>
		<tr >
			<td >Universal cDNA synthesis kit II, 8-64 rxns</td>
			<td >Exiqon</td>
			<td >203301</td>
			<td >Kit for microRNA reverse transcription</td>
		</tr>
		<tr >
			<td >MicroRNA LNA PCR primer set&#160;</td>
			<td >Exiqon</td>
			<td >204000-206xxx and 2100000-21xxxxx</td>
			<td >Primers for miRNA amplification inside droplets</td>
		</tr>
		<tr >
			<td >QX200 droplet generator</td>
			<td >BioRad</td>
			<td >186-4002</td>
			<td >Instrument used for droplet reading</td>
		</tr>
		<tr >
			<td >QX200 droplet reader</td>
			<td >BioRad</td>
			<td >186-4003</td>
			<td >Instrument used for droplet generation</td>
		</tr>
		<tr >
			<td >QuantaSoft software</td>
			<td >BioRad</td>
			<td >186-3007</td>
			<td >Software for data collection and analysis</td>
		</tr>
		<tr >
			<td >PX1 PCR plate sealer</td>
			<td >BioRad</td>
			<td >181-4000</td>
			<td >Plate sealer</td>
		</tr>
		<tr >
			<td >DG8 droplet generator cartridges and gaskets</td>
			<td >BioRad</td>
			<td >186-4008</td>
			<td >Cartridges used to mix sample and oil to generate droplets</td>
		</tr>
		<tr >
			<td >QX200 ddPCR EvaGreen supermix</td>
			<td >BioRad</td>
			<td >186-4033/36</td>
			<td >PCR supermix</td>
		</tr>
		<tr >
			<td >QX200 droplet generator oil for EvaGreen dye</td>
			<td >BioRad</td>
			<td >186-4005</td>
			<td >Oil for droplet generation</td>
		</tr>
	</tbody>
</table>

circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr

마이크로 RNA (miRNA가) (무 세포들)은 순환 혈류로 세포로부터 방출된다. 순환 특정 마이크로 RNA의 양은 질병 상태에 연결된 질병 표지자로서 사용될 수있는 잠재력을 가지고있다. 디지털 PCR 기술 염료 계 화학 제를 사용하여 액적 마이크로 RNA 정량화를 순환 민감하고 정확한 방법이 최근 개발되고있다. 구체적으로, 핵산 (LNA)을 그 고유의 miRNA의 절대 정량을 얻을 수있다 호환 액적 디지털 PCR 시스템에서 녹색 형광 DNA 결합 염료 miRNA에 특이 적 프라이머를 사용하여 잠김 기반. 여기, 우리는이 기술을 수행하는 플라즈마 및 혈청 등의 생물학적 유체에서 miRNA의 양을 평가하는 방법을 설명, 가능하고 효과적이다.

혈장 또는 혈청 1 ㎖ 당 특정의 miRNAs의 절대량 디지털 PCR 기술을 녹색 형광 DNA 결합 염료를 사용하여 액적으로 결정될 수있다. (1)가 최종 miRNA의 농도를 결정하는 포지티브 방울 선택의 과정을 제시 도면 (그 사본 / μL ) 분석 소프트웨어에 의해 계산 된 증폭 반응이다. 혈액의 각 miRNA의 양은 다른 것들보다 일부의 miRNA 종 더 풍부되고, 매우 상이하?...

Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

마이크로 RNA 정량는 DNA 결합 염료 화학, 물방울 디지털 PCR을 사용하여 순환

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been ...

circulating-microrna-quantification-using-dna-binding-dye-chemistry

Research

JoVE Journal

Bioengineering

8.5K 조회수.  University of Bologna. A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

비디오: Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the research and pharmaceutical communities. To study miRNAs, it is essential that the quantification of microRNA levels is accurate and robust. By comparing wild-type to small RNA deficient mouse embryonic stem cells (mESC), we revealed a lack of accuracy and robustness in previous published multiplex qRT-PCR techniques. Here, we describe an optimized method, including purifying away excessive primers from previous multiplex steps before singleplex real time detection, which dramatically increases the accuracy and robustness of the technique. Furthermore, we explain how performing the technique on a microfluidic chip at nanoliter volumes significantly reduces reagent costs and permits time effective high throughput miRNA expression profiling.

