Fecal Microbiota Transplantation and Detection of Prevalence of IgA-Coated Bacteria in the Gut

Summary

We established an efficient way to deplete intestinal bacteria in three days, and subsequently transplant fecal microbiota via gavage of fecal fluid prepared from fresh or frozen intestinal contents in mice. We also present an optimized method to detect the frequency of IgA-coated bacteria in the gut.

Abstract

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the biological function of intestinal bacteria as a whole or at the species level. Several different FMT methods have been published. Here, we present an FMT protocol that successfully depletes gut microbiota in a matter of days, followed by transplantation of fecal microbiota from fresh or frozen donor intestinal contents to conventional mice. Real time-PCR is applied to test the efficacy of bacterial depletion. Sequencing of the 16S ribosomal RNA (rRNA) is then applied to test the relative abundance and identity of gut microbiota in recipient mice. We also present a flow cytometry-based detection method of immunoglobulin A (IgA)-coated bacteria in the gut.

Introduction

A diverse gut microbiota plays a major role in maintaining host homeostasis. This microbiome aids in various physiological processes ranging from digestion and absorption of nutrients from food, defense against infection of pathogens, regulation of immune system development, and immune homeostasis¹. Perturbation in gut microbial composition has been linked to many diseases, including cancer², autoimmune diseases³, inflammatory bowel disease⁴, neurological diseases⁵, and metabolic diseases^6,7. Germ-free (GF) mice are powerful tools in fecal microbiota transplantation models to study the biological effects of microbiota⁸. However, the GF housing environment is very stringent, and performing fecal microbiota transplantation (FMT) in these mice is expensive. Moreover, GF mice have different barrier and mucosal properties, which regulate bacterial penetration, compared to conventional mice⁹. These factors limit the wide application of GF mice in studies. An alternative to using GF mice is to deplete the microbiota in conventional mice using an antibiotic cocktail followed by FMT. Previously reported FMT methods are not well described and inconsistent; therefore, it is necessary to establish a feasible, efficient, and reproducible protocol to perform FMT using conventional mice.

Several steps are crucial to a successful FMT. The efficiency of microbiota depletion is the first important step. For bacteria depletion, use of a single broad-spectrum antibiotic (e.g., streptomycin¹⁰) or an antibiotic cocktail (triple or quadruple-antibiotic treatment) has been reported^11,12. The quadruple-antibiotic treatment including ampicillin, metronidazole, neomycin, and vancomycin, has been found to be the most effective regimen and has been used in several studies^13,14,15. In addition to the type of antibiotic used, the route of administration, dosage, and duration of the antibiotic treatment affect the efficacy of bacterial depletion. Some researchers apply antibiotics in the drinking water to eliminate bacteria in the gastrointestinal tract¹⁵. However, it is hard to control the dosage of antibiotics that each mouse receives this way. Therefore, in subsequent studies, researchers have treated mice with antibiotics by oral gavage for 1–2 weeks¹² to achieve satisfactory depletion. However, the long-term use of antibiotics can be problematic, as the antibiotics themselves may affect some diseases in rodent models¹⁶. Therefore, faster and more efficient methods for microbiota depletion are warranted.

Fecal fluid preparation is another key step to ensure successful FMT. In the gastrointestinal tract, pH ranges from 1 in the stomach to 7 in the proximal and distal intestine⁹. The microbiota in the stomach is limited due to high acidity and includes Helicobacter pylori¹⁷. The proximal intestine produces bile acid for the liver-gut circulation, and contains microbiota associated with fat, protein, and glucose digestion. The distal intestinal tract contains abundant anaerobic bacteria and exhibits high microbial diversity¹⁸. Given the spatial heterogeneity of gut microbiota, it is imperative to isolate gut contents from different regions of the intestinal tracts for fecal fluid preparation. Additionally, other factors, including the nature of the donor sample (e.g., fresh or frozen sample), transplantation frequency, and duration are crucial when performing FMT. Frozen stool is most commonly used for colonizing conventional mice with human gut microbiota¹⁹. In contrast, FMT using fresh stool from animal donors is more appropriate and commonly used in animal models^20,21. FMT frequency and duration vary depending on the experimental design and models. In previous studies, FMT was either performed daily or every second day. The transplantation duration ranged from 3 days²² to 5 weeks²³. In addition to the above factors, maintaining an aseptic surgical environment and the use of sterilized surgical instruments is crucial to avoid unexpected environmental bacterial contamination.

