التمويل المقدم من قبل وزارة الدفاع W81XWH-1023/10/01 (ZJG)، منحة GM081879 P50 من مركز UCSF للنظم والبيولوجيا الاصطناعية (ZJG)، NIH 5R21EB015088-02 (YJ)، والمعاهد الوطنية للصحة 1R21EB018044 (ZJG وYJ). وأيد DS بواسطة برنامج العلوم الحدودي الإنسان العابرة بعد الدكتوراة التخصصات الزمالة البحثية.

1. إنتاج الأحادية التكافؤ الكم النقاط <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نقل مرحلة من QDS العضوية إلى المرحلة المائية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تمييع 200 ميكرولتر من محلول 1 ميكرومتر من QDS المرحلة العضوية مع 400 ميكرولتر من كلوروفورم في كوب 5 مل قارورة. </li><li style=";text-align:right;direction:rtl"> مزيج 400 ميكرولتر من محلول 0.3 M tetrabutylammonium بروميد (TBAB) الكلوروفورم مع 36 ميكرولتر من أنيق MPEG ثيول (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) ويهز O / N. </li><li style=";text-align:right;direction:rtl"> إضافة 800 ميكرولتر من 0.2 M هيدروكسيد الصوديوم محلول مائي ويهز لمدة 30 ثانية. يحدث نقل المرحلة في غضون بضع دقائق، يتبين من نقل الجزيئات الملونة إلى المرحلة المائية فوق المرحلة العضوية أكثر كثافة. </li><li style=";text-align:right;direction:rtl"> إذا كانت الجزيئات تتجمع في المرحلة الثالثة بين المراحل المائية والعضوية، وزيادة فترة حضانة مع ثيول MPEG. إذا بقيت المرحلة المائية واضحة، إلا أن QDS لم نقل مرحلة (انظر الشكل 3A). بالتناوب، وزيادة تناسقالتموينية من MPEG ثيول في الخطوة 2 لتخفيف الفقراء نقل المرحلة. </li><li style=";text-align:right;direction:rtl"> استرداد (ملونة) المرحلة المائية ومن ثم تركيز QDS جمعها مع Centricon تدور العمود (30 كيلو دالتون الوزن الجزيئي قطع) إلى 1 مل. </li><li style=";text-align:right;direction:rtl"> إضافة محلول QD تتركز في عمود باستخدام Sephadex NAP10 معايرتها قبل مع 10 ملي تريس العازلة التي تحتوي على 30 ملي كلوريد الصوديوم (الرقم الهيدروجيني 8.0). أزل QDS مع 1.5 مل من شطف العازلة من تدفق الجاذبية. </li><li style=";text-align:right;direction:rtl"> قياس تركيز QDS مع امتصاص الطيفي في 350 نانومتر. </li></ol></li><li style=";text-align:right;direction:rtl"> إعداد mQDs <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> شراء (أو توليف) ptDNA. يستخدم هذا البروتوكول تسلسل 5&#39;-A S 50 (CT) 10 (ACTG) 5 -3 &quot;(انظر الجدول 1). </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> DNA </td><td> تسلسل </td></tr><tr><td> 5&#39;-A S 50 (CT) 10 (ACTG) 5 </sub&gt; -3 &quot; </td><td> A S S A A A S S S A A A S S S A A A S S S A A A S S S A A A S S A A S S S A A A S S S A A A S S S A A A S S S A A A S S S A A A S S A A S S S A A A S S S A A A S S S A A A S S S A A A S S S A A A S S CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG </td></tr><tr><td> 5&#39;-NH 2 - (CT) 10 (CAGT) 5 -3 &quot; </td><td> NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr><tr><td> BG-DNA </td><td> BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr></tbody></table> الجدول 1. تسلسل الحمض النووي المستخدمة لإنتاج وmQDs الهدف. <ol start="2" style="margin-left: 40px;;text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد 1 مل من 100 نانومتر حل QD في 10 ملي تريس العازلة التي تحتوي على 30 ملي كلوريد الصوديوم (الرقم الهيدروجيني 8). </li><li style=";text-align:right;direction:rtl"> إضافة قطرة من الحكمة 500 ميكرولتر من 100 نانومتر ptDNA حل للQDS مائي لمدة 1 دقيقة مع التحريك بقوة. تحريك أو وضع على شاكر ل9 ساعة إضافية. ملاحظة: هذا يجب أن ينتج نظريا نسبة 1: 2 من ptDNA: QD. ومع ذلك، رياضيات الكيمياء الفعلي هو الكمال أبدا - عادة ما تكون النتيجة هي أقرب إلى 1: 1.5. من أجل إنتاج نسبة 1: 1 من ptDNA: QD، بعد قياس كثافة الكهربائي للهلام ضرورية لقياس نسبة الدقيق من الاقتران نظرا لحجم المعروفة المستخدمة أعلاه. </li><li style=";text-align:right;direction:rtl"> ~ إزالة 10 ميكرولتر من خليط QD لتشغيل على agarose هلام التحليلية. أيضا إزالة تركيز مماثل من QDS اللامقترن في المرحلة المائية (من الخطوة 1.2.1). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إضافة ~ 2 μ؛ ل من 6X Ficoll العازلة تحميل (لزيادة كثافة الحل) وتشغيل هذه العينات اثنين معا على هلام 0.8٪ وزن / V الاغاروز في بورات الصوديوم عازلة لمدة 15 دقيقة في 150 V. فرقة واحدة في السيطرة على الممر اللامقترن المهاجرة بالقرب من البئر، وشريطين في الممر مع QDS مترافق وينظر (انظر المواد الهلامية في الشكل 2B). </li></ol></li><li style=";text-align:right;direction:rtl"> حساب جزء QD لا مقترن باستخدام الكثافة النسبية للعصابات اثنين (انظر المعادلة في الشكل 2B). ثم استخدام ذلك جزء لحساب الحجم الإضافي من 100 نانومتر ptDNA الحل المطلوب لتتناسب مع عدد QDS. </li><li style=";text-align:right;direction:rtl"> كرر الخطوات من 1.2.3 إلى 1.2.5 مرة أخرى مع هذا الحجم المحسوب أو حتى انهيار QDS مترافق إلى فرقة واحدة على هلام تشير الاقتران الكامل لجميع QDS. </li><li style=";text-align:right;direction:rtl"> إضافة 100 ميكرولتر من 10 ملي (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (كربوكسي PEG6 ثيول ألكان) في 10 ملي تريس العازلة التعاونntaining 30 مم كلوريد الصوديوم (الرقم الهيدروجيني 8) إلى mQDs مترافق المنتجة أعلاه، ويهز لمدة 10 دقيقة. ملاحظة: هذه بروابط PEG إيقاف فاعلية سطح QD. وهناك أطول PEG أفضل إيقاف فاعلية وQDS، ومع ذلك، فإنه سيتم أيضا زيادة حجمها. وظائف ثيول ألكان مسعور لديها تقارب أعلى بكثير لQDS، في مجموعها، من أقل مسعور PEG-ثيول تستخدم لنقل المرحلة. لذا، لا تسمح هذه الخطوة للمضي قدما طويلة جدا أو سيتم استبدال ptDNA من قبل ألكان-PEG-ثيول. ~ بعد 30 دقيقة الحضانة، سيكون قد تم تشريد جزء كبير من الحمض النووي من QDS (الشكل 3B). </li><li style=";text-align:right;direction:rtl"> لإزالة الزائد ألكان PEG-ثيول، إضافة 0.5 مل من محلول QD إلى عمود باستخدام Sephadex NAP5 معايرتها قبل مع شطف العازلة (10 ملي