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

높은 처리량 MicroRNA의 프로파일 : 최적 멀티 플렉스 플루 동적 ArrayTM의 IFCs에 Nanoliter의 규모 qRT - PCR

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

연구

생체공학

Fluorescence detection methods for microfluidic droplet platforms

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that accompany system miniaturisation. Advantages include the ability to efficiently process nano- to femoto- liter volumes of sample, facile integration of functional components, an intrinsic predisposition towards large-scale multiplexing, enhanced analytical throughput, improved control and reduced instrumental footprints.1
In recent years much interest has focussed on the development of droplet-based (or segmented flow) microfluidic systems and their potential as platforms in high-throughput experimentation.2-4 Here water-in-oil emulsions are made to spontaneously form in microfluidic channels as a result of capillary instabilities between the two immiscible phases. Importantly, microdroplets of precisely defined volumes and compositions can be generated at frequencies of several kHz. Furthermore, by encapsulating reagents of interest within isolated compartments separated by a continuous immiscible phase, both sample cross-talk and dispersion (diffusion- and Taylor-based) can be eliminated, which leads to minimal cross-contamination and the ability to time analytical processes with great accuracy. Additionally, since there is no contact between the contents of the droplets and the channel walls (which are wetted by the continuous phase) absorption and loss of reagents on the channel walls is prevented.
Once droplets of this kind have been generated and processed, it is necessary to extract the required analytical information. In this respect the detection method of choice should be rapid, provide high-sensitivity and low limits of detection, be applicable to a range of molecular species, be non-destructive and be able to be integrated with microfluidic devices in a facile manner. To address this need we have developed a suite of experimental tools and protocols that enable the extraction of large amounts of photophysical information from small-volume environments, and are applicable to the analysis of a wide range of physical, chemical and biological parameters. Herein two examples of these methods are presented and applied to the detection of single cells and the mapping of mixing processes inside picoliter-volume droplets. We report the entire experimental process including microfluidic chip fabrication, the optical setup and the process of droplet generation and detection.

Droplet-based microfluidic platforms are promising candidates for high throughput experimentation since they are able to generate picoliter, self-compartmentalized vessels inexpensively at kHz rates. Through integration with fast, sensitive and high resolution fluorescence spectroscopic methods, the large amounts of information generated within these systems can be efficiently extracted, harnessed and utilized.

microfluidic 비말 플랫폼 형광 검출 방법

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Detection and Isolation of Circulating Melanoma Cells using Photoacoustic Flowmetry

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed secondary tumors1,2,3. CTCs are indicators of metastatic disease and their detection in blood samples may be used to diagnose cancer and monitor a patient&prime;s response to therapy. Since CTCs are rare, comprising about one tumor cell among billions of normal blood cells in advanced cancer patients, their detection and enumeration is a difficult task. We exploit the presence of pigment in most melanoma cells to generate photoacoustic, or laser induced ultrasonic waves in a custom flow cytometer for detection of circulating melanoma cells (CMCs)4,5. This process entails separating a whole blood sample using centrifugation and obtaining the white blood cell layer. If present in whole blood, CMCs will separate with the white blood cells due to similar density. These cells are resuspended in phosphate buffered saline (PBS) and introduced into the flowmeter. Rather than a continuous flow of the blood cell suspension, we induced two phase flow in order to capture these cells for further study. In two phase flow, two immiscible liquids in a microfluidic system meet at a junction and form alternating slugs of liquid6,7. PBS suspended white blood cells and air form microliter slugs that are sequentially irradiated with laser light. The addition of a surfactant to the liquid phase allows uniform slug formation and the user can create different sized slugs by altering the flow rates of the two phases. Slugs of air and slugs of PBS with white blood cells contain no light absorbers and hence, do not produce photoacoustic waves. However, slugs of white blood cells that contain even single CMCs absorb laser light and produce high frequency acoustic waves. These slugs that generate photoacoustic waves are sequestered and collected for cytochemical staining for verification of CMCs.

We have developed a flow cytometer using laser induced ultrasound to detect circulating melanoma cells as an early indicator of metastatic disease.

Photoacoustic Flowmetry를 사용하여 순환 흑색증 전지의 탐지 및 격리

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed ...

Diagnosis of Neoplasia in Barrett&#8217;s Esophagus using Vital-dye Enhanced Fluorescence Imaging

The ability to differentiate benign metaplasia in Barrett&#8217;s Esophagus (BE) from neoplasia in vivo remains difficult as both tissue types can be flat and indistinguishable with white light imaging alone. As a result, a modality that highlights glandular architecture would be useful to discriminate neoplasia from benign epithelium in the distal esophagus. VFI is a novel technique that uses an exogenous topical fluorescent contrast agent to delineate high grade dysplasia and cancer from benign epithelium. Specifically, the fluorescent images provide spatial resolution of 50 to 100 &#956;m&#160;and a field of view up to 2.5 cm,&#160;allowing endoscopists to visualize glandular morphology. Upon excitation, classic Barrett&#8217;s metaplasia appears as continuous, evenly-spaced glands and an overall homogenous morphology; in contrast, neoplastic tissue appears crowded with complete obliteration of the glandular framework. Here we provide an overview of the instrumentation and enumerate the protocol of this new technique. While VFI affords a gastroenterologist with the glandular architecture of suspicious tissue, cellular dysplasia cannot be resolved with this modality. As such, one cannot morphologically distinguish Barrett&#8217;s metaplasia from BE with Low-Grade Dysplasia via this imaging modality. By trading off a decrease in resolution with a greater field of view, this imaging system can be used at the very least as a red-flag imaging device to target and biopsy suspicious lesions; yet, if the accuracy measures are promising, VFI may become the standard imaging technique for the diagnosis of neoplasia (defined as either high grade dysplasia or cancer) in the distal esophagus.

