Funding provided by DOD W81XWH-10-1-1023 (Z.J.G.), grant P50 GM081879 from the UCSF Center for Systems and Synthetic Biology (Z.J.G.), NIH 5R21EB015088-02 (Y.J.) and NIH 1R21EB018044 (Z.J.G. &#38; Y.J.). D.S. was supported by Human Frontier Science Program Cross- disciplinary postdoc research fellowship.

1. Production of Monovalent Quantum Dots
<ol>
	<li>Phase transfer of QDs from organic to aqueous phase
	<ol>
		<li>Dilute 200 &#181;l of a 1 &#181;M solution of organic phase QDs with 400 &#181;l of chloroform in a 5 ml glass vial.</li>
		<li>Mix 400 &#181;l of a 0.3 M tetrabutylammonium bromide (TBAB) chloroform solution with 36 &#181;l of neat mPEG thiol (CH3O(CH2CH2O)6C2H5SH) and shake O/N.</li>
		<li>Add 800 &#181;l of a 0.2 M NaOH aqueous solution and shake for 30 sec. A phase transfer occurs within a few minutes, indicated by the transfer of the colored particles to the aqueous phase above the denser organic phase.</li>
		<li>If the particles aggregate in a third phase between the aqueous and organic phases, increase the incubation time with the mPEG thiol. If the aqueous phase remains clear, the QDs did not phase transfer (see Figure 3A). Alternately, increase the concentration of mPEG thiol in step 2 to alleviate poor phase transfer.</li>
		<li>Recover the (colored) aqueous phase and then concentrate the collected QDs with a Centricon spin column (30 kDa molecular weight cut-off) to 1 ml.</li>
		<li>Add the concentrated QD solution into a Sephadex NAP10 column pre-equilibrated with 10 mM Tris buffer containing 30 mM NaCl (pH 8.0). Elute the QDs with 1.5 ml of elution buffer by gravity flow.</li>
		<li>Measure the concentration of QDs with absorption spectroscopy at 350 nm.</li>
	</ol>
	</li>
	<li>Preparation of mQDs
	<ol>
		<li>Purchase (or synthesize) ptDNA. This protocol uses the sequence 5&#8217;-AS50(CT)10(ACTG)5 -3&#8217; (see Table 1).</li>
	</ol>
	</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>DNA</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>5&#8217;-AS50(CT)10(ACTG)5-3&#39;</td>
			<td>ASASASASASASASASASASASASASASASAS 
			ASASASASASASASAS ASASASASASASASASAS 
			ASASASASASASASASASASASASASASASASAS 
			CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG</td>
		</tr>
		<tr>
			<td>5&#8217;-NH2-(CT)10(CAGT)5-3&#39;</td>
			<td>NH2-/C6spacer/ CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT</td>
		</tr>
		<tr>
			<td>BG-DNA</td>
			<td>BG-/C6spacer/ CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT</td>
		</tr>
	</tbody>
</table>
Table 1. DNA sequences used to produce and target mQDs.
<ol start="2" style="margin-left: 40px;">
	<li>Prepare 1 ml of 100 nM QD solution in 10 mM Tris buffer containing 30 mM NaCl (pH 8).</li>
	<li>Add drop wise 500 &#181;l of the 100 nM ptDNA solution to the aqueous QDs for 1 min while vigorously stirring. Stir or place on a shaker for an additional 9 hr. 
	Note: This should theoretically produce a 1:2 ratio of ptDNA:QD. However, the actual stoichiometry is never perfect &#8212; usually the result is closer to 1:1.5. In order to produce a 1:1 ratio of ptDNA:QD, densitometry after gel electrophoresis is necessary to quantify the exact ratio of conjugation given the known volumes used above.</li>
	<li>Remove ~10 &#181;l of the QD mixture to run on an analytical agarose gel. Also remove a similar concentration of unconjugated QDs in aqueous phase (from step 1.2.1).
	<ol>
		<li>Add ~2 &#181;l of 6x Ficoll loading buffer (to increase solution density) and run these two samples together on a 0.8% wt/v agarose gel in sodium borate buffer for 15 min at 150 V. A single band in the unconjugated control lane migrating close to the well, and two bands in the lane with conjugated QDs are seen (see gels in Figure 2B).</li>
	</ol>
	</li>
	<li>Calculate the unconjugated QD fraction using the relative intensity of the two bands (see the equation in Figure 2B). Then use that fraction to calculate the additional volume of 100 nM ptDNA solution required to match the number of QDs.</li>
	<li>Repeat steps 1.2.3 to 1.2.5 once more with this calculated volume or until the conjugated QDs collapse into a single band on the gel indicating complete conjugation of all QDs.</li>
	<li>Add 100 &#181;l of 10 mM (CO2H)CH2O(CH2CH2O)6C11H23SH (carboxy PEG6 alkane thiol) in 10 mM Tris buffer containing 30 mM NaCl (pH 8) to the conjugated mQDs produced above, and shake for 10 min. 
	Note: These PEG ligands passivate the QD surface. A longer PEG will better-passivate the QDs, however, it will also increase their size. The hydrophobic alkane thiol functionality has a much higher affinity for the QDs, in aggregate, than the less hydrophobic PEG-thiol used for phase transfer. Therefore, do not allow this step to proceed too long or the ptDNA will be replaced by the alkane-PEG-thiol. After a ~30 min incubation, a significant fraction of DNA will have been displaced from the QDs (Figure 3B).</li>
	<li>To remove excess alkane PEG-thiol, add 0.5 ml of the QD solution to a sephadex NAP5 column pre-equilibrated with elution buffer (10 mM Tris buffer containing 30 mM NaCl). Collect the mQDs with 1.0 ml of elution buffer by gravity flow.</li>
