מימון הניתן על ידי משרד ההגנה האמריקאי W81XWH-1023/10/1 (ZJG), GM081879 P50 מענק ממרכז קליפורניה בסן פרנסיסקו למערכות וביולוגיה סינתטית (ZJG), NIH 5R21EB015088-02 (YJ) וNIH 1R21EB018044 (ZJG &amp; YJ). DS נתמכה על ידי מענק מחקר פוסט דוקטורט משמעתי האדם Frontier Science Program Cross-.

.1 ייצור של חד-אנרגיה קוונטית נקודות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> העברת שלב של QDs מאורגני לשלב מימיים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לדלל 200 μl של פתרון 1 מיקרומטר של QDs שלב האורגני עם 400 μl של כלורופורם בבקבוקון זכוכית 5 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> מערבבים 400 μl של פתרון 0.3 M ברומיד tetrabutylammonium כלורופורם (TBAB) עם 36 μl של תיאול MPEG המסודר (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) ולנער O / N. </li><li style=";text-align:right;direction:rtl"> הוספת 800 μl של תמיסה מימית M NaOH 0.2 ולנער במשך 30 שניות. העברת שלב מתרחשת תוך דקות ספורות, מסומנות על ידי ההעברה של החלקיקים הצבעוניים לשלב המימית מעל השלב האורגני הצפוף יותר. </li><li style=";text-align:right;direction:rtl"> אם החלקיקים לצבור בשלב שלישי בין השלבים מימיים ואורגניים, להגדיל את זמן דגירה עם תיאול MPEG. אם את השלב המימית נשאר ברור, QDs לא העביר שלב (ראה איור 3 א). לחלופין, להגדיל את concentמנה של תיאול MPEG בשלב 2 כדי להקל על העברת שלב עניה. </li><li style=";text-align:right;direction:rtl"> לשחזר את השלב (בצבע) המימית ולאחר מכן להתרכז QDs נאסף עם טור ספין Centricon (חתוכי 30 משקל מולקולרי KDA) עד 1 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> מוסיף את פתרון QD מרוכז בעמודת Sephadex NAP10 מראש equilibrated עם 10 חיץ מ&quot;מ טריס המכיל 30 mM NaCl (pH 8.0). Elute QDs עם 1.5 מ&quot;ל של חיץ elution ידי זרימת כוח הכבידה. </li><li style=";text-align:right;direction:rtl"> למדוד את הריכוז של QDs עם ספקטרוסקופיה קליטה ב350 ננומטר. </li></ol></li><li style=";text-align:right;direction:rtl"> הכנת mQDs <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> רכישה (או לסנתז) ptDNA. פרוטוקול זה משתמש ברצף 5&#39;-S 50 (CT) 10 (ACTG) 5 -3 &#39;(ראה טבלה 1). </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> DNA </td><td> רצף </td></tr><tr><td> 5&#39;-S 50 (CT) 10 (ACTG) 5 </sub&gt; -3 &quot; </td><td> S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG </td></tr><tr><td> 5&#39;-NH 2 - 10 (CAGT) (CT) 5 -3 &quot; </td><td> NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr><tr><td> BG-DNA </td><td> BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr></tbody></table> .1 רצפי DNA שולחן המשמשים לייצור וmQDs היעד. <ol start="2" style="margin-left: 40px;;text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן 1 מ&quot;ל של 100 פתרון QD ננומטר ב10 חיץ מ&quot;מ טריס המכיל 30 mM NaCl (pH 8). </li><li style=";text-align:right;direction:rtl"> הוסף טיפה חכמה 500 μl של פתרון ננומטר ptDNA 100 לQDs המימית 1 דקות תוך ערבוב נמרץ. מערבבים או הנח על שייקר ל9 שעות נוספות. הערה: זה אמור באופן תיאורטי לייצר 1: 2 יחס של ptDNA: QD. עם זאת, stoichiometry בפועל הוא לעולם לא מושלם - בדרך כלל התוצאה קרובה יותר ל1: 1.5. על מנת לייצר 1: 1 יחס של ptDNA: QD, צפיפות לאחר ג&#39;ל אלקטרופורזה יש צורך לכמת את היחס של נטיה ניתנה הכרכים הידועים בשימוש מעל מדויק. </li><li style=";text-align:right;direction:rtl"> הסר ~ 10 μl של תערובת QD לרוץ על ג&#39;ל agarose אנליטיים. גם להסיר ריכוז דומה של QDs unconjugated בשלב מימיים (מצעד 1.2.1). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף ~ 2 μ; L של חיץ טעינת 6x Ficoll (כדי להגדיל את צפיפות פתרון) ולהפעיל שתי דגימות אלה יחד על ג&#39;ל agarose wt 0.8% / v במאגר borate נתרן ל15 דקות ב 150 V. להקה יחידה בנתיב שליטת unconjugated הנודד קרוב ל גם, ושתי להקות במסלול עם QDs מצומדות נראים (ראה ג&#39;לי באיור 2). </li></ol></li><li style=";text-align:right;direction:rtl"> לחשב את החלק היחסי QD unconjugated באמצעות העצמה היחסית של שתי להקות (ראה המשוואה בתרשים 2B). לאחר מכן, השתמש חלק שכדי לחשב את הנפח נוסף של 100 פתרון ננומטר ptDNA הנדרש כדי להתאים את מספר QDs. </li><li style=";text-align:right;direction:rtl"> חזור על השלבים 1.2.3 ל1.2.5 פעם נוספת עם נפח מחושב זו או עד לקריסת QDs מצומדות ללהקה אחת על הג&#39;ל המצביע על נטיה של כל QDs מלאה. </li><li style=";text-align:right;direction:rtl"> הוספה של 10 מ&quot;מ (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carboxy PEG6 האלקאן תיאול) 100 μl ב10 שיתוף חיץ מ&quot;מ טריסntaining 30 mM NaCl (pH 8) לmQDs מצומדות מיוצר לעיל, ולנער עבור 10 דקות. הערה: ligands PEG אלה passivate משטח QD. PEG כבר לא טוב יותר-passivate QDs, עם זאת, זה יהיה גם להגדיל את הגודל שלהם. יש פונקציונלי תיאול האלקאן הידרופובי זיקה גבוהה יותר ל QDs, במצטבר, מ PEG-תיאול משומש פחות הידרופובי להעברת שלב. לכן, אינו מאפשר בשלב זה כדי להמשיך זמן רב מדי או ptDNA יוחלף על ידי-PEG-תיאול האלקאן. לאחר דגירה דקות ~ 30V, חלק משמעותי של DNA יהיה נעקרו מQDs (איור 3 ב). </li><li style=";text-align:right;direction:rtl"> כדי להסיר PEG-תיאול האלקאן עודף, להוסיף 0.5 מ&quot;ל של פתרון QD לעמודת NAP5 Sephadex מראש equilibrated עם חיץ elution (10 חיץ מ&quot;מ טריס המכיל 