Vital-dye enhanced fluorescence imaging (VFI) is a novel in vivo technique that combines high-resolution epithelial imaging with exogenous topical fluorescent contrast to highlight glandular morphology and delineate neoplasia (high grade dysplasia and cancer) in the distal esophagus.

The ability to differentiate benign metaplasia in Barrett&#8217;s Esophagus (BE) from neoplasia in vivo remains difficult as both tissue types can be flat ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have witnessed a tremendous increase in interest in EVs. EVs have been shown to play important roles in various physiological and pathological processes, including coagulation, immune responses, and cancer. In addition, EVs have potential as therapeutic agents, for instance as drug delivery vehicles or as regenerative medicine. Because of their small size (50 to 1,000 nm) accurate quantification and size profiling of EVs is technically challenging.
This protocol describes how tunable resistive pulse sensing (tRPS) technology, using the qNano system, can be used to determine the concentration and size of EVs. The method, which relies on the detection of EVs upon their transfer through a nano sized pore, is relatively fast, suffices the use of small sample volumes and does not require the purification and concentration of EVs. Next to the regular operation protocol an alternative approach is described using samples spiked with polystyrene beads of known size and concentration. This real-time calibration technique can be used to overcome technical hurdles encountered when measuring EVs directly in biological fluids.

Extracellular vesicles play important roles in physiological and pathological processes, including coagulation, immune responses, and cancer or as potential therapeutic agents in drug delivery or regenerative medicine. This protocol presents methods for the quantification and size characterization of isolated and non-isolated extracellular vesicles in various fluids using tunable resistive pulse sensing.

정량화 및 조정 가능한 저항 펄스 감지 기능을 사용하여 세포 외 소포의 크기 프로파일 링

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

Multicolor Fluorescence Detection for Droplet Microfluidics Using Optical Fibers

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as multiplex assays, enzyme evolution, and molecular biology enhanced cell sorting require the detection of two or more colors of fluorescence. Standard multicolor detection systems that couple free space lasers to epifluorescence microscopes are bulky, expensive, and difficult to maintain. In this paper, we describe a scheme to perform multicolor detection by exciting discrete regions of a microfluidic channel with lasers coupled to optical fibers. Emitted light is collected by an optical fiber coupled to a single photodetector. Because the excitation occurs at different spatial locations, the identity of emitted light can be encoded as a temporal shift, eliminating the need for more complicated light filtering schemes. The system has been used to detect droplet populations containing four unique combinations of dyes and to detect sub-nanomolar concentrations of fluorescein.

Multicolor fluorescence detection in droplet microfluidics typically involves bulky and complex epifluorescence microscope-based detection systems. Here we describe a compact and modular multicolor detection scheme that utilizes an array of optical fibers to temporally encode multicolor data collected by a single photodetector.

물방울 미세 유체에 대한 여러 가지 빛깔의 형광 검출 광학 섬유를 사용하여

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as ...

A Method to Estimate Cadaveric Femur Cortical Strains During Fracture Testing Using Digital Image Correlation

This protocol describes the method using digital image correlation to estimate cortical strain from high speed video images of the cadaveric femoral surface obtained from mechanical testing. This optical method requires a texture of many contrasting fiduciary marks on a solid white background for accurate tracking of surface deformation as loading is applied to the specimen. Immediately prior to testing, the surface of interest in the camera view is painted with a water-based white primer and allowed to dry for several minutes. Then, a black paint is speckled carefully over the white background with special consideration for the even size and shape of the droplets. Illumination is carefully designed and set such that there is optimal contrast of these marks while minimizing reflections through the use of filters. Images were obtained through high speed video capture at up to 12,000 frames/s. The key images prior to and including the fracture event are extracted and deformations are estimated between successive frames in carefully sized interrogation windows over a specified region of interest. These deformations are then used to compute surface strain temporally during the fracture test. The strain data is very useful for identifying fracture initiation within the femur, and for eventual validation of proximal femur fracture strength models derived from Quantitative Computed Tomography-based Finite Element Analysis (QCT/FEA).

In this protocol, the femur surface strains are estimated during fracture testing using the digital image correlation technique. The novelty of the method involves application of a high-contrast stochastic speckle pattern on the femur surface, carefully specified illumination, high speed video capture, and digital image correlation analysis for strain calculations.

