Apoiado pelo financiamento da Associação Italiana de Investigação do Cancro (AIRC) para MF (MFAG 11676) e MN (Oncologia Clínica Programa Especial Molecular -. 5 por mille n 9980, 2010/15) e do Ministério Italiano da Instrução, da Universidade e FIRB Research 2011 para MN (Project RBAPIIBYNP).

Isolamento MicroRNA a partir de plasma ou soro Nota: Plasma e preparação do soro é um passo importante na circulação de miRNA quantificação. Não há nenhum procedimento preferido para o plasma e preparação do soro. A única coisa importante a considerar é que todas as amostras de um mesmo experimento deve ser processado usando exatamente o mesmo fluxo de trabalho. Iniciar a partir de soro ou de plasma de 200 ul. O ARN total pode ser isolado a partir de soro ou plasma, utilizando kits disponíveis comercialmente. 1. Protocolo para RNA total (incluindo miRNA) Isolamento <ol><li> As amostras de soro / plasma descongelamento em gelo. </li><li> Adicionar 1 ml de Reagente de Lise (por ex., QIAzol) a 200 ul de soro / plasma. </li><li> Misturar em vortex e colocar o tubo contendo o homogeneizado no banco à TA durante 5 min. </li><li> Adicionar 3 ml de uma solução 4,16 nM de miARN CEL-miR-39-3p sintético de C. elegans. </li><li> Adicionar 200 ul de clorofórmio. Agitar o tubo vigorosamente durante 15 sec. º lugare tubo no banco à TA, durante 2 min. </li><li> Centrifugar durante 15 minutos a 12000 xg, a 4 ° C para se obter a separação fases: a fase aquosa superior contém ARN. </li><li> Transferir a fase aquosa para um novo tubo, cerca de 700 ul, evitar a transferência de qualquer material interfase branca. </li><li> Adicionar 1 ml de etanol a 100% e misturar por inversão. </li><li> Pipeta-se 700 mL da amostra para uma coluna mini-rotação colocado em um tubo de recolha de 2 ml. Fechar a tampa e centrifugar a 12000 xg durante 15 seg. Descartar o fluxo de passagem. </li><li> Repita este passo usando a amostra restante. </li><li> Adicionar 700 mL de buffer ERP para o mini coluna de rotação, feche a tampa e centrifugar por 15 segundos a 12.000 xg para lavar a coluna. Descartar o fluxo de passagem. </li><li> Pipetar 500 ul de tampão de RPE para o mini coluna de centrifugação. Feche a tampa e centrifugar por 15 segundos a 12.000 rpm. Descartar o fluxo de passagem. Repita este passo novamente. </li><li> Centrifugar o mini coluna de centrifugação à velocidade máxima por 2 minutos para secar a coluna de spinmembrana a partir de etanol residual. </li><li> Transferir o mini coluna de centrifugação para um novo tubo de recolha de 1,5 ml e pipeta 35 ul de água isenta de RNase na membrana da coluna. </li><li> Centrifugar durante 1 minuto a 12000 xg para eluir o ARN. </li><li> Armazenar o ARN a -80 ° C. Nota: Uma vez que a concentração de RNA não pode ser determinada com precisão, use volumes fixos como uma medida para a quantidade de entrada. </li></ol> 2. MicroRNA Transcrição Reversa <ol><li> Descongelar a transcrição reversa (RT) componentes de mistura de reagente de tampão de reacção: 5x, água isenta de nuclease. Misture suavemente, invertendo os tubos e colocar no gelo. Imediatamente antes da utilização, retire a mistura de enzimas do congelador e colocar no gelo. Spin down todos os reagentes. </li><li> Preparar a mistura de reagente de RT em gelo tal como descrito na Tabela 1. Preparar pelo menos 10% de mistura superior. </li><li> Misture a reacção por pipetagem, e, em seguida girar para baixo. </li><li> Incubar durante 60 min a 42 ° C. </li><li> Calor-inactivar a reverSE transcriptase durante 5 min a 95 ° C. </li><li> Imediatamente fria a 4 ° C. </li><li> Armazenar o cDNA a -20 ° C. </li></ol> 3. cDNA Diluição <ol><li> Diluir a