30 mM NaCl). לאסוף mQDs עם 1.0 מ&quot;ל של חיץ elution ידי זרימת כוח הכבידה. </li><li style=";text-align:right;direction:rtl"> להתרכז QDs נאסף עם טור ספין Centricon (30 KDA). אחסן mQDs אלה על 4 מעלות צלזיוס במשך חודשים. אל freeze. הערה: אם גלולה בצבע בחלק התחתון של הצינור נראית, את הנקודות שנצברות וצפויות כבר לא שמישים. </li></ol> 2 הפקה של DNA מיקוד (Benzylguanine-) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לייצר או לרכוש DNA-הסתיים אמין. פרוטוקול זה משתמש ברצף 5&#39;-NH 2 - (CT) 10 - (CAGT) 5 -3 &#39;(ראה טבלה 1). מקשר poly-CT מגדיל את נגישות לפונקציונליות הקבור עמוק בglycocalyx אבל ייתכן שלא יהיה צורך לכל היישומים. אם יש גישה לסינתיסייזר DNA, לייצר DNA-הותאם אמינו באמצעות 5 &#39;אמינו-משנה (5&#39; מתאים C6 אמינו-משנה). </li><li style=";text-align:right;direction:rtl"> לפזר BG-N-hydroxysuccinimide (BG-NHS) בsulfoxide דימתיל היבש (DMSO) בריכוז של 10 מ&quot;ג / מ&quot;ל. הערה: BG-NHS יספוג מים מהאוויר ולהוביל להידרוליזה של NHS-אסתר תגובתי, במיוחד בממסי hydroscopic כמו DMSO וdimethylformamide (DMF). BG-NHS הוא החנות הטובה ביותרד ב -80 מעלות צלזיוס כאבקה בבקבוקון משלו בתוך יבוש מיכל המכיל משנית. חם לRT לפני פתיחת הבקבוקון. לחלופין, מייד aliquot ליחד אסתר BG-NHS לתוך ממס קוטבי יבש ולהקפיא ב -80 מעלות צלזיוס, או להגיב באופן מלא עם DNA האמין בשלב 2.2. </li><li style=";text-align:right;direction:rtl"> מגיב על ידי ערבוב BG-NHS בDMSO מצעד 2.1 עם DNA-הסתיים אמין בHEPES (4 (2-Hydroxyethyl) חומצת -1-piperazineethanesulfonic) נאגר (pH 8.5) מים. בטיפוסי להגיב 20 μl של 10 מ&quot;ג / מ&quot;ל BG-NHS בDMSO עם 2 μl של 2 מ&quot;מ NH 2 - (CT) 10 - (CAGT) המים deionized 5 ב58 μl בופר עם 20 μl 0.5 M HEPES pH 8.5. לבצע תגובות בצינור 1.5 מ&quot;ל microcentrifuge. מערבבים במהירות כתגובה ממשיכה במהירות וחייבת להתחרות עם הידרוליזה NHS-אסתר. </li><li style=";text-align:right;direction:rtl"> Sonicate ל5-10 דקות כדי להבטיח ערבוב יסודי. דגירה ~ שעה 1 בRT. יחס stoichiometric של BG: DNA ניתן לשנות לנהוג התגובה להשלמה. </li><li&gt; Desalt התגובה באמצעות טור NAP5 סטנדרטי ל100 אצטט מ&quot;מ triethylamine (TEAA, pH 7). </li><li style=";text-align:right;direction:rtl"> לטהר את BG-DNA מאמין-DNA unreacted ידי התהפך-שלב HPLC פועל TEAA 100 מ&quot;מ: אצטוניטריל שיפוע (ACN) בין 8% ו95 אצטוניטריל% מעל 30 דקות. אמין-DNA unreacted יהיה elute לפני BG-DNA. לאסוף את שבר BG-DNA בצינור חרוטי. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש בעמודת C 18 Zorbax לטיהור oligonucleotide סטנדרטית והשיפוע הבא: 0 → 15 דקות: 8 → 30% ACN; 15 → 21 דקות: 30-90% ACN; 21 → 25 דקות: 90 → 8% ACN; 25 → 30 דקות: 8% ACN; </li></ol></li><li style=";text-align:right;direction:rtl"> הקפאה בחנקן נוזלי וLyophilize החלק שנאסף. Resuspend DNA במים ללא יונים. להיות זהיר במיוחד, Lyophilize עוד פעמים כדי להסיר TEAA השיורי. TEAA שיורי יכול להיות רעיל לתאים בריכוזים גבוהים יותר. </li><li style=";text-align:right;direction:rtl"> Resuspend BG-DNA lyophilized במים, והקפד לשטוף את הצדדים של הצינור דואר, ולדלל את ~ 25 מיקרומטר המניה. Aliquot ולאחסן ב 4 ° C.. דגימות אוחסנו ל~ 9 חודשים ללא השפלה מורגשת. </li></ol> 3 תאי תיוג חיים עם חד-אנרגיה קוונטית נקודות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחלופין, passivate mQDs רק לפני ניסוי הדמיה באמצעות ריאגנטים כגון קזאין (0.5%) או אלבומין בסרום שור (BSA, 1-3%). </li><li style=";text-align:right;direction:rtl"> פלייט תאים המבטאים את החלבון מתויג SNAP על זכוכית -quality הקרינה השתקפות פנימית (TIRF) בסך הכל. בניסוי זה, אנו משתמשים בשורת תאי U2OS להביע קולט Notch1 מתויג SNAP ומשטחי זכוכית באיכות גבוהה. </li><li style=";text-align:right;direction:rtl"> לאחר שהתאים צמודים לזכוכית (~ שעה 24), להסיר את תקשורת צמיחה, לשטוף עם PBS, ודגירת התאים ל10-30 דקות ב RT ב~ 100-150 μl של PBS או תקשורת סלולארי המכילה ~ 1 מיקרומטר BG- DNA מצעד 2.6 לעיל. </li><li style=";text-align:right;direction:rtl"> לאחר הדגרה עם BG, לשטוף בזהירות את התאים עם PBS או תקשורת סלולארי. דגירה התאים ל~ דקות 5-10 עם הmQDs דואר מיוצר בצעד 1.2.9 (ופסיבציה אופציונלית בשלב 3.1). </li><li style=";text-align:right;direction:rtl"> לחלופין, לשטוף את mQDs מאוגד ולהחזיר את התאים לחיץ / מדיה מתאימה גם להדמיה ולתרבות. לתאים שהיו להיות צילמו במצב TIRF, לשטוף את שלב סופי היה לעתים קרובות מיותר כmQDs מאוגד בפתרון מתפזר במהירות כה רב בהשוואה לmQDs כבול כמו להיות בלתי ניתן לגילוי בזמן הניתוח. </li></ol> .4 מיקרוסקופית וניתוח <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תמונת התאים באמצעות מיקרוסקופ TIRF. הערה: ההיקף חייב להיות עירור להפרדה ומסנני פליטה, או קוביית מסנן QD המותאם אישית. QDs נרגש הטובים ביותר עם לייזר נמוך אורך גל (405 או 488 ננומטר). יש לי QDs בקוטר שונה באורכי גל פליטה אופייניים, בדרך כלל קשור בשינוי של סטוק גדולה. </li><li style=";text-align:right;direction:rtl"> בגלל הבהירות של mQDs, לאסוף תמונות במסגרת חליפין גבוהות בTIRF תוך הדמיה צד הבסיס של תא חי. הערה: לחלופין, דינמיקת מולקולה בודדת יכולה להיות folloנישא במטוסי מוקד אחרים באמצעות מיקרוסקופ confocal הדיסק מסתובב. תוכנת מעקב חלקיק יחיד אוטומטי היא בדרך כלל מוצלחת במעקב מדויק אחר mQDs הבהיר וphotostable. </li></ol>