방법 골절 디지털 이미지 상관 관계를 사용 하 여 테스트 하는 동안 싱가포르로 대 퇴 골 피 질 긴장을 예상

This protocol describes the method using digital image correlation to estimate cortical strain from high speed video images of the cadaveric femoral ...

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy (DHM)

Accurately detecting and counting sparse bacterial samples has many applications in the food, beverage, and pharmaceutical processing industries, in medical diagnostics, and for life detection by robotic missions to other planets and moons of the solar system. Currently, sparse bacterial samples are counted by culture plating or epifluorescence microscopy. Culture plates require long incubation times (days to weeks), and epifluorescence microscopy requires extensive staining and concentration of the sample. Here, we demonstrate how to use off-axis digital holographic microscopy (DHM) to enumerate bacteria in very dilute cultures (100-104 cells/mL). First, the construction of the custom DHM is discussed, along with detailed instructions on building a low-cost instrument. The principles of holography are discussed, and a statistical model is used to estimate how long videos should be to detect cells, based on the optical performance characteristics of the instrument and the concentration of the bacterial solution (Table 2). Video detection of cells at 105, 104, 103, and 100 cells/mL is demonstrated in real time using un-reconstructed holograms. Reconstruction of amplitude and phase images is demonstrated using an open-source software package.

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy DHM

Digital holographic microscopy (DHM) is a volumetric technique that allows imaging samples 50-100X thicker than brightfield microscopy at comparable resolution, with focusing performed post-processing. Here DHM is used for identifying, counting, and tracking microorganisms at very low densities and compared with optical density measurements, plate count, and direct count.

디지털 홀로그램 현미경 (DHM)를 사용 하 여 낮은 농도에서 미생물 측정

Accurately detecting and counting sparse bacterial samples has many applications in the food, beverage, and pharmaceutical processing industries, in ...

A Droplet-Based Microfluidic Approach and Microsphere-PCR Amplification for Single-Stranded DNA Amplicons

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and morphology of the obtained microsphere. A microsphere copolymerized with an acrydite-DNA probe was successfully fabricated. Different methods such as asymmetric PCR, exonuclease digestion, and isolation on streptavidin-coated magnetic beads can be used to synthesize single-stranded DNA (ssDNA). However, these methods cannot efficiently use large amounts of highly purified ssDNA. Here, we describe a microsphere-PCR protocol detailing how ssDNA can be efficiently amplified and separated from dsDNA simply by pipetting from a PCR reaction tube. The amplification of ssDNA can be applied as potential reagents for the DNA microarray and DNA-SELEX (Systematic evolution of ligands by exponential enrichment) processes.

This work provides a method for the fabrication of droplet-based microfluidic platforms and the application of polyacrylamide microspheres for microsphere-PCR amplification. The microsphere-PCR method makes it possible to obtain single-stranded DNA amplicons without separating double-stranded DNA.

드롭릿 기반 미세 접근 및 단일 가닥 DNA Amplicons 위한 스피어 PCR 증폭

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and ...

Bulk Droplet Vitrification for Primary Hepatocyte Preservation

Vitrification is a promising ice-free alternative for classic slow-freezing (at approximately 1 &#176;C/min) cryopreservation of biological samples. Vitrification requires extremely fast cooling rates to achieve transition of water into the glass phase while avoiding injurious ice formation. Although pre-incubation with cryoprotective agents (CPA) can reduce the critical cooling rate of biological samples, high concentrations are generally needed to enable ice-free cryopreservation by vitrification. As a result, vitrification is hampered by CPA toxicity and restricted to small samples that can be cooled fast. It was recently demonstrated that these inherent limitations can be overcome by bulk droplet vitrification. Using this novel method, cells are first pre-incubated with a low intracellular CPA concentration. Leveraging rapid osmotic dehydration, the intracellular CPA is concentrated directly ahead of vitrification, without the need to fully equilibrate toxic CPA concentrations. The cellular dehydration is performed in a fluidic device and integrated with continuous high throughput generation of large sized droplets that are vitrified in liquid nitrogen. This ice-free cryopreservation method with minimal CPA toxicity is suitable for large cell quantities and results in increased hepatocyte viability and metabolic function as compared to classical slow-freezing cryopreservation. This manuscript describes the methods for successful bulk droplet vitrification in detail.

This manuscript describes an ice-free cryopreservation method for large quantities of rat hepatocytes whereby primary cells are pre-incubated with cryoprotective agents at a low concentration and vitrified in large droplets.

1 차 간세포 보존을 위한 대량 물방울 유리화

Vitrification is a promising ice-free alternative for classic slow-freezing (at approximately 1 &#176;C/min) cryopreservation of biological samples. ...