	<li>Concentrate the collected QDs with a Centricon spin column (30 kDa). Store these mQDs at 4 &#176;C for months. Do not freeze them. 
	Note: If a colored pellet in the bottom of the tube is seen, the dots have aggregated and are likely no longer useable.</li>
</ol>
2. Production of Targeting (Benzylguanine-) DNA
<ol>
	<li>Produce or purchase amine-terminated DNA. This protocol uses the sequence 5&#8217;-NH2-(CT)10-(CAGT)5-3&#8217; (see Table 1). The poly-CT linker increases accessibility to functionality buried deep in the glycocalyx but may not be needed for all applications. If there is access to a DNA synthesizer, produce amino-modified DNA using an appropriate 5&#8217; amino-modifier (5&#8217; amino-modifier C6).</li>
	<li>Dissolve BG-N-hydroxysuccinimide (BG-NHS) in dry dimethyl sulfoxide (DMSO) at a concentration of 10 mg/ml. 
	Note: BG-NHS will absorb water from the air and lead to hydrolysis of the reactive NHS-ester, particularly in hydroscopic solvents like DMSO and dimethylformamide (DMF). BG-NHS is best stored at -80 &#176;C as a powder in its own vial within a secondary container containing desiccant. Warm to RT before opening the vial. Alternately, immediately aliquot for single use the BG-NHS ester into a dry polar solvent and freeze at -80 &#176;C, or react fully with the amine DNA in step 2.2.</li>
	<li>React by mixing the BG-NHS in DMSO from step 2.1 with amine-terminated DNA in HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) buffered (pH 8.5) water. In a typical react 20 &#181;l of 10 mg/ml BG-NHS in DMSO with 2 &#181;l of 2 mM NH2-(CT)10-(CAGT)5 in 58 &#181;l deionized water buffered with 20 &#181;l 0.5 M HEPES pH 8.5. Carry out reactions in a 1.5 ml microcentrifuge tube. Mix quickly as the reaction proceeds rapidly and must compete with NHS-ester hydrolysis.</li>
	<li>Sonicate for 5&#8211;10 min to ensure thorough mixing. Incubate ~1 hr at RT. The stoichiometric ratio of BG:DNA can be altered to drive the reaction to completion.</li>
	<li>Desalt the reaction using a standard NAP5 column into 100 mM triethylamine acetate (TEAA, pH 7).</li>
	<li>Purify the BG-DNA from the unreacted amine-DNA by reversed-phase HPLC running a 100 mM TEAA:acetonitrile (ACN) gradient between 8% and 95% acetonitrile over 30 min. The unreacted amine-DNA will elute before the BG-DNA. Collect the BG-DNA fraction in a conical tube.
	<ol>
		<li>Use a C18 Zorbax column for standard oligonucleotide purification and the following gradient: 
		0&#8594;15 min: 8&#8594;30% ACN; 
		15&#8594;21 min: 30&#8211;90% ACN; 
		21&#8594;25 min: 90&#8594;8% ACN; 
		25&#8594;30 min: 8% ACN;</li>
	</ol>
	</li>
	<li>Freeze in liquid nitrogen and lyophilize the collected fraction. Resuspend the DNA in deionized water. To be extra careful, lyophilize two more times to remove residual TEAA. Residual TEAA can be toxic to cells at higher concentrations.</li>
	<li>Resuspend the lyophilized BG-DNA in water, making sure to wash the sides of the tube, and dilute to ~25 &#181;M stock. Aliquot and store at 4 &#176;C. Samples were stored for ~9 months without noticeable degradation.</li>
</ol>
3. Labeling Live Cells with Monovalent Quantum Dots
<ol>
	<li>Optionally, passivate the mQDs just prior to an imaging experiment using reagents such as casein (0.5%) or bovine serum albumin (BSA, 1&#8211;3%).</li>
	<li>Plate cells expressing the SNAP-tagged protein on total internal reflection fluorescence (TIRF)-quality glass. In this experiment, we use a U2OS cell line expressing a SNAP-tagged Notch1 receptor and high quality glass surfaces.</li>
	<li>After the cells have attached to the glass (~24 hr), remove growth media, wash with PBS, and incubate the cells for 10&#8211;30 min at RT in ~100&#8211;150 &#181;l of PBS or cell media containing ~1 &#181;M BG-DNA from step 2.6 above.</li>
	<li>After incubation with BG, carefully wash the cells with PBS or cell media. Incubate the cells for ~5&#8211;10 min with the mQDs produced in step 1.2.9 (and optionally passivated in step 3.1).</li>
	<li>Optionally, wash the unbound mQDs and return the cells to a buffer/media suitable for both imaging and culture. For cells that were to be imaged in TIRF mode, a final wash step was often unnecessary as unbound mQDs in solution diffused so rapidly compared with bound mQDs as to be undetectable during analysis.</li>
</ol>
4. Microscopy &#38; Analysis
<ol>
	<li>Image the cells using a TIRF microscope. 
	Note: The scope must have separable excitation and emission filters, or a custom QD filter cube. QDs are best excited with a low-wavelength laser (405 or 488 nm). QDs of different diameter have characteristic emission wavelengths, typically associated with a large Stoke&#8217;s shift.</li>
	<li>Because of the brightness of mQDs, collect images at high frame rates in TIRF while imaging the basal side of a live cell. 
	Note: Alternatively, single-molecule dynamics can be followed at other focal planes using a spinning disk confocal microscope. Automated single-particle tracking software is generally successful at accurately tracking the bright and photostable mQDs.</li>
</ol>