The gut microbiota has the potential to regulate the accumulation of cells that express Immunoglobulin A (IgA). IgA, a predominant antibody isotype, is critical in protecting the host from infection through neutralization and exclusion. High-affinity IgA is transcytosed into the intestinal lumen and can bind and coat offending pathogens. In contrast, coating with IgA may provide a colonization advantage for bacteria²⁴. In contrast to pathogen-induced IgA, indigenous commensal-induced IgA has lower affinity and specificity²⁵. The proportion of intestinal bacteria coated with IgA is reported to be significantly increased in some diseases^25,26. IgA-coated bacteria can initiate a positive feedback loop of IgA production²⁷. Therefore, the relative level of IgA-coated bacteria can predict the magnitude of the inflammatory response in the gut. In fact, this combination can be detected via flow cytometry²⁸. Using IgA-based sorting, Floris et al.²⁷, Palm et al.²⁵, and Andrew et al.²⁹ acquired IgA⁺ and IgA^- fecal bacteria from mice and characterized taxa-specific coated-intestinal microbiota via 16S rRNA sequencing.

In this study, we describe an optimized method to efficiently deplete intestinal dominant bacteria and colonize conventional mice with fresh or frozen fecal microbiota isolated from the contents of the ileum and colon. We also demonstrate a method based on flow cytometry to detect IgA-binding bacteria in the gut.

Protocol

Animal experiments were conducted in accordance with the current ethical regulations for animal care and use in China.

NOTE: Animals were housed in a specific pathogen-free (SPF), controlled environment under 12-hour light and dark cycles at 25 °C. Food was irradiated before being fed to mice. Drinking water and cages were autoclaved before use. Eight-week-old male C57BL/6J mice were used in the study following 1 week of acclimatization. They were divided into several groups based on the experiment design. Each group consisted of at least three mice.

1. Gut microbiota depletion

1. Antibiotic cocktail preparation
   1. Prepare an antibiotic solution in sterile phosphate buffered saline (PBS) with 0.5 mg/mL vancomycin hydrochloride, 1 mg/mL metronidazole, 1 mg/mL ampicillin sodium salt, and 1 mg/mL neomycin sulfate.
      NOTE: Store the antibiotics at 2–8 °C and avoid direct light. Prepare the antibiotic cocktail solution fresh and use immediately.
2. Treatment regimen
   1. For 3 days, orally administer 200 μL of prepared antibiotic cocktail with a #10 needle to a mouse. Hold the mouse vertically in one hand while using the other hand to adjust the angle of the needle to avoid reaching the stomach.
      NOTE: The mouse must be handled gently to avoid struggling, because surface damage of the esophagus and stomach may result in inflammation or death.
   2. Add antibiotics to the drinking water at the same concentrations as indicated in step 1.1.1.
   3. Three days later, sacrifice the mouse by CO₂ asphyxiation.
   4. Dissect the abdomen aseptically using sterile instruments. At a distance of 2 cm away from the caecum, cut off a 2 cm tract of the ileum. Using sterile tweezers to clamp off one end of the tract, squeeze the fresh contents out of the tract into pre-weighed tubes.
   5. To collect the contents of the cecum, cut it in half with surgical scissors. Squeeze the contents of each half of the cecum into pre-weighed tubes.
3. Evaluate gut microbiota depletion efficacy.
   1. Weigh gut contents isolated from the ileum or cecum from naive mice and antibiotic cocktail treated mice, and extract stool microbiota DNA using a kit according to the manufacturer’s instructions. Determine the DNA concentration according to the formula:
      
      concentration_sample (μg/mL) = OD₂₆₀ x 50
       
   2. Construct a standard curve.
      1. Amplify E. Coli genes with a polymerase chain reaction (PCR) using V3-V4 specific primers. Predenature at 95 °C for 1 min, amplify for 40 cycles of 95 °C for 10 s, 60 °C for 30 s, 72 °C for 30 s.
      2. Construct a plasmid by linking the amplified product to a TA vector. Clone the culture with a TA vector kit according to the manufacturer’s instructions.
      3. Measure the plasmid concentration (ng/μL) based on the OD₂₆₀ value as described in step 1.3.1.
         NOTE: The unit for plasmid concentration is different from the unit for DNA concentration.
      4. Calculate the copy numbers using the following formula, where MW stands for molecular weight:
         
         copies in 1 μL = concentration (ng/μL) x 10^-9 x 6.02 x 10²³/(MW_plasmid x 660)
          
