Fecal Microbiota Transplantation and Detection of Prevalence of IgA-Coated Bacteria in the Gut

Summary

We established an efficient way to deplete intestinal bacteria in three days, and subsequently transplant fecal microbiota via gavage of fecal fluid prepared from fresh or frozen intestinal contents in mice. We also present an optimized method to detect the frequency of IgA-coated bacteria in the gut.

Abstract

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the biological function of intestinal bacteria as a whole or at the species level. Several different FMT methods have been published. Here, we present an FMT protocol that successfully depletes gut microbiota in a matter of days, followed by transplantation of fecal microbiota from fresh or frozen donor intestinal contents to conventional mice. Real time-PCR is applied to test the efficacy of bacterial depletion. Sequencing of the 16S ribosomal RNA (rRNA) is then applied to test the relative abundance and identity of gut microbiota in recipient mice. We also present a flow cytometry-based detection method of immunoglobulin A (IgA)-coated bacteria in the gut.

Introduction

A diverse gut microbiota plays a major role in maintaining host homeostasis. This microbiome aids in various physiological processes ranging from digestion and absorption of nutrients from food, defense against infection of pathogens, regulation of immune system development, and immune homeostasis¹. Perturbation in gut microbial composition has been linked to many diseases, including cancer², autoimmune diseases³, inflammatory bowel disease⁴, neurological diseases⁵, and metabolic diseases^6,7.....

Protocol

Animal experiments were conducted in accordance with the current ethical regulations for animal care and use in China.

NOTE: Animals were housed in a specific pathogen-free (SPF), controlled environment under 12-hour light and dark cycles at 25 °C. Food was irradiated before being fed to mice. Drinking water and cages were autoclaved before use. Eight-week-old male C57BL/6J mice were used in the study following 1 week of acclimatization. They were divided into several groups based on the .......

Discussion

Antibiotics used in the depletion procedure have different antibacterial properties. Vancomycin is specific for gram-positive bacteria³⁰. Oral doxycycline can induce significant intestinal microbiota composition changes in female C57BL/6NCrl mice³¹. Neomycin is a broad-spectrum antibiotic that targets most gut-resident bacteria³². It does not prevent intestinal inflammation, however. Broad-spectrum antibiotic cocktails are more effective than a singl.......

Materials

Name	Company	Catalog Number	Comments
5 mL syringe needle	Sheng guang biotech	5mL
70 µm cell strainer	BD biosciences	352350
Ampicillin sodium salt	AMERESCO	0339
APC Streptavidin	BD biosciences	554067
Biotin anti-mouse IgA antibody	Biolegend	407003
Bovine serum albiumin (BSA)	Sigma	B2064-50G
C57BL/6J mice	Chengdu Dashuo
CO2	Xiyuan biotech
E.Coil genome DNA	TsingKe
Eppendorf tubes	Axygen	MCT150-C
Fast DNA stool mini Handbook	QIAGEN	51604
Metronidazole	Shyuanye	S17079-5g
Neomycin sulfate	SIGMA	N-1876
Oral gavage needle	Yuke biotech	10#
pClone007 Versatile simple TA vector kit	TsingKe	007VS
Phosphate Buffer Saline (PBS)	Hyclone	SH30256
Precellys lysing kit	Precellys	KT03961-1-001.2
RT PCR SYBR MIX	Vazyme	Q411-01
SYTO BC green Fluorescent Nucleic Acid Stain	Thermo fisher scientific	S34855
V338 F primer	TsingKe		ACTCCTACGGGAGGCAGCAG
V806 R primer	TsingKe		GGACTACHVGGGTWTCTAAT
Vancomycin hydrochloride	Sigma	V2002
Equipments
BD FACSCalibur flow cytometer	BD biosciences
Bead beater vortx	Scilogex
BIORAD CFX Connect	BIORAD
Centrifuge machine	Eppendorf
Illumina MiSeq	Illumina
Nanodrop nucleic acid measurements machine	Thermo fisher scientific
Surgical instruments	Yuke biotech
Software
Adobe Illustrator CC 2015	Version 2015
BIORAD CFX qPCR SOFTWARE
FlowJo software
Graphpad prism 7
Database
Silva (SSU132) 16S rRNA database