<ol>
	<li>Sako, Y., Minoghchi, S., Yanagida, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+imaging+of+EGFR+signaling+on+the+surface+of+living+cells.">Single-molecule imaging of EGFR signaling on the surface of living cells.</a> Nature Cell Biology. 2 (3), 168-172 (2000).</li><li>Luo, W., He, K., Xia, T., Fang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+monitoring+in+living+cells+by+use+of+fluorescence+microscopy.">Single-molecule monitoring in living cells by use of fluorescence microscopy.</a> Analytical and Bioanalytical Chemistry. 405 (1), 43-49 (2013).</li><li>Chung, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+control+of+EGF+receptor+activation+by+reversible+dimerization+on+living+cells.">Spatial control of EGF receptor activation by reversible dimerization on living cells.</a> Nature. 464 (7289), 783-787 (2010).</li><li>Fern&#225;ndez-Su&#225;rez, M., Ting, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+probes+for+super-resolution+imaging+in+living+cells.">Fluorescent probes for super-resolution imaging in living cells.</a> Nature Reviews Molecular Cell Biology. 9 (12), 929-943 (2008).</li><li>Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photooxidation+and+photobleaching+of+single+CdSe/ZnS+quantum+dots+probed+by+room-temperature+time-resolved+spectroscopy.">Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy.</a> The Journal of Physical Chemistry B. 105 (35), 8281-8284 (2001).</li><li>Pinaud, F., Clarke, S., Sittner, A., Dahan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+cellular+events,+one+quantum+dot+at+a+time.">Probing cellular events, one quantum dot at a time.</a> Nature Methods. 7 (4), 275-285 (2010).</li><li>Michalet, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantum+dots+for+live+cells,+in+vivo+imaging,+and+diagnostics.">Quantum dots for live cells, in vivo imaging, and diagnostics.</a> Science. 307 (5709), 538-544 (2005).</li><li>Howarth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monovalent,+reduced-size+quantum+dots+for+imaging+receptors+on+living+cells.">Monovalent, reduced-size quantum dots for imaging receptors on living cells.</a> Nature Methods. 5 (5), 397-399 (2008).</li><li>Iyer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aromatic+aldehyde+and+hydrazine+activated+peptide+coated+quantum+dots+for+easy+bioconjugation+and+live+cell+imaging.">Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging.</a> Bioconjugate Chemistry. 22 (6), 1006-1011 (2011).</li><li>Tikhomirov, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+programming+of+quantum+dot+valency,+self-assembly+and+luminescence.">DNA-based programming of quantum dot valency, self-assembly and luminescence.</a> Nature Nanotechnology. 6 (8), 485-490 (2011).</li><li>Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+targeted+monovalent+quantum+dots+by+steric+exclusion.">Formation of targeted monovalent quantum dots by steric exclusion.</a> Nature Methods. 10 (12), 1203-1205 (2013).</li><li>Gartner, Z. J., Bertozzi, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmed+assembly+of+3-dimensional+microtissues+with+defined+cellular+connectivity.">Programmed assembly of 3-dimensional microtissues with defined cellular connectivity.</a> Proceeding of the National Academy of Sciences USA. 106 (12), 4606-4610 (2009).</li><li>Selden, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+programmed+cell+adhesion+with+membrane-anchored+oligonucleotides.">Chemically programmed cell adhesion with membrane-anchored oligonucleotides.</a> Journal of the American Chemical Society. 134 (2), 765-768 (2012).</li></ol>