quantidade de modelo de cDNA necessária para as reações ddPCR planejadas em água livre de nuclease. Dilui-se a reacção de ADNc entre 1:50 e 1: 500 em água, dependente da abundância alvo miARN. Armazenar o ADNc diluída a -20 ° C. O cDNA diluído provou ser estável durante pelo menos 3 meses a -20 ° C. </li></ol> 4. gota Geração e PCR Nota: A geração da gota deve ser realizada em 8 amostras de cada vez. Repetições técnicas não são necessárias, devido à elevada reprodutibilidade desta tecnologia 12,15 .A Nenhum modelo de controlo (NTC) amostra deve ser executado em cada placa, e para cada condição ddPCR diferente. <ol><li> Descongelar e equilibrar a mistura principal (por exemplo., EvaGreen Mix Master), microRNA conjunto de primers e cDNA à temperatura ambiente. </li><li> Misturar o th Mistura Principaloroughly invertendo o tubo várias vezes. Spin down todos os reagentes. </li><li> Preparar a mistura de ddPCR como descrito na Tabela 2. Quando várias reacções são realizadas ddPCR, preparar um ddPCR misturar-solução de trabalho. Preparar pelo menos 10% de mistura superior. </li><li> Uma vez montado, misturar cuidadosamente e girar a mistura ddPCR. </li><li> Pipetar 12 ul de ddPCR misturar em uma placa com 96 poços de PCR ou tubos PCR. </li><li> Adicionar 8 mL de modelo de cDNA diluído a cada tubo / poço. </li><li> Insira o cartucho gerador de gotículas no suporte. </li><li> Transferir 20 uL de cada amostra para os poços de amostra (linha do meio) do cartucho gerador de gota cuidadosamente, evitando bolhas de ar na parte inferior do poço. </li><li> Encha cada poço de petróleo (linha de fundo) com 70 l de óleo gerador de gota. </li><li> Gancho a junta sobre o suporte do cartucho e insira no gerador de gota. </li><li> Feche a tampa para iniciar a geração de gotículas de acordo com a pr do fabricanteotocol. Quando a geração de gota tenha terminado, abra a tampa, retire a junta descartável. Os poços superior do cartucho conter as gotículas. </li><li> Pipetar lenta e suavemente 40 ul do conteúdo dos oito poços de topo (as gotas) em uma única coluna de uma placa de 96 poços de PCR. </li><li> Selar a placa PCR com a folha imediatamente após a transferência de gotas para evitar a evaporação. Use selos perfuráveis ​​placa de folha que são compatíveis com as agulhas no leitor de gotícula. </li><li> Comece a ciclos térmicos (PCR) no prazo de 30 min de selagem da placa. </li><li> Execute o protocolo de ciclismo de acordo com a Tabela 3. </li></ol> 5. Gota Reading <ol><li> Ligue o leitor de gota. </li><li> Mover a placa do termociclador para o leitor gota. </li><li> Colocar a placa de PCR de 96 poços contendo as gotículas de pós-PCR para a base de suporte da placa. </li><li> Coloque a parte superior de suporte da placa sobre a placa de PCR. Pressione firmemente ambos os guias de liberaçãopara baixo para fixar a placa de PCR no suporte. </li><li> Inicie o software do PC do sistema. <ol><li> Clique em Configurar para definir o experimento (quantificação absoluta), em seguida, clique em Executar para iniciar a leitura gota. </li><li> Quando leitura gota está completa, clique em &quot;Analisar&quot; botão para abrir e analisar os dados. </li><li> Use o enredo amplitude 2D no software de análise para selecionar as gotículas positivos (Lasso Tool) (Figura 1B). </li><li> Use a guia Eventos para verificar o número de gotículas positivos e totais. Um número total de 18.000 - 21.000 gotículas é geralmente obtida com probeless ddPCR. </li><li> Uma vez que as gotículas positivos são seleccionados, exportar os valores de concentração de miRNA usando a opção de exportação .csv a partir da guia Concentração. </li></ol></li></ol>