<ol>
	<li>Sako, Y., Minoghchi, S., Yanagida, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+imaging+of+EGFR+signaling+on+the+surface+of+living+cells.">Single-molecule imaging of EGFR signaling on the surface of living cells.</a> Nature Cell Biology. 2 (3), 168-172 (2000).</li><li>Luo, W., He, K., Xia, T., Fang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+monitoring+in+living+cells+by+use+of+fluorescence+microscopy.">Single-molecule monitoring in living cells by use of fluorescence microscopy.</a> Analytical and Bioanalytical Chemistry. 405 (1), 43-49 (2013).</li><li>Chung, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+control+of+EGF+receptor+activation+by+reversible+dimerization+on+living+cells.">Spatial control of EGF receptor activation by reversible dimerization on living cells.</a> Nature. 464 (7289), 783-787 (2010).</li><li>Fern&#225;ndez-Su&#225;rez, M., Ting, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+probes+for+super-resolution+imaging+in+living+cells.">Fluorescent probes for super-resolution imaging in living cells.</a> Nature Reviews Molecular Cell Biology. 9 (12), 929-943 (2008).</li><li>Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photooxidation+and+photobleaching+of+single+CdSe/ZnS+quantum+dots+probed+by+room-temperature+time-resolved+spectroscopy.">Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy.</a> The Journal of Physical Chemistry B. 105 (35), 8281-8284 (2001).</li><li>Pinaud, F., Clarke, S., Sittner, A., Dahan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+cellular+events,+one+quantum+dot+at+a+time.">Probing cellular events, one quantum dot at a time.</a> Nature Methods. 7 (4), 275-285 (2010).</li><li>Michalet, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantum+dots+for+live+cells,+in+vivo+imaging,+and+diagnostics.">Quantum dots for live cells, in vivo imaging, and diagnostics.</a> Science. 307 (5709), 538-544 (2005).</li><li>Howarth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monovalent,+reduced-size+quantum+dots+for+imaging+receptors+on+living+cells.">Monovalent, reduced-size quantum dots for imaging receptors on living cells.</a> Nature Methods. 5 (5), 397-399 (2008).</li><li>Iyer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aromatic+aldehyde+and+hydrazine+activated+peptide+coated+quantum+dots+for+easy+bioconjugation+and+live+cell+imaging.">Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging.</a> Bioconjugate Chemistry. 22 (6), 1006-1011 (2011).</li><li>Tikhomirov, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+programming+of+quantum+dot+valency,+self-assembly+and+luminescence.">DNA-based programming of quantum dot valency, self-assembly and luminescence.</a> Nature Nanotechnology. 6 (8), 485-490 (2011).</li><li>Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+targeted+monovalent+quantum+dots+by+steric+exclusion.">Formation of targeted monovalent quantum dots by steric exclusion.</a> Nature Methods. 10 (12), 1203-1205 (2013).</li><li>Gartner, Z. J., Bertozzi, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmed+assembly+of+3-dimensional+microtissues+with+defined+cellular+connectivity.">Programmed assembly of 3-dimensional microtissues with defined cellular connectivity.</a> Proceeding of the National Academy of Sciences USA. 106 (12), 4606-4610 (2009).</li><li>Selden, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+programmed+cell+adhesion+with+membrane-anchored+oligonucleotides.">Chemically programmed cell adhesion with membrane-anchored oligonucleotides.</a> Journal of the American Chemical Society. 134 (2), 765-768 (2012).</li></ol>

The authors have nothing to disclose.