تريس العازلة التي تحتوي على 30 ملي كلوريد الصوديوم). جمع mQDs مع 1.0 مل من شطف العازلة من تدفق الجاذبية. </li><li style=";text-align:right;direction:rtl"> تركيز QDS جمعها مع عمود الدوران Centricon (30 كيلو دالتون). تخزين هذه mQDs في 4 درجة مئوية لمدة أشهر. لا الابeeze لهم. ملاحظة: إذا كان يعتبر بيليه الملونة في أسفل الأنبوب، وتجميع النقاط ويرجح لم تعد صالحة للاستعمال. </li></ol> 2. إنتاج استهداف (Benzylguanine-) DNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إنتاج أو شراء DNA منتهية أمين. يستخدم هذا البروتوكول تسلسل 5&#39;-NH 2 - (CT) 10 - (CAGT) 5 -3 &quot;(انظر الجدول 1). رابط بولي-CT يزيد من إمكانية الوصول إلى وظيفة في أعماق الكنان السكري ولكن قد لا تكون هناك حاجة لجميع التطبيقات. إذا كان هناك إمكانية الوصول إلى المزج الحمض النووي، وإنتاج الحمض النووي تعديل الأمينية باستخدام المناسب 5 &quot;الأمينية معدل (5 &#39;الأمينية معدل C6). </li><li style=";text-align:right;direction:rtl"> حل BG-N-hydroxysuccinimide (BG-NHS) في الجافة ثنائي ميثيل سلفوكسيد (DMSO) بتركيز 10 ملغ / مل. ملاحظة: BG-NHS تمتص الماء من الجو وتؤدي إلى التحلل من رد الفعل NHS استر، لا سيما في المذيبات مثل DMSO hydroscopic وثنائي ميثيل الفورماميد (DMF). BG-NHS هو أفضل متجرد -80 ° C على شكل مسحوق في قنينة خاصة بها داخل حاوية تحتوي على المجففة الثانوي. الحارة لRT قبل فتح القارورة. بالتناوب، قسامة فورا للاستخدام الفردي استر BG-NHS في مذيب قطبي جاف وتجميد في -80 درجة مئوية، أو تتفاعل مع الحمض النووي بشكل كامل أمين في الخطوة 2.2. </li><li style=";text-align:right;direction:rtl"> الرد عن طريق خلط BG-NHS في DMSO من الخطوة 2.1 مع DNA منتهية أمين في HEPES (4- (2 هيدروكسي إيثيل) حامض -1-piperazineethanesulfonic) مخزنة (الرقم الهيدروجيني 8.5) المياه. في رد فعل نموذجي 20 ميكرولتر من 10 ملغ / مل BG-NHS في DMSO مع 2 ميكرولتر من 2 ملي NH 2 - (CT) 10 - (CAGT) 5 في 58 ميكرولتر منزوع الأيونات الماء مخزنة مع 20 ميكرولتر 0.5 M HEPES الرقم الهيدروجيني 8.5. تنفيذ ردود الفعل في أنبوب microcentrifuge 1.5 مل. مزيج العائدات أسرع وقت رد الفعل سريعا ويجب أن تتنافس مع NHS استر التحلل. </li><li style=";text-align:right;direction:rtl"> يصوتن لمدة 5-10 دقيقة لضمان خلط دقيق. احتضان ~ 1 ساعة على RT. نسبة متكافئة من BG: الحمض النووي يمكن تغييرها لدفع رد فعل على الانتهاء. </li><lط&gt; تحلية رد الفعل باستخدام عمود NAP5 القياسية إلى 100 ملي خلات الترايثلامين (TEAA، ودرجة الحموضة 7). </li><li style=";text-align:right;direction:rtl"> تنقية BG-DNA من غير المتفاعل أمين-DNA بواسطة عكس المرحلة HPLC تشغيل TEAA 100 ملي: أسيتونتريل (ACN) التدرج بين 8٪ و 95٪ الأسيتونيتريل أكثر من 30 دقيقة. فإن أمين-DNA غير المتفاعل أزل قبل BG-DNA. جمع جزء BG-DNA في أنبوب مخروطي. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخدام عمود C 18 Zorbax لتنقية قليل النوكليوتيد القياسية والتدرج التالية: 0 → 15 دقيقة: 8 → 30٪ ACN. 15 → 21 دقيقة: 30-90٪ ACN. 21 → 25 دقيقة: 90 → 8٪ ACN. 25 → 30 دقيقة: 8٪ ACN. </li></ol></li><li style=";text-align:right;direction:rtl"> تجميد في النيتروجين السائل ويجفد الأجزاء المتجمعة. Resuspend وDNA في الماء منزوع الأيونات. أن تكون أكثر حذرا، يجفد مرتين أكثر لإزالة TEAA المتبقية. TEAA المتبقية يمكن أن تكون سامة للخلايا بتركيزات أعلى. </li><li style=";text-align:right;direction:rtl"> Resuspend ومجفف بالتجميد BG-DNA في الماء، مع التأكد من غسل الجانبين من عشرأنبوب الإلكترونية، وتمييع ل~ 25 ميكرومتر الأسهم. قسامة وتخزينها في 4 درجة مئوية. تم تخزين العينات ل~ 9 أشهر دون تدهور ملحوظ. </li></ol> 3. خلايا وصفها العيش مع الأحادي التكافؤ الكم النقاط <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> اختياريا، إيقاف فاعلية وmQDs قبيل تجربة التصوير باستخدام الكواشف مثل الكازين (0.5٪) أو ألبومين المصل البقري (BSA، 1-3٪). </li><li style=";text-align:right;direction:rtl"> لوحة الخلايا معربا عن بروتين SNAP الموسومة على مجموع مضان انعكاس الداخلي (TIRF) الزجاج ذات جودة. في هذه التجربة، ونحن نستخدم خط خلية U2OS تعبر عن مستقبل Notch1 SNAP الموسومة والواجهات الزجاجية عالية الجودة. </li><li style=";text-align:right;direction:rtl"> بعد أن تعلق الخلايا على الزجاج (~ 24 ساعة)، وإزالة وسائط النمو، ويغسل مع برنامج تلفزيوني، واحتضان الخلايا لمدة 10-30 دقيقة في RT في ~ 100-150 ميكرولتر من برنامج تلفزيوني أو وسائل الإعلام الخلية التي تحتوي ~ 1 ميكرومتر BG- DNA من الخطوة 2.6 أعلاه. </li><li style=";text-align:right;direction:rtl"> بعد الحضانة مع BG، وغسل بعناية الخلايا مع برنامج تلفزيوني أو وسائل الإعلام الخلية. احتضان الخلايا ل~ 5-10 دقيقة مع الmQDs الإلكترونية المنتجة في الخطوة 1.2.9 (وتخمل اختياريا في الخطوة 3.1). </li><li style=";text-align:right;direction:rtl"> اختياريا، وغسل mQDs غير منضم والعودة الخلايا إلى المخزن مؤقت / وسائل الإعلام مناسب لكلا التصوير والثقافة. للخلايا التي كان من المقرر تصويرها في وضع TIRF، كانت خطوة غسل النهائية غالبا ما تكون غير ضرورية كما mQDs غير منضم في حل تنتشر بسرعة كبيرة مقارنة مع mQDs ملزمة لتكون غير قابلة للكشف خلال التحليل. </li></ol> 4. المجهري والتحليل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> صورة الخلايا باستخدام المجهر TIRF. ملاحظة: يجب أن يكون نطاق الإثارة والمرشحات للفصل الانبعاثات، أو مرشح مكعب QD مخصصة. QDS هي أفضل متحمس مع ليزر منخفض الطول الموجي (405 أو 488 نانومتر). QDS من القطر المختلفة لها أطوال موجية الانبعاثات المميزة، التي ترتبط عادة مع التحول إلى ستوك كبيرة ل. </li><li style=";text-align:right;direction:rtl"> بسبب سطوع mQDs، وجمع الصور في إطار معدلات عالية في حين TIRF التصوير الجانب القاعدي للخلية الحية. ملاحظة: بدلا من ذلك، يمكن ديناميات واحدة جزيء يكون اتباعهحش في طائرات التنسيق الأخرى باستخدام المجهر الغزل القرص مبائر. آلية تتبع البرمجيات واحد الجسيمات ناجحا عموما في تتبع بدقة mQDs مشرق وصامد. </li></ol>