<ol>
	<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Argonaute2+complexes+carry+a+population+of+circulating+microRNAs+independent+of+vesicles+in+human+plasma.">Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.</a> Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).</li><li>Skog, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioblastoma+microvesicles+transport+RNA+and+proteins+that+promote+tumour+growth+and+provide+diagnostic+biomarkers.">Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers.</a> Nat Cell Biol. 10, 1470-1476 (2008).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Braicu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomes+as+divine+messengers:+are+they+the+Hermes+of+modern+molecular+oncology.">Exosomes as divine messengers: are they the Hermes of modern molecular oncology.</a> Cell Death Differ. 22, 34-45 (2015).</li><li>Creemers, E. E., Tijsen, A. J., Pinto, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs:+novel+biomarkers+and+extracellular+communicators+in+cardiovascular+disease.">Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease.</a> Circ Res. 110, 483-495 (2012).</li><li>Guay, C., Regazzi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+as+novel+biomarkers+for+diabetes+mellitus.">Circulating microRNAs as novel biomarkers for diabetes mellitus.</a> Nat Rev Endocrinol. 9, 513-521 (2013).</li><li>Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+relevance+of+circulating+cell-free+microRNAs+in+cancer.">Clinical relevance of circulating cell-free microRNAs in cancer.</a> Nat Rev Clin Oncol. 11, 145-156 (2014).</li><li>Moldovan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodological+challenges+in+utilizing+miRNAs+as+circulating+biomarkers.">Methodological challenges in utilizing miRNAs as circulating biomarkers.</a> J Cell Mol Med. 18, 371-390 (2014).</li><li>Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Challenges+in+Using+Circulating+miRNAs+as+Cancer+Biomarkers.">Challenges in Using Circulating miRNAs as Cancer Biomarkers.</a> Biomed Res Int. 2015, 731479 (2015).</li><li>Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+validity+of+circulating+microRNAs+in+oncology:+five+years+of+challenges+and+contradictions.">The validity of circulating microRNAs in oncology: five years of challenges and contradictions.</a> Mol Oncol. 8, 819-829 (2014).</li><li>Witwer, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+MicroRNA+Biomarker+Studies:+Pitfalls+and+Potential+Solutions.">Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions.</a> Clin Chem. 61, 56-63 (2015).</li><li>Miotto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+Circulating+miRNAs+by+Droplet+Digital+PCR:+Comparison+of+EvaGreen-+and+TaqMan-Based+Chemistries.">Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries.</a> Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).</li><li>Ferracin, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+of+cell-free+microRNAs+in+cancer+patients.">Absolute quantification of cell-free microRNAs in cancer patients.</a> Oncotarget. , (2015).</li><li>Mangolini, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+and+prognostic+microRNAs+in+the+serum+of+breast+cancer+patients+measured+by+droplet+digital+PCR.">Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR.</a> Biomarker Research. , (2015).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nat Methods. 10, 1003-1005 (2013).</li><li>Mestdagh, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+quantitative+miRNA+expression+platforms+in+the+microRNA+quality+control+(miRQC)+study.">Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.</a> Nat Methods. 11, 809-815 (2014).</li></ol>

The authors have nothing to disclose.

miARNs circulantes estão presentes no sangue em concentrações extremamente baixas e a quantidade de ARN que pode ser extraída a partir de amostras de plasma e soro é baixa. Por esta razão, eles são difíceis de quantificar com outras técnicas tais como a sequenciação de ARN e micro-arranjo. Além disso, há uma falta generalizada de acordo com a normalização de dados e a presença de miARNs endógenos de &quot;referência&quot; no sangue. Neste contexto, uma tecnologia de PCR sensíveis, como digitais gota, ...