המודולריות של עיצוב mQD מאפשרת מידה מוגברת של גמישות ניסיונית. לדוגמא, מגוון של mQDs ניתן להכין במהירות בצבעים ייחודיים המאפשרים להדמיה בו זמנית של מספר רב של מטרות. רצף מיקוד ssDNA יכול לכוון mQDs לחלבונים, סוכרים 12, שומנים ומשטחים 13. מספר התגים האנזימטית זמין עם reactivities מאונך, המאפשר מטרות מרובות להיות צילמו בו זמנית עם mQDs הממוקד באופן דיפרנציאלי. בנוסף למיקוד עם תג SNAP, תיוג של חלבוני יעד עם mQDs שימוש בתג CLIP, תג HALO, וחלבוני biotinylated היה גם מוצלח. פרוטוקול זה מדגים את התיוג הספציפי של קולט משטח על תאי חיים עם mQDs אלה, אבל הפרוטוקול יכול בקלות להיות מותאם למספר הקשרים השונים. תובנה מתודולוגיים המשמעותית בייצור mQDs עם ולנסי מוגדרים היא ש~ 50 phosphorothioate צמודבסיסים נדרשים לעטוף QDs (ובכך למנוע את שתי מולקולות מלהיקשר בו זמנית). -פולי רצף S 50 reproducibly ויציבות כרוך 605 QDs ננומטר מחי טכנולוגיות. למרות שמוצר זה הופסק, אסטרטגית ההדרה סטרית היא להכליל למוצרים דומים מיצרנים אחרים שיש בגדלים שונים, צורות, תכונות ספקטרליות. היעילות והיציבות של QDs העטוף ptDNA תלויה באופן קריטי על הכימיה של פני השטח והמבנה של QDs. לכן, ההצלחה של פרוטוקול תהיה תלויה במבנה המקור וכימי המסחרי של QDs. למטרות פרוטוקול זה, שלוש נקודות עיקריות של הבדל קיים בין מקורות שונים מסחריים של QDs: הבדל בתנאים דרושים להעברת שלב; הבדל בכח של עקירה ראשונית מחייבת PEG-תיאול ליגנד, אולי פוגע בptDNA; והבדל בסך של ליבת CdSe חשופה, אשר יכול leמודעה למרווה של QD על ידי תנאי העברת שלב תיאול MPEG. החל בפרסום, QDs עם המבנה הטוב ביותר לייצור של mQDs הוא 4-10 QDs CdSe ננומטר / ליבת ZnS / פגז שנרכש מחי טכנולוגיות עם ספקטרום פליטה ב545, 585, 605 &amp; 625 ננומטר (איור 2 א). QDs מבוסס על הניסוח &quot;Vivid&quot; (545, 605, וכו &#39;) להרוות על תוספת של תיאול MPEG ואינם מתאימים ליישום זה. QDs מאולדריץ והאוקיינוס ​​ננוטק לעבוד היטב, אך דורש צעדי העברת שלב ארוך יותר וטיפול מקדים בתחמוצת trioctylphosphine. פרוטוקול זה כבר מותאם לQDs מחי טכנולוגיות. רצף poly-phosphorothioate נהג לעטוף את QDs מסתיים עם זנב דנ&quot;א יליד 20-mer המכיל את הרצף של (ACTG) 5 עד שגדיל מיקוד עשוי להכליא. רצף זה הוא נוח, שכן יש לא מעט על מנת מבנה משני, ויישאר hybridizעורך על 37 מעלות צלזיוס בPBS. אם יש גישה לסינתיסייזר DNA, ptDNA יכול על ידי מסונתז ולאחר מכן מטוהר על ידי כרומטוגרפיה הנוזלית ביצועים גבוהים שלב הפוך (HPLC) באמצעות טור C 8. PtDNA יהיה elute בהמשך HPLC מאשר oligonucleotides המקביל עם עמוד השדרה ילידים. אנחנו בדרך כלל לעזוב את 5 &#39;DMT הגנת קבוצה על oligonucleotides phosphorothioate שלנו לאחר טיהור. פסיבציה של QDs העטוף ptDNA נדרשת בדרך כלל כדי לשפר את יציבות colloidal של QDs ולהפחית את הרקע מחייב עבור יישומים הניסיוניים ביותר. הפרוטוקול עושה שימוש PEG-שכבה לpassivate QDs. Carboxy PEG תיאול האלקאן עם יחידות PEG נוסף ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H SH 23, תיאול האלקאן carboxy-PEG12) מספק מופחת באופן משמעותי רקע, אם כי את היתדות כבר שניהם גדולות יותר, ובדרך כלל יקר יותר. mQDs מצופה carboxy PEG אלקההליגנדים תיאול ne הם מאוד יציבים במאגרים פיסיולוגיים כגון Salines פוספט שנאגרו ותקשורת ותרבות. אחסון לטווח ארוך (&gt; 8 חודשים) של mQDs על 4 מעלות צלזיוס לא הראה צבירה משמעותית או ניתוק ptDNA 11. בהתאם לניסוי, פסיבציה PEG של QDs לבד לא תמיד מספיק להפחית הלא ספציפית מחייבת של mQDs. דוגרים שני תאים וmQDs בופר פוספט (PBS) המכיל BSA 3% עבור 20 דקות לפני השימוש מפחית באופן משמעותי שאינו ספציפי מחייב את תאים, למרות שזה מגדיל את הרדיוס הידרודינמית לכאורה של mQDs על ידי ~ 50%. פסיבציה עם קזאין 0.5% מפחיתה את הלא ספציפי מחייב עוד יותר אבל זה מגדיל את הגודל הנראית לעין ליותר מBSA במידה רבה יותר. סוף &#39;5 של גדיל DNA משלים לmQDs יכול להיות שונה כדי לאפשר מיקוד של מספר המולקולות הביולוגיים שונות. ישנן מספר טכניקות שהוקמו לרשות לשנות קוולנטית חלבונים, lipids וסוכרים עם דנ&quot;א יחיד שנתקע (ssDNA). כל עוד ssDNA מוצג extracellularly, הוא נגיש לmQDs המסיס. mQDs עם הרצפים מעל מהירות יהיה להכליא עם גדיל DNA משלים בתנאי תרבית תאים. Spacer 10-20x ליזין (CT) בין ptDNA ורצף המיקוד עשוי להידרש ליעיל מיקוד כדי להגביה את הרצף מחייב מעל glycocalyx העבה והטעון שלילי של התא. לפרוטוקול זה בחרנו לייצר BG-DNA עם רצף משלים של (CAGT) 5 ששניהם הכלאה לmQDs וקוולנטית לקשר את עצמו לחלבון SNAP-תג לתיוג מהיר וספציפי. פונקציות פרוטוקול דומות גם לצימוד NHS-אסטרים אחרים לoligonucleotides-הותאם אמינו. להדמית מולקולה בודדת, צפיפות נמוכה של תיוג נדרשת בדרך כלל כדי לפתור מולקולות בודדות. ריכוז סופי mQD של ~ 0.5 ננומטר בPBS עם סוכן passivatingהוא יעד טוב. עם זאת, דילולים גבוהים אלה לעתים הסתיימו בתחת תיוג של התאים. במקרה זה, ניתן להוסיף mQD נוסף עד צפיפות אופטימלית של תיוג הוא ציין. במקרה של Notch1 אדם מתויג SNAP, ריכוזים של&gt; 10 ננומטר mQD מיוצרים תאי תיוג צפופים תוך 0.5 ננומטר mQD הביא את הקובץ המצורף של ~ 20 mQDs על פני השטח הבסיסיים של תא מטרה (ראה איור 4). תא תיוג עם mQDs היה תלוי במידה רבה של confluency של תאים מצופים. מדי תאים ומחוברות לא לתייג במשטחים הבסיסיים שלהם. לסיכום, שיטה פשוטה ליצירה חד ערכי וQDs מודולרית תואר. mQDs אלה למצוא שירות במגוון רחב של יישומי הדמיה תא חיים, כפי שהודגם על ידי ההדמיה קולט Notch על תאי U2OS חיים. תחולתו של mQDs אינה מוגבלת למקרה הספציפי הזה, אבל יכולה באופן פוטנציאלי להיות מורחב למטרות סלולריות אחרות כגון חלבונים אחרים, חומצות גרעין, ואנזימים.

הדינמיקה של מולקולות בודדות על תאי חיים תורמת לתפקוד הביולוגי שלהם. דימות פלואורסצנטי המולקולה בודדת היא שיטה פופולרית ללמוד דינמיקת מולקולה בודדת על 1,2,3 פני התא. עם זאת, יש לי בדיקות ההדמיה הנפוצות ביותר במחקרים אלה יש כמה חסרונות חשובים. לדוגמא, צבעים אורגניים קונבנציונליים וחלבוני ניאון לספק בהירות מתונה, על 10 5 -10 6 M -1 cm -1, אבל הם לא יציבים photochemically, הלבנה לאחר הפליטה של כ 10 5 -10 6 פוטונים בתנאי הדמיה לחיות תאים טיפוסיים 4,5. בניגוד לכך, חלקיקים מוליכים למחצה, נקודות קוונטיות בתדירות גבוהה נקראות (QDs), הם בהירים באופן משמעותי ויציבים יותר, עם מקדמי הכחדה בטווח של 10 -1 6 -10 7 M -1 סנטימטר ועולה על 10 7 -10 8 פוטונים הנפלטים לפני photobleaching 5. הבהירות וphotostability המשופרת של QDs מעל fluorophores האורגני מאפשרים התצפית של מולקולות בודדות במסגרת שיעורים מהירים יותר באופן משמעותי ועל הרבה יותר מסלולי 6. למרות יתרונותיהם וזמינות מסחרית, כמה התחייבויות יישארו לסוכני הדמיה רבי עוצמה אלה. ראשית, יש להם בצורה גרועה מוגדר ולנסי מיקוד, אשר עלול לגרום לcrosslinking של מולקולות ביולוגיות ממוקדים 6. שני, בדרך כלל יש להם גודל גדול הידרודינמית (&gt; 20 ננומטר) שמגביל את הנגישות לסביבות סלולריות צפופות מסוימות 7. שלישית, הם מוגבלים מיקוד מודולריות 7. כמה אסטרטגיות ניסו לטפל 8,9,10 בעיות אלה, אך בדרך כלל דורשות ידע וחומרים כימיים מיוחדים כדי ליישם. כדי להתמודד עם בעיות אלה, אנו דיווחו לאחרונה על אסטרטגיה &quot;הדרה סטרית&quot; להכנה חד ערכי, קטן, ומודולרי QDs 11. QDs הם עטופים בפולימר יחיד DNA phosphorothioate הארוך (ptDNA). PtDNA נקשר למשטח QD דרך אינטראקציות Zn-S מרובים בין אטומי Zn משטח חשוף וקבוצות phosphorothioate של פולימר ptDNA. פולימר קשור אחד sterically ואלקטרוסטטי אינו כולל המחייב שווים נוסף של הפולימר מבלי להגדיל את הגודל הכולל של החלקיקים (כ 2 ננומטר) באופן משמעותי. כל ריאגנטים זמינים מסחרי, מוצרים נוצרים בתשואה גבוהה, והתהליך דורש רק צעדי desalting לטיהור. שכותרתו ברגע, QDs עטוף בלאגד ptDNA (mQDs) יחיד לגדילי דנ&quot;א משלימים נושאות תחומים מיקוד (למשל, benzylguanine (BG), benzylcytosine, או alkylhalides). הפונקציות הללו מיועדים לmQDs במיוחד כדי תגים האנזימטית כגון SNAP, CLIP &amp; HALO הגנטי התמזגו החלבון של עניין. זהו פרוטוקול לסינתזה, מיקוד, והדמיה לחיות תאים של mQDs מיוצר על ידי הדרה סטרית.