The authors have nothing to disclose.

The modularity of the mQD design enables an increased degree of experimental flexibility. For example, a variety of mQDs can be quickly prepared in unique colors allowing for the simultaneous imaging of multiple targets. The ssDNA targeting sequence can direct mQDs to proteins, sugars12, lipids and surfaces13. A number of enzymatic tags are available with orthogonal reactivities, allowing multiple targets to be imaged simultaneously with differentially targeted mQDs. In addition to targeting with the SNAP tag, labeling of target proteins with mQDs using the CLIP tag, the HALO tag, and biotinylated proteins was also successful. This protocol demonstrates the specific labeling of a surface receptor on live cells with these mQDs, but the protocol could easily be adapted to a number of different contexts.
The significant methodological insight in producing mQDs with defined valency is that ~50 phosphorothioate-linked bases are required to wrap the QDs (and thus prevent two molecules from binding simultaneously). A poly-AS50 sequence reproducibly and stably bound 605 nm QDs from Life Technologies. Although this product has been discontinued, the steric exclusion strategy is generalizable to similar products from other vendors having different sizes, shapes, spectral properties.
The efficiency and stability of ptDNA-wrapped QDs depends critically on the surface chemistry and structure of the QDs. Therefore, the success of a protocol will depend upon the commercial source and chemical structure of the QDs. For the purposes of this protocol, three major points of difference exist between various commercial sources of QDs: a difference in conditions necessary for phase transfer; a difference in the strength of initial PEG-thiol-ligand binding, possibly hindering displacement by the ptDNA; and a difference in the amount of exposed CdSe core, which can lead to the quenching of the QD by the mPEG thiol phase transfer conditions.
As of publication, QDs with the best structure for production of mQDs are 4&#8211;10 nm CdSe/ZnS core/shell QDs purchased from Life Technologies with emission spectra at 545, 585, 605 &#38; 625 nm (Figure 2A). QDs based upon the &#8216;Vivid&#8217; formulation (545, 605, etc.) quench upon addition of mPEG thiol and are not suitable for this application. QDs from Aldrich and Ocean Nanotech work well, but require longer phase transfer steps and pretreatment with trioctylphosphine oxide. This protocol has been optimized for QDs from Life Technologies.
The poly-A phosphorothioate sequence used to wrap the QDs is terminated with a native 20-mer DNA tail containing the sequence of (ACTG)5 to which a targeting strand may hybridize. This sequence is convenient, as it has little to no secondary structure, and will remain hybridized at 37 &#176;C in PBS. If there is access to a DNA synthesizer, the ptDNA can by synthesized and then purified by reverse phase high performance liquid chromatography (HPLC) using a C8 column. The ptDNA will elute later on the HPLC than equivalent oligonucleotides with a native backbone. We typically leave the 5&#8217; DMT protecting group on our phosphorothioate oligonucleotides after purification.
Passivation of the ptDNA-wrapped QDs is usually required in order to improve colloidal stability of QDs and reduce background binding for most experimental applications. The protocol uses a PEG-layer to passivate the QDs. Carboxy PEG alkane thiol with additional PEG units ((CO2H)CH2O(CH2CH2O)12C11H23SH, carboxy-PEG12 alkane thiol) provides significantly reduced background, though the longer PEGs are both larger, and generally more expensive. mQDs coated with carboxy PEG alkane thiol ligands are highly stable in physiological buffers such as phosphate buffered salines and culture media. Long-term storage (&#62; 8 months) of mQDs at 4 &#176;C showed no significant aggregation or ptDNA detachment11. Depending upon the experiment, PEG passivation of the QDs alone does not always sufficiently reduce non-specific binding of the mQDs. Incubating both cells and mQDs in phosphate buffered saline (PBS) containing 3% BSA for 20 min prior to use substantially reduces non-specific binding to cells, though it does increase the apparent hydrodynamic radius of the mQDs by ~50%. Passivation with 0.5% casein reduces the non-specific binding even further but it increases the apparent size to a greater extent than BSA.
The 5&#8217; end of a DNA strand complementary to the mQDs can be modified to enable targeting of a number of different biomolecules. There are a number of established techniques available to covalently modify proteins, lipids &#38; sugars with single stranded DNA (ssDNA). So long as the ssDNA is presented extracellularly, it is accessible to soluble mQDs. mQDs with the above sequences will rapidly hybridize with their complementary DNA strand under cell culture conditions. A 10&#8211;20x poly-(CT) spacer between the ptDNA and the targeting sequence may be required for efficient targeting so as to elevate the binding sequence above the thick and negatively charged glycocalyx of the cell. For this protocol we chose to produce a BG-DNA with a complementary sequence of (CAGT)5 that will both hybridized to the mQDs and covalently link itself to a SNAP-tag protein for rapid and specific labeling. A similar protocol functions well for coupling other NHS-esters to amino-modified oligonucleotides.
For single-molecule imaging, a low density of labeling is typically required to resolve individual molecules. A final mQD concentration of ~0.5 nM in PBS with passivating agent is a good target. However, these high dilutions sometimes resulted in under-labeling of the cells. If this occurs, additional mQD can be added until an optimal density of labeling is observed. In the case of SNAP-tagged human Notch1, concentrations of &#62;10 nM mQD produced dense labeling cells while 0.5 nM mQD resulted in the attachment of ~20 mQDs at the basal surface of targeted cell (see Figure 4B). Cell labeling with mQDs was highly dependent of the confluency of plated cells. Overly confluent cells do not label at their basal surfaces.
In summary, a simple method to generate monovalent and modular QDs was described. These mQDs find utility in wide range of live cell imaging applications, as demonstrated by imaging the Notch receptor on live U2OS cells. Applicability of mQDs is not limited to this specific case, but can be potentially extended for other cellular targets such as other proteins, nucleic acids, and enzymes.

The dynamics of single molecules on live cells contributes to their biological function. Single molecule fluorescence imaging is a popular method to study single molecule dynamics on the cell surface1,2,3. However, the most commonly used imaging probes in these studies have several important disadvantages. For example, conventional organic dyes and fluorescent proteins provide moderate brightness, about 105&#8211;106 M-1 cm-1, but are photochemically unstable, bleaching after the emission of about 105&#8211;106 photons under typical live-cell imaging conditions4,5. In contrast, semiconductor nanoparticles, frequently called quantum dots (QDs), are significantly brighter and more stable, with extinction coefficients in the range of 106&#8211;107 M-1 cm-1 and exceeding 107&#8211;108 emitted photons before photobleaching5. The improved brightness and photostability of QDs over organic fluorophores enables the observation of single molecules at significantly faster frame rates and over much longer trajectories6.
Despite their advantages and commercial availability, several liabilities remain for these powerful imaging agents. First, they have poorly defined targeting valency, which may result in crosslinking of targeted biomolecules6. Second, they generally have a large hydrodynamic size (&#62; 20 nm) that limits accessibility to certain crowded cellular environments7. Third, they have limited targeting modularity7. Several strategies have attempted to address these problems8,9,10, but generally require specialized knowledge and reagents to implement.
To address these problems, we recently reported a &#8220;Steric Exclusion&#8221; strategy for preparing monovalent, small, and modular QDs11. The QDs are wrapped with a single long phosphorothioate DNA (ptDNA) polymer. The ptDNA binds to the QD surface through multiple Zn-S interactions between surface-exposed Zn atoms and the phosphorothioate groups of the ptDNA polymer. A single bound polymer sterically and electrostatically excludes the binding of additional equivalents of the polymer without significantly increasing the particle&#8217;s overall size (about 2 nm). All reagents are commercially available, products are formed in high yield, and the process requires only desalting steps for purification. Once labeled, QDs wrapped with a single ptDNA (mQDs) bind to complementary DNA strands bearing targeting domains (e.g., benzylguanine (BG), benzylcytosine, or alkylhalides).
These functionalities target the mQDs specifically to enzymatic tags such as SNAP, CLIP &#38; HALO that are genetically fused to the protein of interest. This is a protocol for the synthesis, targeting, and live-cell imaging of mQDs produced by steric exclusion.