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14. 
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.

<table >
	
		
		
		
		
	
	<tbody>
		<tr >
			<td >miRNeasy Mini Kit</td>
			<td >Qiagen</td>
			<td >217004</td>
			<td >Columns for total RNA, including miRNA, extraction from serum/plasma</td>
		</tr>
		<tr >
			<td >100 nmole RNA oligo Cel-miR-39-3p</td>
			<td >Integrated DNA Technologies</td>
			<td >Custom</td>
			<td >Sequence: UCACCGGGUGUAAAUCAGCUUG</td>
		</tr>
		<tr >
			<td >Universal cDNA synthesis kit II, 8-64 rxns</td>
			<td >Exiqon</td>
			<td >203301</td>
			<td >Kit for microRNA reverse transcription</td>
		</tr>
		<tr >
			<td >MicroRNA LNA PCR primer set&#160;</td>
			<td >Exiqon</td>
			<td >204000-206xxx and 2100000-21xxxxx</td>
			<td >Primers for miRNA amplification inside droplets</td>
		</tr>
		<tr >
			<td >QX200 droplet generator</td>
			<td >BioRad</td>
			<td >186-4002</td>
			<td >Instrument used for droplet reading</td>
		</tr>
		<tr >
			<td >QX200 droplet reader</td>
			<td >BioRad</td>
			<td >186-4003</td>
			<td >Instrument used for droplet generation</td>
		</tr>
		<tr >
			<td >QuantaSoft software</td>
			<td >BioRad</td>
			<td >186-3007</td>
			<td >Software for data collection and analysis</td>
		</tr>
		<tr >
			<td >PX1 PCR plate sealer</td>
			<td >BioRad</td>
			<td >181-4000</td>
			<td >Plate sealer</td>
		</tr>
		<tr >
			<td >DG8 droplet generator cartridges and gaskets</td>
			<td >BioRad</td>
			<td >186-4008</td>
			<td >Cartridges used to mix sample and oil to generate droplets</td>
		</tr>
		<tr >
			<td >QX200 ddPCR EvaGreen supermix</td>
			<td >BioRad</td>
			<td >186-4033/36</td>
			<td >PCR supermix</td>
		</tr>
		<tr >
			<td >QX200 droplet generator oil for EvaGreen dye</td>
			<td >BioRad</td>
			<td >186-4005</td>
			<td >Oil for droplet generation</td>
		</tr>
	</tbody>
</table>

circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr

Circulating (da isentos de células) microARNs (miARNs) são libertados a partir de células para a corrente sanguínea. A quantidade de microARNs específicos na circulação tem sido associada a um estado de doença e tem o potencial de ser utilizado como biomarcador da doença. Um método sensível e preciso para a circulação de microARN quantificação usando uma química à base de corantes e gota a tecnologia de PCR digital foi desenvolvido recentemente. Especificamente, utilizando Locked Nucleic Acid (LNA) à base de iniciadores específicos de miARN com um corante de ligação a ADN fluorescente verde num sistema de PCR compatível gota digital, é possível obter a quantificação absoluta de miARNs específicos. Aqui, nós descrevemos como realizar esta técnica para avaliar a quantidade de miARN em fluidos biológicos, tais como plasma e soro, é viável e eficaz.

A quantidade absoluta de miARNs específicos por mililitro de plasma ou soro pode ser determinada utilizando um corante de ligação a ADN fluorescente verde e gota a tecnologia de PCR digital. A Figura 1 apresenta o processo de selecção do gotículas positivo, o qual determina a concentração final de miARN (cópias / ul ) na reacção de amplificação calculada pelo software de análise. A quantidade de cada um miARN no sangue é muito diferente, sendo algumas esp?...

Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Circulando MicroRNA Quantificação Usando DNA de ligação Dye Química e Gota Digital PCR

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been ...

circulating-microrna-quantification-using-dna-binding-dye-chemistry

Research

JoVE Journal

Bioengineering

8.5K visualizações.  University of Bologna. A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Vídeo: Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the research and pharmaceutical communities. To study miRNAs, it is essential that the quantification of microRNA levels is accurate and robust. By comparing wild-type to small RNA deficient mouse embryonic stem cells (mESC), we revealed a lack of accuracy and robustness in previous published multiplex qRT-PCR techniques. Here, we describe an optimized method, including purifying away excessive primers from previous multiplex steps before singleplex real time detection, which dramatically increases the accuracy and robustness of the technique. Furthermore, we explain how performing the technique on a microfluidic chip at nanoliter volumes significantly reduces reagent costs and permits time effective high throughput miRNA expression profiling.

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

Profiling MicroRNA de Alto Rendimento: Multiplex Optimized qRT-PCR em Escala nanolitros no IFCS Fluidigm dinâmico ArrayTM

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

Bioengenharia

Fluorescence detection methods for microfluidic droplet platforms

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that accompany system miniaturisation. Advantages include the ability to efficiently process nano- to femoto- liter volumes of sample, facile integration of functional components, an intrinsic predisposition towards large-scale multiplexing, enhanced analytical throughput, improved control and reduced instrumental footprints.1
In recent years much interest has focussed on the development of droplet-based (or segmented flow) microfluidic systems and their potential as platforms in high-throughput experimentation.2-4 Here water-in-oil emulsions are made to spontaneously form in microfluidic channels as a result of capillary instabilities between the two immiscible phases. Importantly, microdroplets of precisely defined volumes and compositions can be generated at frequencies of several kHz. Furthermore, by encapsulating reagents of interest within isolated compartments separated by a continuous immiscible phase, both sample cross-talk and dispersion (diffusion- and Taylor-based) can be eliminated, which leads to minimal cross-contamination and the ability to time analytical processes with great accuracy. Additionally, since there is no contact between the contents of the droplets and the channel walls (which are wetted by the continuous phase) absorption and loss of reagents on the channel walls is prevented.
Once droplets of this kind have been generated and processed, it is necessary to extract the required analytical information. In this respect the detection method of choice should be rapid, provide high-sensitivity and low limits of detection, be applicable to a range of molecular species, be non-destructive and be able to be integrated with microfluidic devices in a facile manner. To address this need we have developed a suite of experimental tools and protocols that enable the extraction of large amounts of photophysical information from small-volume environments, and are applicable to the analysis of a wide range of physical, chemical and biological parameters. Herein two examples of these methods are presented and applied to the detection of single cells and the mapping of mixing processes inside picoliter-volume droplets. We report the entire experimental process including microfluidic chip fabrication, the optical setup and the process of droplet generation and detection.

Droplet-based microfluidic platforms are promising candidates for high throughput experimentation since they are able to generate picoliter, self-compartmentalized vessels inexpensively at kHz rates. Through integration with fast, sensitive and high resolution fluorescence spectroscopic methods, the large amounts of information generated within these systems can be efficiently extracted, harnessed and utilized.

Métodos de detecção de fluorescência para as plataformas de gotículas microfluídicos

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Detection and Isolation of Circulating Melanoma Cells using Photoacoustic Flowmetry

