Financiamento concedido pelo DOD W81XWH-1023/10/01 (ZJG), concessão P50 GM081879 partir do Centro de UCSF de Sistemas e Biologia Sintética (ZJG), NIH 5R21EB015088-02 (YJ) e NIH 1R21EB018044 (ZJG &amp; YJ). DS foi apoiado pelo Programa Fronteira Humana cruzada pós-doutorado disciplinar bolsa de pesquisa.

1 Produção de vacina monovalente Quantum Dots <ol><li> De transferência de fase a partir de QDs orgânica para a fase aquosa <ol><li> Dilui-se 200 ul de uma solução 1 | iM de QDs fase orgânica com 400 mL de clorofórmio num frasco de vidro de 5 mL. </li><li> Misturar 400 mL de uma solução 0,3 M de brometo de tetrabutilamónio (TBAB) de clorofórmio com 36 jil de tiol puro mPEG (CH 3 S (CH 2 CH 2 O) 6 C 2 H 5 SH) e agitar S / N. </li><li> Adicionar 800 ul de uma solução aquosa 0,2 M de NaOH e agita-se durante 30 seg. Uma transferência de fase ocorre dentro de poucos minutos, indicadas pela transferência de partículas coloridas para a fase aquosa acima da fase orgânica mais denso. </li><li> Se as partículas de agregado em uma terceira fase entre as fases aquosa e orgânica, aumentar o tempo de incubação com o tiol mPEG. Se a fase aquosa continua a ser evidente, as QDs não de transferência de fase (ver Figura 3A). Como alternativa, aumentar a concentração de mPEG tiol no passo 2 para aliviar transferência de fase pobre. </li><li> Recuperar o (colorido) fase aquosa e, em seguida, concentrar os QDs recolhidos com uma coluna Centricon rotação (30 kDa peso molecular de corte) a 1 ml. </li><li> Adicionar a solução QD concentrada em uma coluna de Sephadex NAP10 pré-equilibrada com tampão Tris 10 mM contendo NaCl 30 mM (pH 8,0). Eluir QDs com 1,5 ml de tampão de eluição por fluxo de gravidade. </li><li> Medir a concentração de QDs com a espectroscopia de absorção a 350 nm. </li></ol></li><li> Preparação de MQDS <ol><li> Compra (ou sintetizar) ptDNA. Este protocolo utiliza a sequência 5&#39;-S Um 50 (CT) 10 (ACTG) 5 -3 &#39;(ver Tabela 1). </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> DNA </td><td> Sequência </td></tr><tr><td> 5&#39;-A S 50 (CT) 10 (ACTG) 5 </sub&gt; -3 &#39; </td><td> A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG </td></tr><tr><td> 5&#39;-NH2 - (CT) 10 (CAGT) 5 -3 &#39; </td><td> NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr><tr><td> BG-DNA </td><td> BG / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr></tbody></table> 1. sequências de ADN Tabela utilizada para produzir e MQDS alvo. <ol start="2" style="margin-left: 40px;"><li> Prepare uma solução de 100 ml de QD nM em tampão Tris 10 mM contendo NaCl 30 mM (pH 8). </li><li> Adicionar gota a gota, 500 mL da solução de 100 nM para os ptDNA QDs aquosas durante 1 minuto, enquanto se agitava vigorosamente. Agita-se ou colocar num agitador durante uma hora adicional 9. Nota: Isto deve, teoricamente, produzir uma relação de 1: de ptDNA 2: QD. No entanto, a estequiometria real nunca é perfeita - geralmente o resultado é mais próximo de 1: 1,5. A fim de produzir uma relação de 1: 1 de ptDNA: QD, densitometria após electroforese em gel é necessária para quantificar a proporção exacta de conjugação, dados os volumes conhecidos utilizados acima. </li><li> Retirar ~ 10 ml da mistura QD para rodar em um gel de agarose analítico. Também remover uma concentração semelhante de QDs não conjugados em fase aquosa (do passo 1.2.1). <ol><li> Adicionar ~ 2 μ; L de tampão de carregamento de 6x Ficoll (para aumentar a densidade da solução) e executar estas duas amostras em conjunto sobre um gel de 0,8% p / v de agarose em tampão de borato de sódio durante 15 min a 150 V. Uma única banda na pista de controlo não conjugada a migrar perto o bem, e as duas bandas na faixa com QDs conjugados são vistos (ver em géis Figura 2B). </li></ol></li><li> Calcula-se a fracção QD não conjugada usando a intensidade relativa das duas bandas (ver a equação na Figura 2B). Em seguida, use essa fração para o cálculo do volume adicional de 100 nM solução ptDNA necessário para corresponder ao número de QDs. </li><li> Repita os passos de 1.2.3 a 1.2.5, mais uma vez com este volume calculado ou até o colapso QDs conjugados numa única banda no gel, indicando conjugação completa de todos os QDs. </li><li> Adicionar 100 ul de 10 mM (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carboxi PEG6 alcano tiol) em tampão Tris 10 mM containing NaCl 30 mM (pH 8) para os conjugados produzidos MQDS acima, e agita-se durante 10 min. Nota: Estes ligantes PEG passivate superfície do QD. A PEG já vai melhor passivate os QDs, no entanto, que também irá aumentar o seu tamanho. A funcionalidade alcano tiol hidrofóbico tem uma afinidade muito maior para os QDs, no total, do que os menos hidrofóbico PEG-tiol utilizado para a transferência de fase. Portanto, não permita que este passo para continuar por muito tempo ou o ptDNA será substituído pelo alcano-PEG-tiol. Após um minuto de incubação ~ 30, uma fracção significativa de DNA terá sido deslocado da QDs (Figura 3B). </li><li> Para remover o excesso de PEG-alcano tiol, adicionar 0,5 ml da solução QD para uma coluna Sephadex NAP5 pré-equilibrada com tampão de eluição (tampão Tris 10 mM contendo NaCl a 30 mM). Recolher os MQDS com 1,0 ml de tampão de eluição por fluxo de gravidade. </li><li> Concentrar os QDs recolhidos com uma coluna Centricon rotação (30 kDa). Armazenar estes MQDS a 4 ° C durante meses. Não freeze eles. Nota: Se uma pastilha de cor na parte inferior do tubo é visto, os pontos foram agregadas e são provavelmente já não utilizável. </li></ol> 2 Produção de Segmentação DNA (Benzylguanine-) <ol><li> Produzir ou adquirir DNA terminada em amina. Este protocolo utiliza a sequência 5&#39;-NH2 - (CT) 10 - (CAGT) 5 -3 &#39;(ver Tabela 1). O ligante poli-CT aumenta a acessibilidade a funcionalidade enterrado no glycocalyx mas pode não ser necessário para todas as aplicações. Se não há acesso a um sintetizador de DNA, produzir ADN modificado com amino usando um 5 &#39;amino-modificador (5&#39; apropriado amino-modificador C6). </li><li> Dissolve-BG-N-hidroxissuccinimida (NHS-BG) em dimetilsulfóxido seco (DMSO) a uma concentração de 10 mg / ml. Nota: BG-NHS irá absorver a água a partir do ar e provocar a hidrólise do NHS-éster reactivo, em especial em solventes como DMSO hidroscópicos e dimetilformamida (DMF). BG-NHS é melhor lojad a -80 ° C como um pó no seu próprio frasco dentro de um recipiente contendo dessecante secundário. Aquece-se para a TA antes de abrir o frasco. Como alternativa, imediatamente aliquotar para uso único, o éster de NHS-BG num solvente polar seco e congelar a -80 ° C, ou de reagir totalmente com o ADN de amina no passo 2.2. </li><li> Reagir misturando o BG-NHS em DMSO a partir do passo 2.1 com ADN terminada com amina em HEPES (4 (2-hidroxietil) -1-piperazinoetanossulfónico) tamponada (pH 8,5) de água. Num típico reagem 20 ul de 10 mg / mL de bG-NHS em DMSO com 2 mL de 2 mM de NH 2 - (CT) 10 - (CAGT) 5 em 58 mL de água desionizada tamponada com 20 uL de 0,5 M de HEPES pH 8,5. Realizar reações em um tubo de microcentrífuga de 1,5 ml. Misture rapidamente medida que a reacção prossegue rapidamente e deve competir com a hidrólise do NHS-éster. </li><li> Sonicar durante 5-10 minutos para garantir a mistura completa. Incubar ~ 1 hora à temperatura ambiente. A razão estequiométrica de BG: ADN pode ser alterada para dirigir a reacção até ao fim. </li><li&gt; Dessalgar a reacção usando uma coluna NAP5 padrão em 100 mM de acetato de trietilamina (TEAA, pH 7). </li><li> Purifica-se o BG-ADN que não reagiu a partir da amina-DNA por HPLC de fase inversa a execução de um de TEAA 100 mM: acetonitrilo (ACN) gradiente entre 8% e 95% de acetonitrilo ao longo de 30 min. O ADN-amina que não reagiu antes de se eluir o ADN-BG. Recolher a fracção de BG-ADN num tubo cónico. <ol><li> Use uma coluna C 18 Zorbax para a purificação de oligonucleótidos padrão e o gradiente seguinte: 0 → 15 min: 8 → 30% ACN; 15 → 21 min: 30-90% ACN; 21 → 25 min: 90 → 8% ACN; 25 → 30 min: 8% ACN; </li></ol></li><li> Congelar em nitrogênio líquido e liofilizar a fracção recolhida. Ressuspender o ADN em água desionizada. Para ser mais cautelosos, liofilizar mais duas vezes para remover TEAA residual. TEAA residual pode ser tóxico para células em concentrações mais elevadas. </li><li> Ressuspender o BG-DNA liofilizado em água, certificando-se de lavar as laterais do the tubo, e diluir a ~ 25 mM estoque. Alíquotas e armazenar a 4 ° C. As amostras foram armazenadas durante 9 meses ~ sem degradação perceptível. </li></ol> 3. Labeling células