<ol>
	<li>Sako, Y., Minoghchi, S., Yanagida, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+imaging+of+EGFR+signaling+on+the+surface+of+living+cells.">Single-molecule imaging of EGFR signaling on the surface of living cells.</a> Nature Cell Biology. 2 (3), 168-172 (2000).</li><li>Luo, W., He, K., Xia, T., Fang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+monitoring+in+living+cells+by+use+of+fluorescence+microscopy.">Single-molecule monitoring in living cells by use of fluorescence microscopy.</a> Analytical and Bioanalytical Chemistry. 405 (1), 43-49 (2013).</li><li>Chung, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+control+of+EGF+receptor+activation+by+reversible+dimerization+on+living+cells.">Spatial control of EGF receptor activation by reversible dimerization on living cells.</a> Nature. 464 (7289), 783-787 (2010).</li><li>Fern&#225;ndez-Su&#225;rez, M., Ting, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+probes+for+super-resolution+imaging+in+living+cells.">Fluorescent probes for super-resolution imaging in living cells.</a> Nature Reviews Molecular Cell Biology. 9 (12), 929-943 (2008).</li><li>Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photooxidation+and+photobleaching+of+single+CdSe/ZnS+quantum+dots+probed+by+room-temperature+time-resolved+spectroscopy.">Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy.</a> The Journal of Physical Chemistry B. 105 (35), 8281-8284 (2001).</li><li>Pinaud, F., Clarke, S., Sittner, A., Dahan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+cellular+events,+one+quantum+dot+at+a+time.">Probing cellular events, one quantum dot at a time.</a> Nature Methods. 7 (4), 275-285 (2010).</li><li>Michalet, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantum+dots+for+live+cells,+in+vivo+imaging,+and+diagnostics.">Quantum dots for live cells, in vivo imaging, and diagnostics.</a> Science. 307 (5709), 538-544 (2005).</li><li>Howarth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monovalent,+reduced-size+quantum+dots+for+imaging+receptors+on+living+cells.">Monovalent, reduced-size quantum dots for imaging receptors on living cells.</a> Nature Methods. 5 (5), 397-399 (2008).</li><li>Iyer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aromatic+aldehyde+and+hydrazine+activated+peptide+coated+quantum+dots+for+easy+bioconjugation+and+live+cell+imaging.">Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging.</a> Bioconjugate Chemistry. 22 (6), 1006-1011 (2011).</li><li>Tikhomirov, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+programming+of+quantum+dot+valency,+self-assembly+and+luminescence.">DNA-based programming of quantum dot valency, self-assembly and luminescence.</a> Nature Nanotechnology. 6 (8), 485-490 (2011).</li><li>Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+targeted+monovalent+quantum+dots+by+steric+exclusion.">Formation of targeted monovalent quantum dots by steric exclusion.</a> Nature Methods. 10 (12), 1203-1205 (2013).</li><li>Gartner, Z. J., Bertozzi, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmed+assembly+of+3-dimensional+microtissues+with+defined+cellular+connectivity.">Programmed assembly of 3-dimensional microtissues with defined cellular connectivity.</a> Proceeding of the National Academy of Sciences USA. 106 (12), 4606-4610 (2009).</li><li>Selden, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+programmed+cell+adhesion+with+membrane-anchored+oligonucleotides.">Chemically programmed cell adhesion with membrane-anchored oligonucleotides.</a> Journal of the American Chemical Society. 134 (2), 765-768 (2012).</li></ol>

The authors have nothing to disclose.