<table border="0" cellpadding="0" cellspacing="0" width="497">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:91px;">Comments/Description</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">mQD Production:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Phosphorothioate DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(A*)x50-(ACTG)x5</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Quantum Dots:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="127">
			<td height="127" style="height:127px;width:216px;">QDots 525, 585, 605 &#38; 625</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">Q21791MP (545), Q21711MP (585), Q21701MP (605)</td>
			<td style="width:91px;">Custom QD synthesis for QD625.</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">QD610</td>
			<td style="width:71px;">Ocean Nanotech</td>
			<td style="width:119px;">QSP-610-10&#160;</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">QD 610 lamda</td>
			<td style="width:71px;">Aldrich</td>
			<td style="width:119px;">731854</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Chloroform, 99.8%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">67-66-3</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Tetrabutylammonium bromide, 98.0%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">426288</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95%</td>
			<td style="width:71px;">Polypure</td>
			<td style="width:119px;">11156-0695</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:216px;">HSC11EG6CO2H&#160; [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H]</td>
			<td style="width:71px;">ProChimia</td>
			<td style="width:119px;">TH 003-m11.n6-0.1</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Boric Acid, 99.5%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">B0394</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Sodium Hydroxide, 99.0%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">S/4845</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Sodium Chloride, 98%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">310166</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Agarose LE</td>
			<td style="width:71px;">U.S. Biotech Sources</td>
			<td style="width:119px;">G02PD-125</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Ethanol</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">459828</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">BG-DNA Production:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Amine DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5(T)40-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">NHS-GLA-Benzylguanine</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">S9151</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">DMSO</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D8428</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">HEPES Buffer</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">83264</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">NAP5 Column</td>
			<td style="width:71px;">GE Healthcare</td>
			<td style="width:119px;">17-0853-01</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">C18 Column</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Acetonitrile</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">Mammalian Cell Culture &#38; Imaging:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Cell line expressing SNAP-tagged protein</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">E9100S</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">McCoys 5A</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">PBS</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Nunc Lab-tek II Chambered Coverglass</td>
			<td style="width:71px;">Thermo-Fischer Scientific</td>
			<td style="width:119px;">155409</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Matriplate 96-well plate</td>
			<td style="width:71px;">Brooks Life Science Systems</td>
			<td style="width:119px;">MGB096-1-2-LG-L</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">BSA</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">5% Alkali-soluble Casein</td>
			<td style="width:71px;">EMD Millipore</td>
			<td style="width:119px;">70955</td>
			<td style="width:91px;">Not all caseins are the same</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">(Optional) DNA Synthesis Reagents:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">5&#8217; Amine modifier C6</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">Oct-06</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">dA-Thiophosphoramidite</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">10-700</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Analysis Software:</td>
			<td></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">FIJI</td>
			<td colspan="3">http://valelab.ucsf.edu/~schindelin/</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">RyTrack.pro</td>
			<td colspan="3">http://sun.iwu.edu/~gspaldin/rytrack.html</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Tracker</td>
			<td colspan="3">http://www.gartnerlab.ucsf.edu/more/software</td>
		</tr>
	</tbody>
</table>

production and targeting of monovalent quantum dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in biology, where clustering and the spatial organization of biomolecules is often the object of study. We describe here a protocol to produce monovalent quantum dots (mQDs) that can be accomplished in most biological research laboratories via a simple mixing of CdSe/ZnS core/shell QDs with phosphorothioate DNA (ptDNA) of defined length. After a single ptDNA strand has wrapped the QD, additional strands are excluded from the surface. Production of mQDs in this manner can be accomplished at small and large scale, with commercial reagents, and in minimal steps. These mQDs can be specifically directed to biological targets by hybridization to a complementary single stranded targeting DNA. We demonstrate the use of these mQDs as imaging probes by labeling SNAP-tagged Notch receptors on live mammalian cells, targeted by mQDs bearing a benzylguanine moiety.