<table border="0" cellpadding="0" cellspacing="0" width="497">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:91px;">Comments/Description</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">mQD Production:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Phosphorothioate DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(A*)x50-(ACTG)x5</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Quantum Dots:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="127">
			<td height="127" style="height:127px;width:216px;">QDots 525, 585, 605 &#38; 625</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">Q21791MP (545), Q21711MP (585), Q21701MP (605)</td>
			<td style="width:91px;">Custom QD synthesis for QD625.</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">QD610</td>
			<td style="width:71px;">Ocean Nanotech</td>
			<td style="width:119px;">QSP-610-10&#160;</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">QD 610 lamda</td>
			<td style="width:71px;">Aldrich</td>
			<td style="width:119px;">731854</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Chloroform, 99.8%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">67-66-3</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Tetrabutylammonium bromide, 98.0%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">426288</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95%</td>
			<td style="width:71px;">Polypure</td>
			<td style="width:119px;">11156-0695</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:216px;">HSC11EG6CO2H&#160; [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H]</td>
			<td style="width:71px;">ProChimia</td>
			<td style="width:119px;">TH 003-m11.n6-0.1</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Boric Acid, 99.5%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">B0394</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Sodium Hydroxide, 99.0%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">S/4845</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Sodium Chloride, 98%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">310166</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Agarose LE</td>
			<td style="width:71px;">U.S. Biotech Sources</td>
			<td style="width:119px;">G02PD-125</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Ethanol</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">459828</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">BG-DNA Production:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Amine DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5(T)40-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">NHS-GLA-Benzylguanine</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">S9151</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">DMSO</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D8428</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">HEPES Buffer</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">83264</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">NAP5 Column</td>
			<td style="width:71px;">GE Healthcare</td>
			<td style="width:119px;">17-0853-01</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">C18 Column</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Acetonitrile</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">Mammalian Cell Culture &#38; Imaging:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Cell line expressing SNAP-tagged protein</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">E9100S</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">McCoys 5A</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">PBS</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Nunc Lab-tek II Chambered Coverglass</td>
			<td style="width:71px;">Thermo-Fischer Scientific</td>
			<td style="width:119px;">155409</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Matriplate 96-well plate</td>
			<td style="width:71px;">Brooks Life Science Systems</td>
			<td style="width:119px;">MGB096-1-2-LG-L</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">BSA</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">5% Alkali-soluble Casein</td>
			<td style="width:71px;">EMD Millipore</td>
			<td style="width:119px;">70955</td>
			<td style="width:91px;">Not all caseins are the same</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">(Optional) DNA Synthesis Reagents:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">5&#8217; Amine modifier C6</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">Oct-06</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">dA-Thiophosphoramidite</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">10-700</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Analysis Software:</td>
			<td></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">FIJI</td>
			<td colspan="3">http://valelab.ucsf.edu/~schindelin/</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">RyTrack.pro</td>
			<td colspan="3">http://sun.iwu.edu/~gspaldin/rytrack.html</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Tracker</td>
			<td colspan="3">http://www.gartnerlab.ucsf.edu/more/software</td>
		</tr>
	</tbody>
</table>

production and targeting of monovalent quantum dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in biology, where clustering and the spatial organization of biomolecules is often the object of study. We describe here a protocol to produce monovalent quantum dots (mQDs) that can be accomplished in most biological research laboratories via a simple mixing of CdSe/ZnS core/shell QDs with phosphorothioate DNA (ptDNA) of defined length. After a single ptDNA strand has wrapped the QD, additional strands are excluded from the surface. Production of mQDs in this manner can be accomplished at small and large scale, with commercial reagents, and in minimal steps. These mQDs can be specifically directed to biological targets by hybridization to a complementary single stranded targeting DNA. We demonstrate the use of these mQDs as imaging probes by labeling SNAP-tagged Notch receptors on live mammalian cells, targeted by mQDs bearing a benzylguanine moiety.

The phase transfer of the QDs from an organic to an aqueous phase is critical for the production of mQDs, but can be both condition- and QD-specific. Phase transfer in section 1.1 should appear as clean as the first two vials in Figure 3. If transfer appears more like vial 3, then one should try again with different conditions.
Once the QDs are coated with the negatively-charged DNA they should migrate on a gel separately from the non-wrapped QDs. Using an aliquot of unwrapped QDs as a control, a second, faster-migrating band should appear upon addition of the ptDNA, as seen in the first gel in Figure 2B. Complete formation of mQDs is demonstrated with the loss of the immobile band, and its collapse into the mobile band as seen in the last gel in Figure 2B. If an aliquot of your mQD product migrates as a single band separable from the unwrapped QDs, then your mQDs are monovalent and ready to be used in further steps.
Cell labeling should be specific to the target of your choice and should be dependent on protein expression levels and mQD concentration. Empirical optimization of both mQD concentration and mQD passivation is often required for any given application. Figure 4B demonstrates the labeling of U2OS cells expressing a SNAP-tagged Notch receptor with mQDs ranging in concentration from 0.5 nM to 10 nM.
<img fo:content-width="6in" width="600" alt="Figure 1" src="/files/ftp_upload/52198/52198fig1highres.jpg" /> 
Figure 1.&#160;Modular targeting of mQDs. mQDs hybridize to ssDNA functionalized by various targeting molecules. Benzylguanine-linked DNA targets mQDs to SNAP-tagged fusion proteins. Other 5&#8217; modifications and DNA sequences enable the targeting of mQDs to a variety of other biomolecules. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig1highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img fo:content-width="6in" width="600" alt="Figure 2" src="/files/ftp_upload/52198/52198fig2highres.jpg" /> 
Figure 2. Scheme for production of mQDs. (A) Organic-phase QDs are transferred to the aqueous phase by treatment with mPEG thiol and TBAB, wrapped with ptDNA, and passivated with carboxy PEG6 alkane thiol. Representative TEM images are organic QD545, QD585, and QD605, respectively. (B) A method for empirically determining the stoichiometry of interaction between QDs and ptDNA in step two above. QD &#38; ptDNA stoichiometries are empirically verified by densitometry such that the final reaction stoichiometry is 1:1 (QD:ptDNA). The initial number of moles of ptDNA is multiplied by the ratio of QD:mQD, and adjusted by the actual volume after conjugation to yield the number of moles required to achieve 1:1 conjugation. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig2highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img fo:content-width="6in" width="600" alt="Figure 3" src="/files/ftp_upload/52198/52198fig3highres.jpg" /> 
	Figure 3. Experimental details for production of mQDs. (A) Representative photos of successful and failed phase transfer. QDs should visually transfer between the dense organic phase and the less-dense aqueous phase. Incomplete phase separation indicates poor transfer. (B) ptDNA can be replaced by the alkane-PEG-thiol. Right gel data is representative of a reaction where a significant fraction of ptDNA have been displaced from the QDs due to over-passivation. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig3highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img fo:content-width="6in" width="600" alt="Figure 4" src="/files/ftp_upload/52198/52198fig4highres.jpg" /> 
Figure 4. Labeling SNAP-tagged proteins on live cells. (A) Schematic demonstrating the expression, attachment and labeling of a SNAP-tagged receptor with a BG-targeted mQD. (B) Representative labeling of cells expressing a SNAP-Notch-mCherry construct at various mQD concentrations. mQDs passivated with PEG12 colocalize with mCherry indicating specific labeling. Lower labeling densities (&#60;0.5 nM) are generally preferable for single particle tracking. Scale bar is 10 &#956;m. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig4highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Production and Targeting of Monovalent Quantum Dots at JoVE.com