على نمطية للتصميم mQD يمكن زيادة درجة المرونة التجريبية. على سبيل المثال، مجموعة متنوعة من mQDs يمكن إعداد بسرعة بألوان فريدة تسمح التصوير المتزامن لأهداف متعددة. تسلسل استهداف ssDNA يمكن توجيه mQDs إلى البروتينات، والسكريات 12، والدهون والأسطح 13. وهناك عدد من العلامات الأنزيمية المتاحة مع نشاطية متعامدة، مما يسمح لأهداف متعددة في وقت واحد يمكن تصوير مع mQDs المستهدفة بشكل مختلف. وبالإضافة إلى استهداف مع العلامة SNAP، كان وسم البروتينات الهدف مع mQDs باستخدام علامة CLIP، العلامة HALO، والبروتينات المعقدة البيروكسيديز ناجحة أيضا. يوضح هذا البروتوكول وصفها محدد من المستقبلات على سطح الخلايا الحية مع هذه mQDs، ولكن يمكن بسهولة أن تتكيف بروتوكول لعدد من السياقات المختلفة. البصيرة المنهجية الهامة في إنتاج mQDs مع تكافؤ محددة هي أن ~ المرتبطة phosphorothioate 50هناك حاجة إلى التفاف قواعد QDS (وبالتالي منع جزيئين من الملزم في وقت واحد). A-A بولي تسلسل S 50 بتكاثر ومستقر ملزمة QDS 605 نانومتر من تقنيات الحياة. على الرغم من أنه تم وقف هذا المنتج، واستراتيجية الإقصاء الفراغية هي تعميم لمنتجات مماثلة من موردين آخرين جود مختلف الأحجام والأشكال، والخصائص الطيفية. كفاءة واستقرار QDS ptDNA الملفوفة تعتمد بشكل كبير على الكيمياء السطحية وهيكل QDS. وبالتالي، فإن نجاح بروتوكول تعتمد على بنية مصدر والكيميائية التجاري للQDS. لأغراض هذا البروتوكول، وهناك ثلاث نقاط رئيسية للفرق بين مصادر تجارية مختلفة من QDS: اختلاف في الشروط اللازمة لنقل المرحلة. الفرق في قوة الأولي ملزم PEG-ثيول يجند، ربما تعوق التشريد من قبل ptDNA. واختلاف في كمية يتعرض CdSe الأساسية، والتي يمكن جنيهإعلان للتبريد من QD من قبل MPEG شروط نقل المرحلة ثيول. والنشر، QDS مع أفضل بنية لإنتاج mQDs هي 4-10 QDS نانومتر CdSe / اغشية الأساسية / شل شراؤها من تقنيات الحياة مع أطياف الانبعاثات في 545، 585، 605 و 625 نانومتر (الشكل 2A). QDS استنادا إلى صياغة &quot;حية&quot; (545، 605، الخ) على إخماد إضافة MPEG ثيول وغير مناسبة لهذا التطبيق. QDS من الدريتش والمحيط تكنولوجيا النانو تعمل بشكل جيد، ولكن تتطلب خطوات نقل مرحلة أطول والمعالجة المسبقة مع أكسيد trioctylphosphine. وقد تم تحسين هذا البروتوكول لQDS من تقنيات الحياة. يتم إنهاء تسلسل بولي-A phosphorothioate تستخدم لالتفاف QDS مع الأصلي 20 مير ذيل DNA تحتوي على تسلسل (ACTG) 5 التي تستهدف حبلا قد هجن. هذا التسلسل غير مريحة، كما أن لديها قليل من دون هيكل الثانوي، وسيظل hybridizإد عند 37 درجة مئوية في برنامج تلفزيوني. إذا كان هناك إمكانية الوصول إلى المزج الحمض النووي، يمكن للptDNA توليفها من ثم تنقيته بواسطة عكس المرحلة اللوني السائل عالي الأداء (HPLC) باستخدام عمود C 8. سوف ptDNA أزل في وقت لاحق على HPLC من أليغنوكليوتيد] تعادل مع العمود الفقري الأصلي. نحن عادة ترك 5 &#39;DMT حماية المجموعة على أليغنوكليوتيد] phosphorothioate لدينا بعد تنقيتها. مطلوب عادة التخميل من QDS ptDNA ملفوفة في أجل تحسين الاستقرار الغروية من QDS والحد خلفية ملزمة لمعظم التطبيقات التجريبية. يستخدم بروتوكول طبقة من PEG-إيقاف فاعلية وQDS. كربوكسي PEG ثيول ألكان مع وحدات إضافية PEG ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH، كربوكسي-PEG12 ثيول ألكان) يوفر انخفاض كبير الخلفية، على الرغم من أن أوتاد أطول على حد سواء أكبر، وعموما أكثر تكلفة. mQDs المغلفة مع كربوكسي PEG الكابروابط ثيول شمال شرق مستقرة للغاية في مخازن الفسيولوجية مثل ملاحات الفوسفات مخزنة وسائل الإعلام والثقافة. أظهر تخزين على المدى الطويل (&gt; 8 أشهر) من mQDs في 4 درجات مئوية أي تجميع كبير أو ptDNA مفرزة 11. تبعا للتجربة، PEG التخميل من QDS وحده لا يقلل بما فيه الكفاية دائما غير محددة وملزمة للmQDs. احتضان كل من الخلايا وmQDs في الفوسفات مخزنة المالحة (PBS) التي تحتوي على 3٪ BSA لمدة 20 دقيقة قبل استخدامها يقلل إلى حد كبير غير محددة ملزمة للخلايا، على الرغم من أنه لا يزيد نصف قطرها الهيدروديناميكية واضح من قبل mQDs ~ 50٪. التخميل مع 0.5٪ يقلل من الكازين غير محددة ملزمة أبعد من ذلك ولكن لأنه يزيد من حجم واضحا إلى حد أكبر من BSA. 5 &#39;نهاية حبلا الحمض النووي مكملة لmQDs يمكن تعديلها لتمكين استهداف عدد من الجزيئات الحيوية المختلفة. هناك عدد من التقنيات المتاحة لتأسيس تعديل تساهميا البروتينات، لipids والسكريات مع الحمض النووي واحد الذين تقطعت بهم السبل (ssDNA). طالما يتم تقديم ssDNA خارج الخلية، فإنه يمكن الوصول إلى mQDs قابل للذوبان. سوف mQDs مع تسلسل أعلاه هجن بسرعة مع حبلا الحمض النووي التكميلي في ظل ظروف ثقافة الخلية. و10-20x بولي (CT) فاصل بين ptDNA وتسلسل استهداف قد تكون هناك حاجة لكفاءة استهداف وذلك لرفع تسلسل ملزمة فوق الكنان السكري سميكة وذات الشحنة السالبة للخلية. لهذا البروتوكول اخترنا لإنتاج DNA-BG مع سلسلة متكاملة من (CAGT) 5 من شأنها أن كلا تهجين إلى mQDs وتساهميا ربط نفسه إلى البروتين SNAP-علامة لوصفها سريع ومحدد. وظائف بروتوكول مماثلة تماما لاقتران أخرى NHS-استرات ل[أليغنوكليوتيد المعدلة الأمينية. للتصوير جزيء واحد، وعادة ما تتطلب كثافة منخفضة من وضع العلامات لحل الجزيئات الفردية. وهناك تركيز mQD النهائي ~ 0.5 نانومتر في برنامج تلفزيوني مع وكيل تخميلهو هدف جيد. ومع ذلك، أدت هذه التخفيفات عالية أحيانا في ظل وضع العلامات من الخلايا. إذا حدث هذا، يمكن أن تضاف إضافية mQD حتى لوحظ كثافة المثلى لوضع العلامات. في حالة SNAP الموسومة Notch1 البشري، تركيزات&gt; 10 نانومتر mQD أنتجت خلايا وضع العلامات كثيفة بينما أسفرت 0.5 نانومتر mQD في المرفق من ~ 20 mQDs على السطح القاعدي الخلايا المستهدفة (انظر الشكل 4B). كان وضع العلامات خلية مع mQDs يعتمد بشكل كبير من الخلايا confluency مطلي. مفرطة في خلايا متكدسة لا التسمية في السطوح القاعدية الخاصة بهم. باختصار، طريقة بسيطة لتوليد أحادي التكافؤ وصفت QDS وحدات. هذه mQDs تجد فائدة في مجموعة واسعة من تطبيقات التصوير الخلية الحية، كما يتبين من تصوير مستقبلات الشق على الخلايا U2OS الحية. تطبيق mQDs لا يقتصر على هذه الحالة المحددة، ولكن يمكن تمديد يحتمل للأهداف الخلوية الأخرى مثل البروتينات الأخرى، والأحماض النووية، والإنزيمات.