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed secondary tumors1,2,3. CTCs are indicators of metastatic disease and their detection in blood samples may be used to diagnose cancer and monitor a patient&prime;s response to therapy. Since CTCs are rare, comprising about one tumor cell among billions of normal blood cells in advanced cancer patients, their detection and enumeration is a difficult task. We exploit the presence of pigment in most melanoma cells to generate photoacoustic, or laser induced ultrasonic waves in a custom flow cytometer for detection of circulating melanoma cells (CMCs)4,5. This process entails separating a whole blood sample using centrifugation and obtaining the white blood cell layer. If present in whole blood, CMCs will separate with the white blood cells due to similar density. These cells are resuspended in phosphate buffered saline (PBS) and introduced into the flowmeter. Rather than a continuous flow of the blood cell suspension, we induced two phase flow in order to capture these cells for further study. In two phase flow, two immiscible liquids in a microfluidic system meet at a junction and form alternating slugs of liquid6,7. PBS suspended white blood cells and air form microliter slugs that are sequentially irradiated with laser light. The addition of a surfactant to the liquid phase allows uniform slug formation and the user can create different sized slugs by altering the flow rates of the two phases. Slugs of air and slugs of PBS with white blood cells contain no light absorbers and hence, do not produce photoacoustic waves. However, slugs of white blood cells that contain even single CMCs absorb laser light and produce high frequency acoustic waves. These slugs that generate photoacoustic waves are sequestered and collected for cytochemical staining for verification of CMCs.

We have developed a flow cytometer using laser induced ultrasound to detect circulating melanoma cells as an early indicator of metastatic disease.

Detecção e isolamento de células de melanoma circulantes usando Fluxometria Fotoacústica

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed ...

Diagnosis of Neoplasia in Barrett&#8217;s Esophagus using Vital-dye Enhanced Fluorescence Imaging

The ability to differentiate benign metaplasia in Barrett&#8217;s Esophagus (BE) from neoplasia in vivo remains difficult as both tissue types can be flat and indistinguishable with white light imaging alone. As a result, a modality that highlights glandular architecture would be useful to discriminate neoplasia from benign epithelium in the distal esophagus. VFI is a novel technique that uses an exogenous topical fluorescent contrast agent to delineate high grade dysplasia and cancer from benign epithelium. Specifically, the fluorescent images provide spatial resolution of 50 to 100 &#956;m&#160;and a field of view up to 2.5 cm,&#160;allowing endoscopists to visualize glandular morphology. Upon excitation, classic Barrett&#8217;s metaplasia appears as continuous, evenly-spaced glands and an overall homogenous morphology; in contrast, neoplastic tissue appears crowded with complete obliteration of the glandular framework. Here we provide an overview of the instrumentation and enumerate the protocol of this new technique. While VFI affords a gastroenterologist with the glandular architecture of suspicious tissue, cellular dysplasia cannot be resolved with this modality. As such, one cannot morphologically distinguish Barrett&#8217;s metaplasia from BE with Low-Grade Dysplasia via this imaging modality. By trading off a decrease in resolution with a greater field of view, this imaging system can be used at the very least as a red-flag imaging device to target and biopsy suspicious lesions; yet, if the accuracy measures are promising, VFI may become the standard imaging technique for the diagnosis of neoplasia (defined as either high grade dysplasia or cancer) in the distal esophagus.

Vital-dye enhanced fluorescence imaging (VFI) is a novel in vivo technique that combines high-resolution epithelial imaging with exogenous topical fluorescent contrast to highlight glandular morphology and delineate neoplasia (high grade dysplasia and cancer) in the distal esophagus.

Diagnóstico de neoplasia de esôfago de Barrett usando-dye Vital Aprimorado imagens de fluorescência

The ability to differentiate benign metaplasia in Barrett&#8217;s Esophagus (BE) from neoplasia in vivo remains difficult as both tissue types can be flat ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have witnessed a tremendous increase in interest in EVs. EVs have been shown to play important roles in various physiological and pathological processes, including coagulation, immune responses, and cancer. In addition, EVs have potential as therapeutic agents, for instance as drug delivery vehicles or as regenerative medicine. Because of their small size (50 to 1,000 nm) accurate quantification and size profiling of EVs is technically challenging.
This protocol describes how tunable resistive pulse sensing (tRPS) technology, using the qNano system, can be used to determine the concentration and size of EVs. The method, which relies on the detection of EVs upon their transfer through a nano sized pore, is relatively fast, suffices the use of small sample volumes and does not require the purification and concentration of EVs. Next to the regular operation protocol an alternative approach is described using samples spiked with polystyrene beads of known size and concentration. This real-time calibration technique can be used to overcome technical hurdles encountered when measuring EVs directly in biological fluids.