Production and Targeting of Monovalent Quantum Dots

We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications.

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in ...

production-and-targeting-of-monovalent-quantum-dots

Research

JoVE Journal

Bioengineering

25.4K Views.  University of California, San Francisco. We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications. 

Video: Production and Targeting of Monovalent Quantum Dots

Solubilization and Bio-conjugation of Quantum Dots and Bacterial Toxicity Assays by Growth Curve and Plate Count

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. QDs have attracted a lot of interest for imaging, diagnostics, and therapy due to their bright, stable fluorescence1,2 3,4,5. QDs can be conjugated to a variety of bio-active molecules for binding to bacteria and mammalian cells6.
QDs are also being widely investigated as cytotoxic agents for targeted killing of bacteria. The emergence of multiply-resistant bacterial strains is rapidly becoming a public health crisis, particularly in the case of Gram negative pathogens 7. Because of the well-known antimicrobial effect of certain nanomaterials, especially Ag, there are hundreds of studies examining the toxicity of nanoparticles to bacteria 8. Bacterial studies have been performed with other types of semiconductor nanoparticles as well, especially TiO2 9,10-11, but also ZnO12 and others including CuO 13. Some comparisons of bacterial strains have been performed in these studies, usually comparing a Gram negative strain with a Gram positive. With all of these particles, mechanisms of toxicity are attributed to oxidation: either the photogeneration of reactive oxygen species (ROS) by the particles or the direct release of metal ions that can cause oxidative toxicity. Even with these materials, results of different studies vary greatly. In some studies the Gram positive test strain is reportedly more sensitive than the Gram negative 10; in others it is the opposite 14. These studies have been well reviewed 15.
In all nanoparticle studies, particle composition, size, surface chemistry, sample aging/breakdown, and wavelength, power, and duration of light exposure can all dramatically affect the results. In addition, synthesis byproducts and solvents must be considered16 17. High-throughput screening techniques are needed to be able to develop effective new nanomedicine agents.
CdTe QDs have anti-microbial effects alone18 or in combination with antibiotics. In a previous study, we showed that coupling of antibiotics to CdTe can increase toxicity to bacteria but decrease toxicity to mammalian cells, due to decreased production of reactive oxygen species from the conjugates19. Although it is unlikely that cadmium-containing compounds will be approved for use in humans, such preparations could be used for disinfection of surfaces or sterilization of water.
In this protocol, we give a straightforward approach to solubilizing CdTe QDs with mercaptopropionic acid (MPA). The QDs are ready to use within an hour. We then demonstrate coupling to an antimicrobial agent.
The second part of the protocol demonstrates a 96-well bacterial inhibition assay using the conjugated and unconjugated QDs. The optical density is read over many hours, permitting the effects of QD addition and light exposure to be evaluated immediately as well as after a recovery period. We also illustrate a colony count for quantifying bacterial survival.

Nanoparticles such as semiconductor quantum dots (QDs) can be used to create photoactivatable agents for anti-microbial or anti-cancer applications. This technique shows how to water-solubilize cadmium telluride (CdTe) QDs, conjugate them to an antibiotic, and perform a bacterial inhibition assay based upon growth curves and plate count.

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. ...

Cell Labeling and Targeting with Superparamagnetic Iron Oxide Nanoparticles

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the target site while minimizing deleterious effects to off-target sites. Magnetic cell targeting is an efficient, safe, and straightforward delivery technique. Superparamagnetic iron oxide nanoparticles (SPION) are biodegradable, biocompatible, and can be endocytosed into cells to render them responsive to magnetic fields. The synthesis process involves creating magnetite (Fe3O4) nanoparticles followed by high-speed emulsification to form a poly(lactic-co-glycolic acid) (PLGA) coating. The PLGA-magnetite SPIONs are approximately 120 nm in diameter including the approximately 10 nm diameter magnetite core. When placed in culture medium, SPIONs are naturally endocytosed by cells and stored as small clusters within cytoplasmic endosomes. These particles impart sufficient magnetic mass to the cells to allow for targeting within magnetic fields. Numerous cell sorting and targeting applications are enabled by rendering various cell types responsive to magnetic fields. SPIONs have a variety of other biomedical applications as well including use as a medical imaging contrast agent, targeted drug or gene delivery, diagnostic assays, and generation of local hyperthermia for tumor therapy or tissue soldering.

Targeted cell delivery is useful in a variety of biomedical applications. The goal of this protocol is to use superparamagnetic iron oxide nanoparticles (SPION) to label cells and thereby enable magnetic cell targeting approaches for a high degree of control over cell delivery and localization.

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the ...