ديناميكية الجزيئات واحدة على الخلايا الحية تساهم في الوظيفة البيولوجية الخاصة بهم. التصوير مضان جزيء واحد هو وسيلة شعبية لدراسة ديناميكية الجزيئات واحدة على 1،2،3 سطح الخلية. ومع ذلك، فإن تحقيقات التصوير الأكثر شيوعا في هذه الدراسات لها عيوب عديدة مهمة. على سبيل المثال، والأصباغ العضوية والبروتينات الفلورية التقليدية توفر سطوع معتدل، حوالي 10 -10 5 6 M -1 سم -1، ولكن غير مستقرة ضوئيا، وتبيض بعد انبعاث حوالي 10 -10 5 6 الفوتونات في ظل ظروف التصوير الخلية الحية النموذجية 4،5. في المقابل، أشباه الموصلات النانوية، وعادة ما يطلق نقاط الكم (QDS)، هي أكثر إشراقا بكثير وأكثر استقرارا، مع معاملات الانقراض في حدود 10 -10 6 7 M -1 سم -1 وتتجاوز 10 -10 7 8 الفوتونات المنبعثة قبل photobleaching 5. تحسن السطوع وصمود من QDS على fluorophores العضوية يتيح مراقبة الجزيئات واحدة في أسرع بشكل ملحوظ معدلات الإطار وأكثر من 6 مسارات أطول بكثير. على الرغم من مزاياها والتوافر التجاري، لا تزال عدة التزامات لهذه العوامل التصوير قوية. أولا، أنها محددة بشكل واضح استهداف التكافؤ، مما قد يؤدي في يشابك من الجزيئات الحيوية المستهدفة 6. الثانية، لديهم عادة حجم كبير الهيدروديناميكية (&gt; 20 نانومتر) الذي يحد من إمكانية الوصول إلى بعض البيئات المزدحمة الخلوية 7. ثالثا، أنها حدت من استهداف نمطية 7. وقد حاول العديد من الاستراتيجيات لمعالجة هذه المشاكل 8،9،10، ولكن عموما تتطلب معرفة متخصصة والكواشف لتنفيذها. لمعالجة هذه المشاكل، ونحن ذكرت مؤخرا استراتيجية &quot;استبعاد الفراغية&quot; لإعداد الأحادي التكافؤ، صغيرة، ووحدات QDS 11. هي ملفوفة في QDS مع DNA phosphorothioate طويلة (ptDNA) البوليمر واحد. وptDNA يربط إلى السطح QD متعددة من خلال التفاعل بين الزنك-S-تتعرض سطح ذرات الزنك والجماعات phosphorothioate من البوليمر ptDNA. بوليمر المربوطة واحد sterically وكهربية يستبعد الربط مكافئات إضافية من البوليمر دون زيادة كبيرة الحجم الكلي الجسيمات (حوالي 2 نانومتر). كلها الكواشف المتاحة تجاريا، وتشكل المنتجات عالية الغلة، وهذه العملية تتطلب سوى خطوات تحلية لتنقية. مرة واحدة المسمى، QDS ملفوفة مع ptDNA (mQDs) ربط واحد للحمض النووي مكملة تحمل تستهدف المجالات (على سبيل المثال، benzylguanine (BG)، benzylcytosine، أو alkylhalides). هذه الوظائف تستهدف mQDs تحديدا إلى علامات الأنزيمية مثل SNAP، وCLIP HALO التي تنصهر فيها وراثيا لبروتين من الفائدة. هذا هو بروتوكول لتوليف، الاستهداف، والتصوير الخلية الحية من mQDs التي تنتجها استبعاد الفراغية.

<table border="0" cellpadding="0" cellspacing="0" width="497">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:91px;">Comments/Description</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">mQD Production:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Phosphorothioate DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(A*)x50-(ACTG)x5</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Quantum Dots:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="127">
			<td height="127" style="height:127px;width:216px;">QDots 525, 585, 605 &#38; 625</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">Q21791MP (545), Q21711MP (585), Q21701MP (605)</td>
			<td style="width:91px;">Custom QD synthesis for QD625.</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">QD610</td>
			<td style="width:71px;">Ocean Nanotech</td>
			<td style="width:119px;">QSP-610-10&#160;</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">QD 610 lamda</td>
			<td style="width:71px;">Aldrich</td>
			<td style="width:119px;">731854</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Chloroform, 99.8%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">67-66-3</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Tetrabutylammonium bromide, 98.0%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">426288</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95%</td>
			<td style="width:71px;">Polypure</td>
			<td style="width:119px;">11156-0695</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:216px;">HSC11EG6CO2H&#160; [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H]</td>
			<td style="width:71px;">ProChimia</td>
			<td style="width:119px;">TH 003-m11.n6-0.1</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Boric Acid, 99.5%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">B0394</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Sodium Hydroxide, 99.0%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">S/4845</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Sodium Chloride, 98%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">310166</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Agarose LE</td>
			<td style="width:71px;">U.S. Biotech Sources</td>
			<td style="width:119px;">G02PD-125</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Ethanol</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">459828</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">BG-DNA Production:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Amine DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5(T)40-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">NHS-GLA-Benzylguanine</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">S9151</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">DMSO</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D8428</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">HEPES Buffer</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">83264</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">NAP5 Column</td>
			<td style="width:71px;">GE Healthcare</td>
			<td style="width:119px;">17-0853-01</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">C18 Column</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Acetonitrile</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">Mammalian Cell Culture &#38; Imaging:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Cell line expressing SNAP-tagged protein</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">E9100S</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">McCoys 5A</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">PBS</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Nunc Lab-tek II Chambered Coverglass</td>
			<td style="width:71px;">Thermo-Fischer Scientific</td>
			<td style="width:119px;">155409</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Matriplate 96-well plate</td>
			<td style="width:71px;">Brooks Life Science Systems</td>
			<td style="width:119px;">MGB096-1-2-LG-L</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">BSA</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">5% Alkali-soluble Casein</td>
			<td style="width:71px;">EMD Millipore</td>
			<td style="width:119px;">70955</td>
			<td style="width:91px;">Not all caseins are the same</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">(Optional) DNA Synthesis Reagents:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">5&#8217; Amine modifier C6</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">Oct-06</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">dA-Thiophosphoramidite</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">10-700</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Analysis Software:</td>
			<td></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">FIJI</td>
			<td colspan="3">http://valelab.ucsf.edu/~schindelin/</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">RyTrack.pro</td>
			<td colspan="3">http://sun.iwu.edu/~gspaldin/rytrack.html</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Tracker</td>
			<td colspan="3">http://www.gartnerlab.ucsf.edu/more/software</td>
		</tr>
	</tbody>
</table>

production and targeting of monovalent quantum dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in biology, where clustering and the spatial organization of biomolecules is often the object of study. We describe here a protocol to produce monovalent quantum dots (mQDs) that can be accomplished in most biological research laboratories via a simple mixing of CdSe/ZnS core/shell QDs with phosphorothioate DNA (ptDNA) of defined length. After a single ptDNA strand has wrapped the QD, additional strands are excluded from the surface. Production of mQDs in this manner can be accomplished at small and large scale, with commercial reagents, and in minimal steps. These mQDs can be specifically directed to biological targets by hybridization to a complementary single stranded targeting DNA. We demonstrate the use of these mQDs as imaging probes by labeling SNAP-tagged Notch receptors on live mammalian cells, targeted by mQDs bearing a benzylguanine moiety.