Extracellular vesicles play important roles in physiological and pathological processes, including coagulation, immune responses, and cancer or as potential therapeutic agents in drug delivery or regenerative medicine. This protocol presents methods for the quantification and size characterization of isolated and non-isolated extracellular vesicles in various fluids using tunable resistive pulse sensing.

Quantificação e Tamanho-profiling de vesículas extracelulares Usando Sintonizável resistiva Pulso Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

Multicolor Fluorescence Detection for Droplet Microfluidics Using Optical Fibers

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as multiplex assays, enzyme evolution, and molecular biology enhanced cell sorting require the detection of two or more colors of fluorescence. Standard multicolor detection systems that couple free space lasers to epifluorescence microscopes are bulky, expensive, and difficult to maintain. In this paper, we describe a scheme to perform multicolor detection by exciting discrete regions of a microfluidic channel with lasers coupled to optical fibers. Emitted light is collected by an optical fiber coupled to a single photodetector. Because the excitation occurs at different spatial locations, the identity of emitted light can be encoded as a temporal shift, eliminating the need for more complicated light filtering schemes. The system has been used to detect droplet populations containing four unique combinations of dyes and to detect sub-nanomolar concentrations of fluorescein.

Multicolor fluorescence detection in droplet microfluidics typically involves bulky and complex epifluorescence microscope-based detection systems. Here we describe a compact and modular multicolor detection scheme that utilizes an array of optical fibers to temporally encode multicolor data collected by a single photodetector.

Multicolor detecção de fluorescência para Gota microfluídica Utilizando Fibras Ópticas

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as ...

A Method to Estimate Cadaveric Femur Cortical Strains During Fracture Testing Using Digital Image Correlation

This protocol describes the method using digital image correlation to estimate cortical strain from high speed video images of the cadaveric femoral surface obtained from mechanical testing. This optical method requires a texture of many contrasting fiduciary marks on a solid white background for accurate tracking of surface deformation as loading is applied to the specimen. Immediately prior to testing, the surface of interest in the camera view is painted with a water-based white primer and allowed to dry for several minutes. Then, a black paint is speckled carefully over the white background with special consideration for the even size and shape of the droplets. Illumination is carefully designed and set such that there is optimal contrast of these marks while minimizing reflections through the use of filters. Images were obtained through high speed video capture at up to 12,000 frames/s. The key images prior to and including the fracture event are extracted and deformations are estimated between successive frames in carefully sized interrogation windows over a specified region of interest. These deformations are then used to compute surface strain temporally during the fracture test. The strain data is very useful for identifying fracture initiation within the femur, and for eventual validation of proximal femur fracture strength models derived from Quantitative Computed Tomography-based Finite Element Analysis (QCT/FEA).

In this protocol, the femur surface strains are estimated during fracture testing using the digital image correlation technique. The novelty of the method involves application of a high-contrast stochastic speckle pattern on the femur surface, carefully specified illumination, high speed video capture, and digital image correlation analysis for strain calculations.

Um método para estimar cepas Cortical de fêmur cadavérico durante fratura testes usando a correlação de imagem Digital

This protocol describes the method using digital image correlation to estimate cortical strain from high speed video images of the cadaveric femoral ...