העברת השלב של QDs מאורגני לשלב מימיים היא קריטית לייצור mQDs, אבל יכולה להיות גם condition- וQD-ספציפי. העברת שלב בסעיף 1.1 אמורה להופיע נקייה כמו שני הבקבוקונים הראשונים באיור 3. אם העברה מופיעה יותר כמו 3 בקבוקון, אז צריך לנסות שוב עם תנאים שונים. ברגע שQDs מצופה בDNA באופן שלילי הטעון הם צריכים להעביר על ג&#39;ל בנפרד מQDs העטוף שאינו. באמצעות aliquot של QDs עטיפה כביקורת, שנייה, להקה מהר יותר-נודדת אמורה להופיע על תוספת של ptDNA, כפי שניתן לראות בג&#39;ל הראשון באיור 2. היווצרות מלאה של mQDs באה לידי ביטוי באובדן של הלהקה הנייחת, וקריסתה לתוך הפס הנייד כפי שניתן לראות בג&#39;ל האחרון באיור 2. אם aliquot של מוצר mQD שלך נודד כלהקה יחידה להפרדה מQDs העטיפה, אז mQDs שלך הם חד ערכי וr<html> eady לשמש בצעדים נוספים. תיוג תא צריך להיות ספציפי ליעד של הבחירה שלך וצריך להיות תלוי ברמות ביטוי חלבון וריכוז mQD. אופטימיזציה אמפירית של שני ריכוז mQD ופסיבציה mQD נדרשה לעתים קרובות עבור כל יישום נתון. איור 4 מדגים את התיוג של תאי U2OS להביע קולט Notch מתויג SNAP עם mQDs נע בריכוז מ0.5 ננומטר ל10 ננומטר. <img fo:content-width="6in" width="600" alt="איור 1" src="/files/ftp_upload/52198/52198fig1highres.jpg" /> איור 1 מודולרי מיקוד של mQDs. MQDs להכליא ssDNA פונקציונליות על ידי מולקולות מיקוד שונות. Benzylguanine צמוד mQDs מטרות DNA לSNAP מתויגים חלבוני היתוך. שינויים &#39;5 אחרים ורצפי DNA יאפשרו המיקוד של mQDs למגוון של מולקולות ביולוגיות אחרות.&quot;Target =&quot; /files/ftp_upload/52198/52198fig1highres.jpg _blank &quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img fo:content-width="6in" width="600" alt="איור 2" src="/files/ftp_upload/52198/52198fig2highres.jpg" /> איור 2 תכנית לייצור mQDs. () QDs אורגני-השלב מועבר לשלב המימית על ידי טיפול עם תיאול MPEG וTBAB, עטוף בptDNA, ופסיבציה עם תיאול האלקאן PEG6 carboxy. נציג תמונות TEM הן QD545 האורגני, QD585, וQD605, בהתאמה. (ב) שיטה לקביעה אמפירית ההרכב של אינטראקציה בין QDs וptDNA בשלב שני לעיל. stoichiometries QD וptDNA מאומת באופן אמפירי על ידי צפיפות כזו שstoichiometry התגובה הסופי הוא 1: 1 (QD: ptDNA). המספר הראשוני של שומות של ptDNA מוכפל בשיעור של QD: mQD, והותאם על ידי af הנפח בפועל<html> נטיית ter להניב מספר השומות הנדרשות כדי להשיג 1:. 1 נטיה <a href="https://www.jove.com/files/ftp_upload/52198/52198fig2highres.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img fo:content-width="6in" width="600" alt="איור 3" src="/files/ftp_upload/52198/52198fig3highres.jpg" /> 3 פרטי איור ניסיוני לייצור mQDs. () תמונות נציג מוצלח וכושלות העברת שלב. QDs צריך מבחינה ויזואלית להעביר בין השלב האורגני הצפוף והשלב מימיים פחות הצפוף. ההפרדה פאזות שלמה מציינת העברת עניים. יכול להיות מוחלף (B) ptDNA על ידי-PEG-תיאול האלקאן. נתונים ג&#39;ל נכונים הוא נציג של תגובה שבו חלק משמעותי של ptDNA נעקרו מQDs בשל-פסיבציה מעל.&quot;Target =&quot; es.jpg _blank &quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img fo:content-width="6in" width="600" alt="איור 4" src="/files/ftp_upload/52198/52198fig4highres.jpg" /> איור 4 התיוג SNAP-מתויג חלבונים בתאים חיים. (א) סכמטי המדגים את הביטוי, קובץ מצורף וסימון של קולט SNAP-מתויג עם mQD ממוקד BG. תיוג נציג של תאים לבטא SNAP-Notch-mCherry לבנות בריכוזים mQD שונים (B). mQDs פסיבציה עם PEG12 colocalize עם mCherry המציין תיוג ספציפי. צפיפויות תיוג נמוכות (&lt;0.5 ננומטר) הן בדרך כלל עדיפות למעקב אחר חלקיקים בודדים. סרגל קנה מידה הוא 10 מיקרומטר. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig4highres.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Production and Targeting of Monovalent Quantum Dots at JoVE.com

Production and Targeting of Monovalent Quantum Dots

We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications.

ייצור ומיקוד של חד-אנרגיה קוונטית נקודות

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in ...

production-and-targeting-of-monovalent-quantum-dots

Research

JoVE Journal

Bioengineering

25.3K Views.  University of California, San Francisco. We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications. 

Video: Production and Targeting of Monovalent Quantum Dots

Solubilization and Bio-conjugation of Quantum Dots and Bacterial Toxicity Assays by Growth Curve and Plate Count

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. QDs have attracted a lot of interest for imaging, diagnostics, and therapy due to their bright, stable fluorescence1,2 3,4,5. QDs can be conjugated to a variety of bio-active molecules for binding to bacteria and mammalian cells6.
QDs are also being widely investigated as cytotoxic agents for targeted killing of bacteria. The emergence of multiply-resistant bacterial strains is rapidly becoming a public health crisis, particularly in the case of Gram negative pathogens 7. Because of the well-known antimicrobial effect of certain nanomaterials, especially Ag, there are hundreds of studies examining the toxicity of nanoparticles to bacteria 8. Bacterial studies have been performed with other types of semiconductor nanoparticles as well, especially TiO2 9,10-11, but also ZnO12 and others including CuO 13. Some comparisons of bacterial strains have been performed in these studies, usually comparing a Gram negative strain with a Gram positive. With all of these particles, mechanisms of toxicity are attributed to oxidation: either the photogeneration of reactive oxygen species (ROS) by the particles or the direct release of metal ions that can cause oxidative toxicity. Even with these materials, results of different studies vary greatly. In some studies the Gram positive test strain is reportedly more sensitive than the Gram negative 10; in others it is the opposite 14. These studies have been well reviewed 15.
In all nanoparticle studies, particle composition, size, surface chemistry, sample aging/breakdown, and wavelength, power, and duration of light exposure can all dramatically affect the results. In addition, synthesis byproducts and solvents must be considered16 17. High-throughput screening techniques are needed to be able to develop effective new nanomedicine agents.
CdTe QDs have anti-microbial effects alone18 or in combination with antibiotics. In a previous study, we showed that coupling of antibiotics to CdTe can increase toxicity to bacteria but decrease toxicity to mammalian cells, due to decreased production of reactive oxygen species from the conjugates19. Although it is unlikely that cadmium-containing compounds will be approved for use in humans, such preparations could be used for disinfection of surfaces or sterilization of water.
In this protocol, we give a straightforward approach to solubilizing CdTe QDs with mercaptopropionic acid (MPA). The QDs are ready to use within an hour. We then demonstrate coupling to an antimicrobial agent.
The second part of the protocol demonstrates a 96-well bacterial inhibition assay using the conjugated and unconjugated QDs. The optical density is read over many hours, permitting the effects of QD addition and light exposure to be evaluated immediately as well as after a recovery period. We also illustrate a colony count for quantifying bacterial survival.

Nanoparticles such as semiconductor quantum dots (QDs) can be used to create photoactivatable agents for anti-microbial or anti-cancer applications. This technique shows how to water-solubilize cadmium telluride (CdTe) QDs, conjugate them to an antibiotic, and perform a bacterial inhibition assay based upon growth curves and plate count.

Solubilization ביו נטיה של נקודות קוונטיות ועל מבחני רעילות של חיידקים עקומת צמיחה הרוזן פלייט

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. ...