نقل مرحلة من مراحل QDS من العضوية إلى المرحلة المائية هو أمر حاسم لإنتاج mQDs، ولكن يمكن أن تكون على شرط وQD محددة. يجب أن تظهر في مرحلة نقل القسم 1.1 نظيفة كما أول قارورة اثنين في الشكل 3. إذا ظهر نقل أكثر مثل قنينة 3، ثم ينبغي للمرء أن المحاولة مرة أخرى مع الظروف المختلفة. مرة واحدة والمغلفة للQDS مع الحمض النووي المشحونة سلبا عليهم الهجرة على هلام بشكل منفصل عن QDS غير الملفوفة. باستخدام قسامة من QDS ملفوف كعنصر تحكم، والثانية، يجب أن تظهر الفرقة أسرع المهاجرة عليها اضافة ptDNA، كما رأينا في هلام الأول في الشكل 2B. ويتجلى تشكيل كامل للmQDs مع فقدان الفرقة متحركة، وانهياره في الفرقة المتنقلة كما رأينا في الماضي جل في الشكل 2B. إذا قسامة من الناتج mQD الخاص بترحيل بمثابة فرقة واحدة للفصل من QDS ملفوف، ثم mQDs لديك هي أحادي التكافؤ وص<html> إيدي لاستخدامها في اتخاذ مزيد من الخطوات. يجب أن يكون وضع العلامات خلية معينة إلى الهدف من اختيارك ويجب أن تكون معتمدة على مستويات التعبير البروتين وتركيز mQD. وغالبا ما يتطلب التحسين التجريبية من كل من تركيز mQD وmQD التخميل لأي تطبيق معين. الشكل 4B يدل على وضع العلامات الخلايا U2OS تعبر عن مستقبلات الشق SNAP الموسومة مع mQDs تتراوح تركيز من 0.5 نانومتر إلى 10 نانومتر. <img fo:content-width="6in" width="600" alt="الشكل 1" src="/files/ftp_upload/52198/52198fig1highres.jpg" /> الرقم 1. حدات استهداف mQDs. mQDs هجن إلى ssDNA بين functionalized من قبل مختلف الجزيئات الاستهداف. Benzylguanine المرتبطة أهداف DNA mQDs لالتقاط الموسومة البروتينات الانصهار. التعديلات الأخرى 5 &#39;و تسلسل الحمض النووي تمكن استهداف mQDs لمجموعة متنوعة من الجزيئات الحيوية الأخرى./files/ftp_upload/52198/52198fig1highres.jpg &quot;الهدف =&quot; _ على بياض &quot;&gt; اضغط هنا لمشاهدة نسخة أكبر من هذا الرقم. <img fo:content-width="6in" width="600" alt="الشكل 2" src="/files/ftp_upload/52198/52198fig2highres.jpg" /> الرقم 2. خطة لإنتاج mQDs. يتم نقل (A) QDS المرحلة العضوية إلى المرحلة المائية عن طريق العلاج مع MPEG ثيول وTBAB، ملفوفة مع ptDNA، وتخمل مع كربوكسي PEG6 ثيول ألكان. صور الممثل TEM هي QD545 العضوية، QD585، وQD605، على التوالي. (B) وهناك طريقة لتحديد تجريبيا رياضيات الكيمياء من التفاعل بين QDS وptDNA في الخطوة الثانية أعلاه. ويتم التحقق منها QD وptDNA stoichiometries تجريبيا بواسطة قياس كثافة مثل أن رد فعل رياضيات الكيمياء النهائي هو 1: 1 (QD: ptDNA). يتم ضرب العدد الأولي مولات ptDNA من نسبة QD: mQD، وتعديلها من قبل AF الحجم الفعلي<html> ثالثا اقتران لانتاج عدد مولات اللازمة لتحقيق 1: 1 اقتران <a href="https://www.jove.com/files/ftp_upload/52198/52198fig2highres.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img fo:content-width="6in" width="600" alt="الرقم 3" src="/files/ftp_upload/52198/52198fig3highres.jpg" /> الرقم 3. تفاصيل التجريبية لإنتاج mQDs. (A) الصور التمثيلية للنجاح وفشل نقل المرحلة. يجب QDS نقل بصريا بين المرحلة العضوية الكثيفة والمرحلة المائية أقل الكثيفة. فصل مرحلة ناقصة يشير نقل الفقراء. (B) ptDNA يمكن الاستعاضة عن ألكان-PEG-ثيول. البيانات هلام الصحيح هو ممثل رد فعل حيث نزح جزء كبير من ptDNA من QDS بسبب الإفراط في التخميل.es.jpg &quot;الهدف =&quot; _ على بياض &quot;&gt; اضغط هنا لمشاهدة نسخة أكبر من هذا الرقم. <img fo:content-width="6in" width="600" alt="الرقم 4" src="/files/ftp_upload/52198/52198fig4highres.jpg" /> الرقم 4. صفها البروتينات SNAP الموسومة في الخلايا الحية. (A) تخطيطي مما يدل على التعبير، مرفق ووضع العلامات على مستقبلات SNAP الموسومة مع mQD BG المستهدفة. (ب) وضع العلامات الممثل خلايا تعبر عن SNAP-الشق-mCherry بناء بتركيزات mQD المختلفة. mQDs تخمل مع PEG12 colocalize مع mCherry تشير العلامات محددة. كثافة العلامات الدنيا (&lt;0.5 نانومتر) هي الأفضل عموما لتتبع جسيم واحد. شريط النطاق هو 10 ميكرون. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig4highres.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a>

Watch this Scientific Journal Video about Production and Targeting of Monovalent Quantum Dots at JoVE.com

Production and Targeting of Monovalent Quantum Dots

We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications.

الإنتاج واستهداف الأحادي التكافؤ الكم النقاط

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in ...

production-and-targeting-of-monovalent-quantum-dots

Research

JoVE Journal

Bioengineering

25.3K Views.  University of California, San Francisco. We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications. 

Video: Production and Targeting of Monovalent Quantum Dots

Solubilization and Bio-conjugation of Quantum Dots and Bacterial Toxicity Assays by Growth Curve and Plate Count

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. QDs have attracted a lot of interest for imaging, diagnostics, and therapy due to their bright, stable fluorescence1,2 3,4,5. QDs can be conjugated to a variety of bio-active molecules for binding to bacteria and mammalian cells6.
QDs are also being widely investigated as cytotoxic agents for targeted killing of bacteria. The emergence of multiply-resistant bacterial strains is rapidly becoming a public health crisis, particularly in the case of Gram negative pathogens 7. Because of the well-known antimicrobial effect of certain nanomaterials, especially Ag, there are hundreds of studies examining the toxicity of nanoparticles to bacteria 8. Bacterial studies have been performed with other types of semiconductor nanoparticles as well, especially TiO2 9,10-11, but also ZnO12 and others including CuO 13. Some comparisons of bacterial strains have been performed in these studies, usually comparing a Gram negative strain with a Gram positive. With all of these particles, mechanisms of toxicity are attributed to oxidation: either the photogeneration of reactive oxygen species (ROS) by the particles or the direct release of metal ions that can cause oxidative toxicity. Even with these materials, results of different studies vary greatly. In some studies the Gram positive test strain is reportedly more sensitive than the Gram negative 10; in others it is the opposite 14. These studies have been well reviewed 15.
In all nanoparticle studies, particle composition, size, surface chemistry, sample aging/breakdown, and wavelength, power, and duration of light exposure can all dramatically affect the results. In addition, synthesis byproducts and solvents must be considered16 17. High-throughput screening techniques are needed to be able to develop effective new nanomedicine agents.
CdTe QDs have anti-microbial effects alone18 or in combination with antibiotics. In a previous study, we showed that coupling of antibiotics to CdTe can increase toxicity to bacteria but decrease toxicity to mammalian cells, due to decreased production of reactive oxygen species from the conjugates19. Although it is unlikely that cadmium-containing compounds will be approved for use in humans, such preparations could be used for disinfection of surfaces or sterilization of water.
In this protocol, we give a straightforward approach to solubilizing CdTe QDs with mercaptopropionic acid (MPA). The QDs are ready to use within an hour. We then demonstrate coupling to an antimicrobial agent.
The second part of the protocol demonstrates a 96-well bacterial inhibition assay using the conjugated and unconjugated QDs. The optical density is read over many hours, permitting the effects of QD addition and light exposure to be evaluated immediately as well as after a recovery period. We also illustrate a colony count for quantifying bacterial survival.