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy (DHM)

Accurately detecting and counting sparse bacterial samples has many applications in the food, beverage, and pharmaceutical processing industries, in medical diagnostics, and for life detection by robotic missions to other planets and moons of the solar system. Currently, sparse bacterial samples are counted by culture plating or epifluorescence microscopy. Culture plates require long incubation times (days to weeks), and epifluorescence microscopy requires extensive staining and concentration of the sample. Here, we demonstrate how to use off-axis digital holographic microscopy (DHM) to enumerate bacteria in very dilute cultures (100-104 cells/mL). First, the construction of the custom DHM is discussed, along with detailed instructions on building a low-cost instrument. The principles of holography are discussed, and a statistical model is used to estimate how long videos should be to detect cells, based on the optical performance characteristics of the instrument and the concentration of the bacterial solution (Table 2). Video detection of cells at 105, 104, 103, and 100 cells/mL is demonstrated in real time using un-reconstructed holograms. Reconstruction of amplitude and phase images is demonstrated using an open-source software package.

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy DHM

Digital holographic microscopy (DHM) is a volumetric technique that allows imaging samples 50-100X thicker than brightfield microscopy at comparable resolution, with focusing performed post-processing. Here DHM is used for identifying, counting, and tracking microorganisms at very low densities and compared with optical density measurements, plate count, and direct count.

Quantificação de microrganismos em baixas concentrações, utilizando microscopia holográfica Digital (DHM)

Accurately detecting and counting sparse bacterial samples has many applications in the food, beverage, and pharmaceutical processing industries, in ...

A Droplet-Based Microfluidic Approach and Microsphere-PCR Amplification for Single-Stranded DNA Amplicons

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and morphology of the obtained microsphere. A microsphere copolymerized with an acrydite-DNA probe was successfully fabricated. Different methods such as asymmetric PCR, exonuclease digestion, and isolation on streptavidin-coated magnetic beads can be used to synthesize single-stranded DNA (ssDNA). However, these methods cannot efficiently use large amounts of highly purified ssDNA. Here, we describe a microsphere-PCR protocol detailing how ssDNA can be efficiently amplified and separated from dsDNA simply by pipetting from a PCR reaction tube. The amplification of ssDNA can be applied as potential reagents for the DNA microarray and DNA-SELEX (Systematic evolution of ligands by exponential enrichment) processes.

This work provides a method for the fabrication of droplet-based microfluidic platforms and the application of polyacrylamide microspheres for microsphere-PCR amplification. The microsphere-PCR method makes it possible to obtain single-stranded DNA amplicons without separating double-stranded DNA.

Uma abordagem Microfluidic gotículas e amplificação por PCR-microesfera para Single-Stranded DNA Amplicons

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and ...

Bulk Droplet Vitrification for Primary Hepatocyte Preservation

Vitrification is a promising ice-free alternative for classic slow-freezing (at approximately 1 &#176;C/min) cryopreservation of biological samples. Vitrification requires extremely fast cooling rates to achieve transition of water into the glass phase while avoiding injurious ice formation. Although pre-incubation with cryoprotective agents (CPA) can reduce the critical cooling rate of biological samples, high concentrations are generally needed to enable ice-free cryopreservation by vitrification. As a result, vitrification is hampered by CPA toxicity and restricted to small samples that can be cooled fast. It was recently demonstrated that these inherent limitations can be overcome by bulk droplet vitrification. Using this novel method, cells are first pre-incubated with a low intracellular CPA concentration. Leveraging rapid osmotic dehydration, the intracellular CPA is concentrated directly ahead of vitrification, without the need to fully equilibrate toxic CPA concentrations. The cellular dehydration is performed in a fluidic device and integrated with continuous high throughput generation of large sized droplets that are vitrified in liquid nitrogen. This ice-free cryopreservation method with minimal CPA toxicity is suitable for large cell quantities and results in increased hepatocyte viability and metabolic function as compared to classical slow-freezing cryopreservation. This manuscript describes the methods for successful bulk droplet vitrification in detail.

This manuscript describes an ice-free cryopreservation method for large quantities of rat hepatocytes whereby primary cells are pre-incubated with cryoprotective agents at a low concentration and vitrified in large droplets.

Vitrificação de gotículas em massa para preservação primária de hepatócitos

Vitrification is a promising ice-free alternative for classic slow-freezing (at approximately 1 &#176;C/min) cryopreservation of biological samples. ...