      5. Reconstitute the plasmid with double distilled water to a final concentration of 40 µg/μL. Prepare a 10x gradient dilution series with eight stages. Construct a standard curve by plotting the C_T value (Y-axis) against log (Copies_plasmid) (X-axis) after PCR amplification, where C_T stands for threshold cycle for target amplification. Extract the equation from the plot (in this case, it was y = -3.07x + 45.07, R² = 0.994).
   3. Amplify 1 μL of the DNA samples obtained in step 1.3.1 extracted from the ileum or cecum from a naive control group and the antibiotic cocktail treatment group by real-time PCR as described in step 1.3.2.1. Calculate the copy number in 1 μL of the DNA samples based on the standard curve in step 1.3.2.5 and then calculate the total copy number using the following formula:
      Total copy number (per mg) in the weighted samples = copy numbers × total DNA volume/initial weight of the sample
4. Analyze the microbiota DNA by sequencing the 16S rRNA V3 and V4 regions.

2. Fecal microbiota transplantation

1. Fecal fluid preparation for both fresh and frozen stool samples
   NOTE: All instruments are soaked in 75% alcohol prior to usage to avoid preexisting bacterial contamination. It is crucial to avoid contamination when the ileum and colon contents are collected.
   1. Sacrifice 3–5 donor mice by CO₂ asphyxiation.
   2. Collect the contents of the ileum as described in step 1.2.4.
   3. To collect the contents in the colon, make the first incision near the anus and cut the upper 2 cm tract. Extract the contents as explained in step 1.2.4. Collect the samples in 1 min to reduce exposure to air.
   4. For frozen fecal fluid, collect the ileum or colon contents as described in steps 2.1.2 and 2.1.3, and flash freeze the contents in liquid nitrogen.
   5. Store samples in a -80 °C freezer until ready for use.
2. Pool and weigh the contents, add in fresh sterile tubes with beads. For frozen samples, thaw the fecal pellets on ice before weighing.
3. Add sterile PBS into the tube and resuspend the fecal pellets in PBS (1 mL of PBS/0.2 g of fecal pellet) using a 5 mL syringe needle. Homogenize the fecal pellet completely with beads and vortex 3x for 1 min each.
4. Centrifuge at 800 x g for 3 min, then filter the supernatants by passing through a 70 µm cell strainer. Collect the filtered fecal fluid in a sterile tube and use for FMT immediately.

3. Fecal microbiota transplantation procedure

1. Administer 200 µL of prepared fecal fluid to the microbiota-depleted mice via oral gavage every second day for 7 days. Gavage control mice with 200 µL of sterile PBS.
2. Sacrifice the mice by CO₂ asphyxiation and harvest the contents from the ileum and colon according to steps 2.1.2 and 2.1.3. Store samples at -80 °C until further processing.
3. Extract the microbiota DNA of the ileum and colon contents as described in step 1.3.1. Verify the microbiota composition in the gut of transplanted mice by 16S rRNA sequencing.