Solid Lipid Nanoparticles (SLNs) for Intracellular Targeting Applications

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter cellular signaling and gene expression. In a previous investigation, the synthesis of ultra-small solid lipid nanoparticles (SLNs) for topical drug delivery and biomarker detection applications was demonstrated. SLNs are a well-studied example of a nanoparticle delivery system that has emerged as a promising drug delivery vehicle. In this study, SLNs were loaded with a fluorescent dye and used as a model to investigate particle-cell interactions. The phase inversion temperature (PIT) method was used for the synthesis of ultra-small populations of biocompatible nanoparticles. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylphenyltetrazolium bromide (MTT) assay was utilized in order to establish appropriate dosing levels prior to the nanoparticle-cell interaction studies. Furthermore, primary human dermal fibroblasts and mouse dendritic cells were exposed to dye-loaded SLN over time and the interactions with respect to toxicity and particle uptake were characterized using fluorescence microscopy and flow cytometry. This study demonstrated that ultra-small SLNs, as a nanoparticle delivery system, are suitable for intracellular targeting of different cell types.

Solid Lipid Nanoparticles SLNs for Intracellular Targeting Applications

In this study, a method for synthesizing ultra-small populations of biocompatible nanoparticles was described, as well as several in vitro methods by which to assess their cellular interactions.

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter ...

A Rapid and Quantitative Fluorimetric Method for Protein-Targeting Small Molecule Drug Screening

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold nanoclusters (Au NCs) within the drug-loaded protein, based on the differential fluorescence signal emitted by the Au NCs. Albumin proteins such as human serum albumin (HSA) and bovine serum albumin (BSA) are selected as the model proteins. Four small molecular drugs (e.g., ibuprofen, warfarin, phenytoin, and sulfanilamide) of different binding affinities to the albumin proteins are tested. It was found that the formation rate of fluorescent Au NCs inside the drug loaded albumin protein under denaturing conditions (i.e., 60 &#176;C or in the presence of urea) is slower than that formed in the pristine protein (without drugs). Moreover, the fluorescent intensity of the as-formed NCs is found to be inversely correlated to the binding affinities of these drugs to the albumin proteins. Particularly, the higher the drug-protein binding affinity, the slower the rate of Au NCs formation, and thus a lower fluorescence intensity of the resultant Au NCs is observed. The fluorescence intensity of the resultant Au NCs therefore provides a simple measure of the relative binding strength of different drugs tested. This method is also extendable to measure the specific drug-protein binding constant (KD) by simply varying the drug content preloaded in the protein at a fixed protein concentration. The measured results match well with the values obtained using other prestige but more complicated methods.

A protocol for small molecular drug screening based on in-situ synthesis of ultrasmall fluorescent gold nanoclusters (Au NCs) using drug-loaded protein as template is presented. This method is simple to determine the binding affinity of drugs to a target protein by a visible fluorescent signal emitted from the protein-templated Au NCs.

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold ...

Correlative Light- and Electron Microscopy Using Quantum Dot Nanoparticles

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using widefield fluorescence light microscopy and transmission electron microscopy (TEM). To demonstrate the protocol we have immunolabeled ultrathin epoxy sections of human somatostatinoma tumor using a primary antibody to somatostatin, followed by a biotinylated secondary antibody and visualization with streptavidin conjugated 585 nm cadmium-selenium (CdSe) quantum dots (QDs). The sections are mounted on a TEM specimen grid then placed on a glass slide for observation by widefield fluorescence light microscopy. Light microscopy reveals 585 nm QD labeling as bright orange fluorescence forming a granular pattern within the tumor cell cytoplasm. At low to mid-range magnification by light microscopy the labeling pattern can be easily recognized and the level of non-specific or background labeling assessed. This is a critical step for subsequent interpretation of the immunolabeling pattern by TEM and evaluation of the morphological context. The same section is then blotted dry and viewed by TEM. QD probes are seen to be attached to amorphous material contained in individual secretory granules. Images are acquired from the same region of interest (ROI) seen by light microscopy for correlative analysis. Corresponding images from each modality may then be blended to overlay fluorescence data on TEM ultrastructure of the corresponding region.

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of epoxy embedded human pathology tissue. We employ commercial antibody fragment conjugated QDs that are visualized by widefield fluorescence light microscopy and transmission electron microscopy.

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using ...

Initial Evaluation of Antibody-conjugates Modified with Viral-derived Peptides for Increasing Cellular Accumulation and Improving Tumor Targeting

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used in cancer treatment and imaging due to increased cellular accumulation over current ACs. During early AC in vitro development, fluorescence techniques and radioimmunoassays are sufficient for determining intracellular localization, accumulation efficiency, and target cell specificity. Currently, there is no consensus on standardized methods for preparing cells for evaluating AC intracellular accumulation and localization. The initial testing of ACs modified with virus-derived peptides is critical especially if several candidates have been constructed. Determining intracellular accumulation by fluorescence can be affected by background signal from ACs at the cell surface and complicate the interpretation of accumulation. For radioimmunoassays, typically treated cells are fractionated and the radioactivity in different cell compartments measured. However, cell lysis varies from cell to cell and often nuclear and cytoplasmic compartments are not adequately isolated. This can produce misleading data on payload delivery properties. The intravenous injection of radiolabeled virus-derived peptide-modified ACs in tumor bearing mice followed by radionuclide imaging is a powerful method for determining tumor targeting and payload delivery properties at the in vivo phase of development. However, this is a relatively recent advancement and few groups have evaluated virus-derived peptide-modified ACs in this manner. We describe the processing of treated cells to more accurately evaluate virus-derived peptide-modified AC accumulation when using confocal microscopy and radioimmunoassays. Specifically, a method for trypsinizing cells to remove cell surface bound ACs. We also provide a method for improving cellular fractionation. Lastly, this protocol provides an in vivo method using positron emission tomography (PET) for evaluating initial tumor targeting properties in tumor-bearing mice. We use the radioisotope 64Cu (t1/2 = 12.7 h) as an example payload in this protocol.