Cell Labeling and Targeting with Superparamagnetic Iron Oxide Nanoparticles

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the target site while minimizing deleterious effects to off-target sites. Magnetic cell targeting is an efficient, safe, and straightforward delivery technique. Superparamagnetic iron oxide nanoparticles (SPION) are biodegradable, biocompatible, and can be endocytosed into cells to render them responsive to magnetic fields. The synthesis process involves creating magnetite (Fe3O4) nanoparticles followed by high-speed emulsification to form a poly(lactic-co-glycolic acid) (PLGA) coating. The PLGA-magnetite SPIONs are approximately 120 nm in diameter including the approximately 10 nm diameter magnetite core. When placed in culture medium, SPIONs are naturally endocytosed by cells and stored as small clusters within cytoplasmic endosomes. These particles impart sufficient magnetic mass to the cells to allow for targeting within magnetic fields. Numerous cell sorting and targeting applications are enabled by rendering various cell types responsive to magnetic fields. SPIONs have a variety of other biomedical applications as well including use as a medical imaging contrast agent, targeted drug or gene delivery, diagnostic assays, and generation of local hyperthermia for tumor therapy or tissue soldering.

Targeted cell delivery is useful in a variety of biomedical applications. The goal of this protocol is to use superparamagnetic iron oxide nanoparticles (SPION) to label cells and thereby enable magnetic cell targeting approaches for a high degree of control over cell delivery and localization.

תיוג תא ומיקוד עם פאראמגנטי תחמוצת ברזל חלקיקים

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the ...

Solid Lipid Nanoparticles (SLNs) for Intracellular Targeting Applications

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter cellular signaling and gene expression. In a previous investigation, the synthesis of ultra-small solid lipid nanoparticles (SLNs) for topical drug delivery and biomarker detection applications was demonstrated. SLNs are a well-studied example of a nanoparticle delivery system that has emerged as a promising drug delivery vehicle. In this study, SLNs were loaded with a fluorescent dye and used as a model to investigate particle-cell interactions. The phase inversion temperature (PIT) method was used for the synthesis of ultra-small populations of biocompatible nanoparticles. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylphenyltetrazolium bromide (MTT) assay was utilized in order to establish appropriate dosing levels prior to the nanoparticle-cell interaction studies. Furthermore, primary human dermal fibroblasts and mouse dendritic cells were exposed to dye-loaded SLN over time and the interactions with respect to toxicity and particle uptake were characterized using fluorescence microscopy and flow cytometry. This study demonstrated that ultra-small SLNs, as a nanoparticle delivery system, are suitable for intracellular targeting of different cell types.

Solid Lipid Nanoparticles SLNs for Intracellular Targeting Applications

In this study, a method for synthesizing ultra-small populations of biocompatible nanoparticles was described, as well as several in vitro methods by which to assess their cellular interactions.

מוצקים שומנים חלקיקים (SLNs) אפליקציות לתאיות מיקוד

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter ...

A Rapid and Quantitative Fluorimetric Method for Protein-Targeting Small Molecule Drug Screening

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold nanoclusters (Au NCs) within the drug-loaded protein, based on the differential fluorescence signal emitted by the Au NCs. Albumin proteins such as human serum albumin (HSA) and bovine serum albumin (BSA) are selected as the model proteins. Four small molecular drugs (e.g., ibuprofen, warfarin, phenytoin, and sulfanilamide) of different binding affinities to the albumin proteins are tested. It was found that the formation rate of fluorescent Au NCs inside the drug loaded albumin protein under denaturing conditions (i.e., 60 &#176;C or in the presence of urea) is slower than that formed in the pristine protein (without drugs). Moreover, the fluorescent intensity of the as-formed NCs is found to be inversely correlated to the binding affinities of these drugs to the albumin proteins. Particularly, the higher the drug-protein binding affinity, the slower the rate of Au NCs formation, and thus a lower fluorescence intensity of the resultant Au NCs is observed. The fluorescence intensity of the resultant Au NCs therefore provides a simple measure of the relative binding strength of different drugs tested. This method is also extendable to measure the specific drug-protein binding constant (KD) by simply varying the drug content preloaded in the protein at a fixed protein concentration. The measured results match well with the values obtained using other prestige but more complicated methods.

A protocol for small molecular drug screening based on in-situ synthesis of ultrasmall fluorescent gold nanoclusters (Au NCs) using drug-loaded protein as template is presented. This method is simple to determine the binding affinity of drugs to a target protein by a visible fluorescent signal emitted from the protein-templated Au NCs.

מהיר וכמוני Fluorimetric שיטה להקרנת סמים מיקוד-חלבון מולקולה קטנה

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold ...

Correlative Light- and Electron Microscopy Using Quantum Dot Nanoparticles

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using widefield fluorescence light microscopy and transmission electron microscopy (TEM). To demonstrate the protocol we have immunolabeled ultrathin epoxy sections of human somatostatinoma tumor using a primary antibody to somatostatin, followed by a biotinylated secondary antibody and visualization with streptavidin conjugated 585 nm cadmium-selenium (CdSe) quantum dots (QDs). The sections are mounted on a TEM specimen grid then placed on a glass slide for observation by widefield fluorescence light microscopy. Light microscopy reveals 585 nm QD labeling as bright orange fluorescence forming a granular pattern within the tumor cell cytoplasm. At low to mid-range magnification by light microscopy the labeling pattern can be easily recognized and the level of non-specific or background labeling assessed. This is a critical step for subsequent interpretation of the immunolabeling pattern by TEM and evaluation of the morphological context. The same section is then blotted dry and viewed by TEM. QD probes are seen to be attached to amorphous material contained in individual secretory granules. Images are acquired from the same region of interest (ROI) seen by light microscopy for correlative analysis. Corresponding images from each modality may then be blended to overlay fluorescence data on TEM ultrastructure of the corresponding region.

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of epoxy embedded human pathology tissue. We employ commercial antibody fragment conjugated QDs that are visualized by widefield fluorescence light microscopy and transmission electron microscopy.

מיקרוסקופי אלקטרונים בהירי-עור גומל באמצעות חלקיקי נקודה קוונטית

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using ...

Initial Evaluation of Antibody-conjugates Modified with Viral-derived Peptides for Increasing Cellular Accumulation and Improving Tumor Targeting

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used in cancer treatment and imaging due to increased cellular accumulation over current ACs. During early AC in vitro development, fluorescence techniques and radioimmunoassays are sufficient for determining intracellular localization, accumulation efficiency, and target cell specificity. Currently, there is no consensus on standardized methods for preparing cells for evaluating AC intracellular accumulation and localization. The initial testing of ACs modified with virus-derived peptides is critical especially if several candidates have been constructed. Determining intracellular accumulation by fluorescence can be affected by background signal from ACs at the cell surface and complicate the interpretation of accumulation. For radioimmunoassays, typically treated cells are fractionated and the radioactivity in different cell compartments measured. However, cell lysis varies from cell to cell and often nuclear and cytoplasmic compartments are not adequately isolated. This can produce misleading data on payload delivery properties. The intravenous injection of radiolabeled virus-derived peptide-modified ACs in tumor bearing mice followed by radionuclide imaging is a powerful method for determining tumor targeting and payload delivery properties at the in vivo phase of development. However, this is a relatively recent advancement and few groups have evaluated virus-derived peptide-modified ACs in this manner. We describe the processing of treated cells to more accurately evaluate virus-derived peptide-modified AC accumulation when using confocal microscopy and radioimmunoassays. Specifically, a method for trypsinizing cells to remove cell surface bound ACs. We also provide a method for improving cellular fractionation. Lastly, this protocol provides an in vivo method using positron emission tomography (PET) for evaluating initial tumor targeting properties in tumor-bearing mice. We use the radioisotope 64Cu (t1/2 = 12.7 h) as an example payload in this protocol.