Nanoparticles such as semiconductor quantum dots (QDs) can be used to create photoactivatable agents for anti-microbial or anti-cancer applications. This technique shows how to water-solubilize cadmium telluride (CdTe) QDs, conjugate them to an antibiotic, and perform a bacterial inhibition assay based upon growth curves and plate count.

الإذابة والحيوية، من اقتران نقاط الكم وفحوصات السمية البكتيرية التي منحنى النمو والكونت بلايت

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. ...

Cell Labeling and Targeting with Superparamagnetic Iron Oxide Nanoparticles

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the target site while minimizing deleterious effects to off-target sites. Magnetic cell targeting is an efficient, safe, and straightforward delivery technique. Superparamagnetic iron oxide nanoparticles (SPION) are biodegradable, biocompatible, and can be endocytosed into cells to render them responsive to magnetic fields. The synthesis process involves creating magnetite (Fe3O4) nanoparticles followed by high-speed emulsification to form a poly(lactic-co-glycolic acid) (PLGA) coating. The PLGA-magnetite SPIONs are approximately 120 nm in diameter including the approximately 10 nm diameter magnetite core. When placed in culture medium, SPIONs are naturally endocytosed by cells and stored as small clusters within cytoplasmic endosomes. These particles impart sufficient magnetic mass to the cells to allow for targeting within magnetic fields. Numerous cell sorting and targeting applications are enabled by rendering various cell types responsive to magnetic fields. SPIONs have a variety of other biomedical applications as well including use as a medical imaging contrast agent, targeted drug or gene delivery, diagnostic assays, and generation of local hyperthermia for tumor therapy or tissue soldering.

Targeted cell delivery is useful in a variety of biomedical applications. The goal of this protocol is to use superparamagnetic iron oxide nanoparticles (SPION) to label cells and thereby enable magnetic cell targeting approaches for a high degree of control over cell delivery and localization.

وسم الخلية واستهداف مع مغنطيسية مسايرة فائقة superparamagnetic أوكسيد الحديد النانوية

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the ...

Solid Lipid Nanoparticles (SLNs) for Intracellular Targeting Applications

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter cellular signaling and gene expression. In a previous investigation, the synthesis of ultra-small solid lipid nanoparticles (SLNs) for topical drug delivery and biomarker detection applications was demonstrated. SLNs are a well-studied example of a nanoparticle delivery system that has emerged as a promising drug delivery vehicle. In this study, SLNs were loaded with a fluorescent dye and used as a model to investigate particle-cell interactions. The phase inversion temperature (PIT) method was used for the synthesis of ultra-small populations of biocompatible nanoparticles. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylphenyltetrazolium bromide (MTT) assay was utilized in order to establish appropriate dosing levels prior to the nanoparticle-cell interaction studies. Furthermore, primary human dermal fibroblasts and mouse dendritic cells were exposed to dye-loaded SLN over time and the interactions with respect to toxicity and particle uptake were characterized using fluorescence microscopy and flow cytometry. This study demonstrated that ultra-small SLNs, as a nanoparticle delivery system, are suitable for intracellular targeting of different cell types.

Solid Lipid Nanoparticles SLNs for Intracellular Targeting Applications

In this study, a method for synthesizing ultra-small populations of biocompatible nanoparticles was described, as well as several in vitro methods by which to assess their cellular interactions.

الصلبة الدهون النانوية (SLNs) لاستهداف التطبيقات بين الخلايا

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter ...

A Rapid and Quantitative Fluorimetric Method for Protein-Targeting Small Molecule Drug Screening

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold nanoclusters (Au NCs) within the drug-loaded protein, based on the differential fluorescence signal emitted by the Au NCs. Albumin proteins such as human serum albumin (HSA) and bovine serum albumin (BSA) are selected as the model proteins. Four small molecular drugs (e.g., ibuprofen, warfarin, phenytoin, and sulfanilamide) of different binding affinities to the albumin proteins are tested. It was found that the formation rate of fluorescent Au NCs inside the drug loaded albumin protein under denaturing conditions (i.e., 60 &#176;C or in the presence of urea) is slower than that formed in the pristine protein (without drugs). Moreover, the fluorescent intensity of the as-formed NCs is found to be inversely correlated to the binding affinities of these drugs to the albumin proteins. Particularly, the higher the drug-protein binding affinity, the slower the rate of Au NCs formation, and thus a lower fluorescence intensity of the resultant Au NCs is observed. The fluorescence intensity of the resultant Au NCs therefore provides a simple measure of the relative binding strength of different drugs tested. This method is also extendable to measure the specific drug-protein binding constant (KD) by simply varying the drug content preloaded in the protein at a fixed protein concentration. The measured results match well with the values obtained using other prestige but more complicated methods.

A protocol for small molecular drug screening based on in-situ synthesis of ultrasmall fluorescent gold nanoclusters (Au NCs) using drug-loaded protein as template is presented. This method is simple to determine the binding affinity of drugs to a target protein by a visible fluorescent signal emitted from the protein-templated Au NCs.

A السريع والكمية Fluorimetric طريقة لاستهداف البروتين جزيء صغير فحص المخدرات

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold ...

Correlative Light- and Electron Microscopy Using Quantum Dot Nanoparticles

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using widefield fluorescence light microscopy and transmission electron microscopy (TEM). To demonstrate the protocol we have immunolabeled ultrathin epoxy sections of human somatostatinoma tumor using a primary antibody to somatostatin, followed by a biotinylated secondary antibody and visualization with streptavidin conjugated 585 nm cadmium-selenium (CdSe) quantum dots (QDs). The sections are mounted on a TEM specimen grid then placed on a glass slide for observation by widefield fluorescence light microscopy. Light microscopy reveals 585 nm QD labeling as bright orange fluorescence forming a granular pattern within the tumor cell cytoplasm. At low to mid-range magnification by light microscopy the labeling pattern can be easily recognized and the level of non-specific or background labeling assessed. This is a critical step for subsequent interpretation of the immunolabeling pattern by TEM and evaluation of the morphological context. The same section is then blotted dry and viewed by TEM. QD probes are seen to be attached to amorphous material contained in individual secretory granules. Images are acquired from the same region of interest (ROI) seen by light microscopy for correlative analysis. Corresponding images from each modality may then be blended to overlay fluorescence data on TEM ultrastructure of the corresponding region.

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of epoxy embedded human pathology tissue. We employ commercial antibody fragment conjugated QDs that are visualized by widefield fluorescence light microscopy and transmission electron microscopy.

المتلازم الخفيفة والمجهر الإلكتروني عن طريق الكم دوت النانوية

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using ...