4. IgA-coated bacteria measurement

1. Sample preparation
   1. Collect 50 mg of fecal pellets from donor mice as described in steps 2.1.2 and 2.1.3, and incubate in 1 mL of sterile PBS at 4 °C for 1 h. Homogenize the pellets using a bead beater for 5 s.
   2. Centrifuge the solution at 300 x g for 10 min at 4 °C. Collect supernatant after filtrating through a 70 µm strainer.
      NOTE: Avoid high speed centrifugation.
   3. Add 5 µL of the supernatant to 1 mL of 1% bovine serum albumin (BSA) in PBS (FACS buffer). Pellet at 8,000 x g for 5 min at 4 °C and discard the supernatant.
   4. Resuspend the pellet in 1 mL of FACS buffer, centrifuge at 8,000 x g for 5 min at 4 °C, and discard the supernatant.
      NOTE: The volume used here may need to be optimized. Too much of the supernatant at this step may mask the positive signal of IgA-coated bacteria.
   5. Resuspend the pellet in 100 µL of PBS containing 10% goat serum and incubate on ice or at 4 °C for 30 min. Add 1 mL of FACS buffer in the tube and centrifuge at 8,000 x g for 5 min at 4 °C to pellet.
2. Flow cytometry
   1. Resuspend the pellet obtained in step 4.1.5 with 200 µL of FACS buffer containing biotin anti-mouse IgA antibody (1:100) and APC-conjugated anti-biotin antibody (1:100) and incubate for 30 min at 4 °C.
   2. Add 1 mL of FACS buffer in the tube and centrifuge at 8,000 x g for 5 min at 4 °C. Discard the supernatant.
   3. Stain the pellet from step 4.2.2 by adding 200 µL of FACS buffer containing green fluorescent nucleic acid stain (1:200) and incubate at 4 °C for 5 min.
   4. Add 1 mL of FACS buffer and centrifuge at 8,000 x g for 5 min at 4 °C to pellet.
   5. Resuspend the pellet in 250 µL of FACS buffer before measurement.
   6. Acquire the data using a flow cytometer and analyze it using FlowJo software.

Results

The FMT schedule used in this study is outlined in Figure 1. After treatment with the antibiotic cocktail, the efficiency of intestinal microbiota depletion was analyzed by sequencing the 16S rRNA region. We detected 196 species in the ileum of naive mice, whereas 3-day antibiotic treatment rapidly reduced the bacterial species to 35 (Figure 2A). There were eight species detected solely in mice that underwent the antibiotic cocktail treatment (

Discussion

Antibiotics used in the depletion procedure have different antibacterial properties. Vancomycin is specific for gram-positive bacteria³⁰. Oral doxycycline can induce significant intestinal microbiota composition changes in female C57BL/6NCrl mice³¹. Neomycin is a broad-spectrum antibiotic that targets most gut-resident bacteria³². It does not prevent intestinal inflammation, however. Broad-spectrum antibiotic cocktails are more effective than a singl...

Materials

Name	Company	Catalog Number	Comments
5 mL syringe needle	Sheng guang biotech	5mL
70 µm cell strainer	BD biosciences	352350
Ampicillin sodium salt	AMERESCO	0339
APC Streptavidin	BD biosciences	554067
Biotin anti-mouse IgA antibody	Biolegend	407003
Bovine serum albiumin (BSA)	Sigma	B2064-50G
C57BL/6J mice	Chengdu Dashuo
CO2	Xiyuan biotech
E.Coil genome DNA	TsingKe
Eppendorf tubes	Axygen	MCT150-C
Fast DNA stool mini Handbook	QIAGEN	51604
Metronidazole	Shyuanye	S17079-5g
Neomycin sulfate	SIGMA	N-1876
Oral gavage needle	Yuke biotech	10#
pClone007 Versatile simple TA vector kit	TsingKe	007VS
Phosphate Buffer Saline (PBS)	Hyclone	SH30256
Precellys lysing kit	Precellys	KT03961-1-001.2
RT PCR SYBR MIX	Vazyme	Q411-01
SYTO BC green Fluorescent Nucleic Acid Stain	Thermo fisher scientific	S34855
V338 F primer	TsingKe		ACTCCTACGGGAGGCAGCAG
V806 R primer	TsingKe		GGACTACHVGGGTWTCTAAT
Vancomycin hydrochloride	Sigma	V2002
Equipments
BD FACSCalibur flow cytometer	BD biosciences
Bead beater vortx	Scilogex
BIORAD CFX Connect	BIORAD
Centrifuge machine	Eppendorf
Illumina MiSeq	Illumina
Nanodrop nucleic acid measurements machine	Thermo fisher scientific
Surgical instruments	Yuke biotech
Software
Adobe Illustrator CC 2015	Version 2015
BIORAD CFX qPCR SOFTWARE
FlowJo software
Graphpad prism 7
Database
Silva (SSU132) 16S rRNA database