Viral-derived peptides coupled to antibody-conjugates (ACs) is an approach gaining momentum due to the potential of delivering molecular payloads with increased tumor cell accumulation. Utilizing common methods to evaluate peptide conjugation, AC and payload intracellular accumulation, and tumor targeting, this protocol helps researchers during the key initial development phases.

ההערכה הראשונית של נוגדן-conjugates שונה עם פפטידים ויראלי-derived הגדלת לצבירה התאית ושיפור הגידול מיקוד

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used ...

20 mJ, 1 ps Yb:YAG Thin-disk Regenerative Amplifier

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with turn-key performance and microjoule-level pulse energy is used to seed the regenerative chirped-pulse amplifier. The amplifier is placed in airtight housing. It operates at room temperature and exhibits stable operation at a 5 kHz repetition rate, with a pulse-to-pulse stability less than 1%. By employing a 1.5 mm-thick beta barium borate crystal, the frequency of the laser output is doubled to 515 nm, with an average power of 70 W, which corresponds to an optical-to-optical efficiency of 70%. This superior performance makes the system an attractive pump source for optical parametric chirped-pulse amplifiers in the near-infrared and mid-infrared spectral range. Combining the turn-key performance and the superior stability of the regenerative amplifier, the system facilitates the generation of a broadband, CEP-stable seed. Providing the seed and pump of the optical parametric chirped-pulse amplification (OPCPA) from one laser source eliminates the demand of active temporal synchronization between these pulses. This work presents a detailed guide to set up and operate a Yb:YAG thin-disk regenerative amplifier, based on chirped-pulse amplification (CPA), as a pump source for an optical parametric chirped-pulse amplifier.

A protocol for the operation of a high-energy, high-power optical parametric chirped pulse amplifier pump source based on an Yb:YAG thin-disk regenerative amplifier is presented here.

20 mJ, 1 PS Yb: YAG דיסק דק מגבר משובי

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with ...

Synthesis of Monocyte-targeting Peptide Amphiphile Micelles for Imaging of Atherosclerosis

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. Atherosclerosis is also the leading cause of sudden death and myocardial infarction, instigated by unstable plaques that rupture and occlude the blood vessel without warning. Current imaging modalities cannot differentiate between stable and unstable plaques that rupture. Peptide amphiphiles micelles (PAMs) can overcome this drawback as they can be modified with a variety of targeting moieties that bind specifically to diseased tissue. Monocytes have been shown to be early markers of atherosclerosis, while large accumulation of monocytes is associated with plaques prone to rupture. Hence, nanoparticles that can target monocytes can be used to discriminate different stages of atherosclerosis. To that end, here, we describe a protocol for the preparation of monocyte-targeting PAMs (monocyte chemoattractant protein-1 (MCP-1) PAMs). MCP-1 PAMs are self-assembled through synthesis under mild conditions to form nanoparticles of 15 nm in diameter with near neutral surface charge. In vitro, PAMs were found to be biocompatible and had a high binding affinity for monocytes. The methods described herein show promise for a wide range of applications in atherosclerosis as well as other inflammatory diseases.

This paper presents a method involving the synthesis and characterization of monocyte-targeting peptide amphiphile micelles and the corresponding assays to test for biocompatibility and ability of the micelle to bind to monocytes.

סינתזה של פילוח מונוציט פפטיד אמפיפיליות הקזאין עבור הדמיה של טרשת עורקים

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. ...

Synthesis of Functionalized 10-nm Polymer-coated Gold Particles for Endothelium Targeting and Drug Delivery

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting and drug delivery are some of the applications of these AuNPs, but endothelial extracellular matrices&#39; defensive properties hamper particle uptake. To address this issue, we describe a synthesis method for ultrasmall gold nanoparticles to improve vascular delivery, with customizable functional groups and polymer lengths for further adjustments. The protocol yields 2.5 nm AuNPs that are capped with tetrakis(hydroxymethyl)phosphonium chloride (THPC). The replacement of THPC with hetero-functional polyethylene glycol (PEG) on the surface of the AuNP increases the hydrodynamic radius to 10.5 nm while providing various functional groups on the surface. The last part of the protocol includes an optional addition of a fluorophore to allow the AuNPs to be visualized under fluorescence to track nanoparticle uptake. Dialysis and lyophilization were used to purify and isolate the AuNPs. These fluorescent nanoparticles can be visualized in both in vitro and in vivo experiments due to the biocompatible PEG coating and fluorescent probes. Additionally, the size range of these nanoparticles render them an ideal candidate for probing the glycocalyx without disrupting normal vasculature function, which may lead to improved delivery and therapeutics.

We describe a method of synthesizing biocompatible 10-nm gold nanoparticles, functionalized by coating poly-ethylene glycol onto the surface. These particles can be used in vitro and in vivo for delivering therapeutics to nanoscale cellular and extracellular spaces that are difficult to access with conventional nanoparticle sizes.

סינתזה של Functionalized 10-nm פולימר מצופה זהב חלקיקים אנדותל הכוונת משלוח סמים

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting ...

Targeting Neuronal Fiber Tracts for Deep Brain Stimulation Therapy Using Interactive, Patient-Specific Models

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for movement disorders and is being applied to a growing number of disorders. Computational modeling has been successfully used to predict the clinical effects of DBS; however, there is a need for novel modeling techniques to keep pace with the growing complexity of DBS devices. These models also need to generate predictions quickly and accurately. The goal of this project is to develop an image processing pipeline to incorporate structural magnetic resonance imaging (MRI) and diffusion weighted imaging (DWI) into an interactive, patient specific model to simulate the effects of DBS. A virtual DBS lead can be placed inside of the patient model, along with active contacts and stimulation settings, where changes in lead position or orientation generate a new finite element mesh and solution of the bioelectric field problem in near real-time, a timespan of approximately 10 seconds. This system also enables the simulation of multiple leads in close proximity to allow for current steering by varying anodes and cathodes on different leads. The techniques presented in this paper reduce the burden of generating and using computational models while providing meaningful feedback about the effects of electrode position, electrode design, and stimulation configurations to researchers or clinicians who may not be modeling experts.

The goal of this project is to develop an interactive, patient-specific modeling pipeline to simulate the effects of deep brain stimulation in near real-time and provide meaningful feedback as to how these devices influence neural activity in the brain.

פילוח סיבים עצביים ספינלי לטיפול גירוי מוחי עמוק באמצעות דגמים אינטראקטיביים, מטופל ספציפי

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for ...