Viral-derived peptides coupled to antibody-conjugates (ACs) is an approach gaining momentum due to the potential of delivering molecular payloads with increased tumor cell accumulation. Utilizing common methods to evaluate peptide conjugation, AC and payload intracellular accumulation, and tumor targeting, this protocol helps researchers during the key initial development phases.

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used ...

20 mJ, 1 ps Yb:YAG Thin-disk Regenerative Amplifier

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with turn-key performance and microjoule-level pulse energy is used to seed the regenerative chirped-pulse amplifier. The amplifier is placed in airtight housing. It operates at room temperature and exhibits stable operation at a 5 kHz repetition rate, with a pulse-to-pulse stability less than 1%. By employing a 1.5 mm-thick beta barium borate crystal, the frequency of the laser output is doubled to 515 nm, with an average power of 70 W, which corresponds to an optical-to-optical efficiency of 70%. This superior performance makes the system an attractive pump source for optical parametric chirped-pulse amplifiers in the near-infrared and mid-infrared spectral range. Combining the turn-key performance and the superior stability of the regenerative amplifier, the system facilitates the generation of a broadband, CEP-stable seed. Providing the seed and pump of the optical parametric chirped-pulse amplification (OPCPA) from one laser source eliminates the demand of active temporal synchronization between these pulses. This work presents a detailed guide to set up and operate a Yb:YAG thin-disk regenerative amplifier, based on chirped-pulse amplification (CPA), as a pump source for an optical parametric chirped-pulse amplifier.

A protocol for the operation of a high-energy, high-power optical parametric chirped pulse amplifier pump source based on an Yb:YAG thin-disk regenerative amplifier is presented here.

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with ...

Synthesis of Monocyte-targeting Peptide Amphiphile Micelles for Imaging of Atherosclerosis

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. Atherosclerosis is also the leading cause of sudden death and myocardial infarction, instigated by unstable plaques that rupture and occlude the blood vessel without warning. Current imaging modalities cannot differentiate between stable and unstable plaques that rupture. Peptide amphiphiles micelles (PAMs) can overcome this drawback as they can be modified with a variety of targeting moieties that bind specifically to diseased tissue. Monocytes have been shown to be early markers of atherosclerosis, while large accumulation of monocytes is associated with plaques prone to rupture. Hence, nanoparticles that can target monocytes can be used to discriminate different stages of atherosclerosis. To that end, here, we describe a protocol for the preparation of monocyte-targeting PAMs (monocyte chemoattractant protein-1 (MCP-1) PAMs). MCP-1 PAMs are self-assembled through synthesis under mild conditions to form nanoparticles of 15 nm in diameter with near neutral surface charge. In vitro, PAMs were found to be biocompatible and had a high binding affinity for monocytes. The methods described herein show promise for a wide range of applications in atherosclerosis as well as other inflammatory diseases.

This paper presents a method involving the synthesis and characterization of monocyte-targeting peptide amphiphile micelles and the corresponding assays to test for biocompatibility and ability of the micelle to bind to monocytes.

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. ...

Synthesis of Functionalized 10-nm Polymer-coated Gold Particles for Endothelium Targeting and Drug Delivery

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting and drug delivery are some of the applications of these AuNPs, but endothelial extracellular matrices&#39; defensive properties hamper particle uptake. To address this issue, we describe a synthesis method for ultrasmall gold nanoparticles to improve vascular delivery, with customizable functional groups and polymer lengths for further adjustments. The protocol yields 2.5 nm AuNPs that are capped with tetrakis(hydroxymethyl)phosphonium chloride (THPC). The replacement of THPC with hetero-functional polyethylene glycol (PEG) on the surface of the AuNP increases the hydrodynamic radius to 10.5 nm while providing various functional groups on the surface. The last part of the protocol includes an optional addition of a fluorophore to allow the AuNPs to be visualized under fluorescence to track nanoparticle uptake. Dialysis and lyophilization were used to purify and isolate the AuNPs. These fluorescent nanoparticles can be visualized in both in vitro and in vivo experiments due to the biocompatible PEG coating and fluorescent probes. Additionally, the size range of these nanoparticles render them an ideal candidate for probing the glycocalyx without disrupting normal vasculature function, which may lead to improved delivery and therapeutics.

We describe a method of synthesizing biocompatible 10-nm gold nanoparticles, functionalized by coating poly-ethylene glycol onto the surface. These particles can be used in vitro and in vivo for delivering therapeutics to nanoscale cellular and extracellular spaces that are difficult to access with conventional nanoparticle sizes.

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting ...

Targeting Neuronal Fiber Tracts for Deep Brain Stimulation Therapy Using Interactive, Patient-Specific Models

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for movement disorders and is being applied to a growing number of disorders. Computational modeling has been successfully used to predict the clinical effects of DBS; however, there is a need for novel modeling techniques to keep pace with the growing complexity of DBS devices. These models also need to generate predictions quickly and accurately. The goal of this project is to develop an image processing pipeline to incorporate structural magnetic resonance imaging (MRI) and diffusion weighted imaging (DWI) into an interactive, patient specific model to simulate the effects of DBS. A virtual DBS lead can be placed inside of the patient model, along with active contacts and stimulation settings, where changes in lead position or orientation generate a new finite element mesh and solution of the bioelectric field problem in near real-time, a timespan of approximately 10 seconds. This system also enables the simulation of multiple leads in close proximity to allow for current steering by varying anodes and cathodes on different leads. The techniques presented in this paper reduce the burden of generating and using computational models while providing meaningful feedback about the effects of electrode position, electrode design, and stimulation configurations to researchers or clinicians who may not be modeling experts.

The goal of this project is to develop an interactive, patient-specific modeling pipeline to simulate the effects of deep brain stimulation in near real-time and provide meaningful feedback as to how these devices influence neural activity in the brain.

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for ...