Initial Evaluation of Antibody-conjugates Modified with Viral-derived Peptides for Increasing Cellular Accumulation and Improving Tumor Targeting

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used in cancer treatment and imaging due to increased cellular accumulation over current ACs. During early AC in vitro development, fluorescence techniques and radioimmunoassays are sufficient for determining intracellular localization, accumulation efficiency, and target cell specificity. Currently, there is no consensus on standardized methods for preparing cells for evaluating AC intracellular accumulation and localization. The initial testing of ACs modified with virus-derived peptides is critical especially if several candidates have been constructed. Determining intracellular accumulation by fluorescence can be affected by background signal from ACs at the cell surface and complicate the interpretation of accumulation. For radioimmunoassays, typically treated cells are fractionated and the radioactivity in different cell compartments measured. However, cell lysis varies from cell to cell and often nuclear and cytoplasmic compartments are not adequately isolated. This can produce misleading data on payload delivery properties. The intravenous injection of radiolabeled virus-derived peptide-modified ACs in tumor bearing mice followed by radionuclide imaging is a powerful method for determining tumor targeting and payload delivery properties at the in vivo phase of development. However, this is a relatively recent advancement and few groups have evaluated virus-derived peptide-modified ACs in this manner. We describe the processing of treated cells to more accurately evaluate virus-derived peptide-modified AC accumulation when using confocal microscopy and radioimmunoassays. Specifically, a method for trypsinizing cells to remove cell surface bound ACs. We also provide a method for improving cellular fractionation. Lastly, this protocol provides an in vivo method using positron emission tomography (PET) for evaluating initial tumor targeting properties in tumor-bearing mice. We use the radioisotope 64Cu (t1/2 = 12.7 h) as an example payload in this protocol.

Viral-derived peptides coupled to antibody-conjugates (ACs) is an approach gaining momentum due to the potential of delivering molecular payloads with increased tumor cell accumulation. Utilizing common methods to evaluate peptide conjugation, AC and payload intracellular accumulation, and tumor targeting, this protocol helps researchers during the key initial development phases.

تعديل التقييم الأولى لجسم-يصرف مع الببتيدات المشتقة من الفيروسية لزيادة تراكم الخلوية وتحسين استهداف الورم

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used ...

20 mJ, 1 ps Yb:YAG Thin-disk Regenerative Amplifier

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with turn-key performance and microjoule-level pulse energy is used to seed the regenerative chirped-pulse amplifier. The amplifier is placed in airtight housing. It operates at room temperature and exhibits stable operation at a 5 kHz repetition rate, with a pulse-to-pulse stability less than 1%. By employing a 1.5 mm-thick beta barium borate crystal, the frequency of the laser output is doubled to 515 nm, with an average power of 70 W, which corresponds to an optical-to-optical efficiency of 70%. This superior performance makes the system an attractive pump source for optical parametric chirped-pulse amplifiers in the near-infrared and mid-infrared spectral range. Combining the turn-key performance and the superior stability of the regenerative amplifier, the system facilitates the generation of a broadband, CEP-stable seed. Providing the seed and pump of the optical parametric chirped-pulse amplification (OPCPA) from one laser source eliminates the demand of active temporal synchronization between these pulses. This work presents a detailed guide to set up and operate a Yb:YAG thin-disk regenerative amplifier, based on chirped-pulse amplification (CPA), as a pump source for an optical parametric chirped-pulse amplifier.

A protocol for the operation of a high-energy, high-power optical parametric chirped pulse amplifier pump source based on an Yb:YAG thin-disk regenerative amplifier is presented here.

20 مج، 1 بس يب: ياغ مكبر للصوت ريجينيراتيف ريسينيراتيف

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with ...

Synthesis of Monocyte-targeting Peptide Amphiphile Micelles for Imaging of Atherosclerosis

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. Atherosclerosis is also the leading cause of sudden death and myocardial infarction, instigated by unstable plaques that rupture and occlude the blood vessel without warning. Current imaging modalities cannot differentiate between stable and unstable plaques that rupture. Peptide amphiphiles micelles (PAMs) can overcome this drawback as they can be modified with a variety of targeting moieties that bind specifically to diseased tissue. Monocytes have been shown to be early markers of atherosclerosis, while large accumulation of monocytes is associated with plaques prone to rupture. Hence, nanoparticles that can target monocytes can be used to discriminate different stages of atherosclerosis. To that end, here, we describe a protocol for the preparation of monocyte-targeting PAMs (monocyte chemoattractant protein-1 (MCP-1) PAMs). MCP-1 PAMs are self-assembled through synthesis under mild conditions to form nanoparticles of 15 nm in diameter with near neutral surface charge. In vitro, PAMs were found to be biocompatible and had a high binding affinity for monocytes. The methods described herein show promise for a wide range of applications in atherosclerosis as well as other inflammatory diseases.

This paper presents a method involving the synthesis and characterization of monocyte-targeting peptide amphiphile micelles and the corresponding assays to test for biocompatibility and ability of the micelle to bind to monocytes.

توليف لاستهداف الوحيدات في المذيلات أمفيفيلي الببتيد للتصوير من تصلب الشرايين

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. ...

Synthesis of Functionalized 10-nm Polymer-coated Gold Particles for Endothelium Targeting and Drug Delivery

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting and drug delivery are some of the applications of these AuNPs, but endothelial extracellular matrices&#39; defensive properties hamper particle uptake. To address this issue, we describe a synthesis method for ultrasmall gold nanoparticles to improve vascular delivery, with customizable functional groups and polymer lengths for further adjustments. The protocol yields 2.5 nm AuNPs that are capped with tetrakis(hydroxymethyl)phosphonium chloride (THPC). The replacement of THPC with hetero-functional polyethylene glycol (PEG) on the surface of the AuNP increases the hydrodynamic radius to 10.5 nm while providing various functional groups on the surface. The last part of the protocol includes an optional addition of a fluorophore to allow the AuNPs to be visualized under fluorescence to track nanoparticle uptake. Dialysis and lyophilization were used to purify and isolate the AuNPs. These fluorescent nanoparticles can be visualized in both in vitro and in vivo experiments due to the biocompatible PEG coating and fluorescent probes. Additionally, the size range of these nanoparticles render them an ideal candidate for probing the glycocalyx without disrupting normal vasculature function, which may lead to improved delivery and therapeutics.

We describe a method of synthesizing biocompatible 10-nm gold nanoparticles, functionalized by coating poly-ethylene glycol onto the surface. These particles can be used in vitro and in vivo for delivering therapeutics to nanoscale cellular and extracellular spaces that are difficult to access with conventional nanoparticle sizes.

تركيب 10 نانومتر فونكتيوناليزيد المغلفة البوليمر جزيئات الذهب لاستهداف البطانة وإيصال الأدوية

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting ...

Targeting Neuronal Fiber Tracts for Deep Brain Stimulation Therapy Using Interactive, Patient-Specific Models

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for movement disorders and is being applied to a growing number of disorders. Computational modeling has been successfully used to predict the clinical effects of DBS; however, there is a need for novel modeling techniques to keep pace with the growing complexity of DBS devices. These models also need to generate predictions quickly and accurately. The goal of this project is to develop an image processing pipeline to incorporate structural magnetic resonance imaging (MRI) and diffusion weighted imaging (DWI) into an interactive, patient specific model to simulate the effects of DBS. A virtual DBS lead can be placed inside of the patient model, along with active contacts and stimulation settings, where changes in lead position or orientation generate a new finite element mesh and solution of the bioelectric field problem in near real-time, a timespan of approximately 10 seconds. This system also enables the simulation of multiple leads in close proximity to allow for current steering by varying anodes and cathodes on different leads. The techniques presented in this paper reduce the burden of generating and using computational models while providing meaningful feedback about the effects of electrode position, electrode design, and stimulation configurations to researchers or clinicians who may not be modeling experts.

The goal of this project is to develop an interactive, patient-specific modeling pipeline to simulate the effects of deep brain stimulation in near real-time and provide meaningful feedback as to how these devices influence neural activity in the brain.

استهداف مساحات الألياف العصبية للعلاج تحفيز الدماغ العميق باستخدام نماذج تفاعلية، والخاصة بالمريض

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for ...