vivas com monovalente Quantum Dots <ol><li> Opcionalmente, passivar os MQDS imediatamente antes de uma experiência de imagem, utilizando reagentes, tais como a caseína (0,5%) ou de albumina de soro bovino (BSA, 1-3%). </li><li> Células da placa que expressam a proteína SNAP-marcado em total de fluorescência de reflexão interna (TIRF) vidro -quality. Neste experimento, usamos uma linha de células U2OS expressando um receptor Notch1 SNAP-marcados e superfícies de vidro de alta qualidade. </li><li> Após as células terem ligado ao vidro (~ 24 horas), remover o meio de crescimento, lavagem com PBS, e incubar as células durante 10-30 min à temperatura ambiente em ~ 100-150 ul de PBS ou meio celular contendo 1 uM ~ BG ADN do passo 2.6 acima. </li><li> Após a incubação com a BG, lava-se cuidadosamente as células com PBS ou meio celular. Incubar as células de ~ 5-10 min com the MQDS produzidos no passo 1.2.9 (e opcionalmente passivado na etapa 3.1). </li><li> Opcionalmente, lavar os MQDS não ligados e devolver as células a um buffer / media adequado tanto de imagem e cultura. Para as células que estavam a ser trabalhada no modo TIRF, uma etapa de lavagem final foi muitas vezes desnecessários como MQDS não ligados em solução difundido tão rapidamente em comparação com MQDS vinculado como para não ser detectável durante a análise. </li></ol> 4. Microscopia e Análise <ol><li> Imagem as células usando um microscópio TIRF. Nota: O escopo deve ter excitação separáveis ​​e filtros de emissão, ou um filtro de cubo QD personalizado. QDs são mais animado com um laser de baixa comprimento de onda (405 ou 488 nm). QDs de diferentes diâmetros têm comprimentos de onda de emissão características, normalmente associada a uma grande mudança do Stoke. </li><li> Por causa do brilho do MQDS, coletar imagens em altas taxas de quadros em TIRF enquanto a imagem do lado basal de uma célula viva. Nota: Como alternativa, dinâmica única molécula pode ser seguinwed outros planos focais, utilizando um microscópio confocal de disco giratório. Software de rastreamento de partícula única automatizada é geralmente bem sucedido em seguir com precisão os MQDS brilhantes e fotoestável. </li></ol>

<ol>
	<li>Sako, Y., Minoghchi, S., Yanagida, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+imaging+of+EGFR+signaling+on+the+surface+of+living+cells.">Single-molecule imaging of EGFR signaling on the surface of living cells.</a> Nature Cell Biology. 2 (3), 168-172 (2000).</li><li>Luo, W., He, K., Xia, T., Fang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+monitoring+in+living+cells+by+use+of+fluorescence+microscopy.">Single-molecule monitoring in living cells by use of fluorescence microscopy.</a> Analytical and Bioanalytical Chemistry. 405 (1), 43-49 (2013).</li><li>Chung, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+control+of+EGF+receptor+activation+by+reversible+dimerization+on+living+cells.">Spatial control of EGF receptor activation by reversible dimerization on living cells.</a> Nature. 464 (7289), 783-787 (2010).</li><li>Fern&#225;ndez-Su&#225;rez, M., Ting, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+probes+for+super-resolution+imaging+in+living+cells.">Fluorescent probes for super-resolution imaging in living cells.</a> Nature Reviews Molecular Cell Biology. 9 (12), 929-943 (2008).</li><li>Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photooxidation+and+photobleaching+of+single+CdSe/ZnS+quantum+dots+probed+by+room-temperature+time-resolved+spectroscopy.">Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy.</a> The Journal of Physical Chemistry B. 105 (35), 8281-8284 (2001).</li><li>Pinaud, F., Clarke, S., Sittner, A., Dahan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+cellular+events,+one+quantum+dot+at+a+time.">Probing cellular events, one quantum dot at a time.</a> Nature Methods. 7 (4), 275-285 (2010).</li><li>Michalet, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantum+dots+for+live+cells,+in+vivo+imaging,+and+diagnostics.">Quantum dots for live cells, in vivo imaging, and diagnostics.</a> Science. 307 (5709), 538-544 (2005).</li><li>Howarth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monovalent,+reduced-size+quantum+dots+for+imaging+receptors+on+living+cells.">Monovalent, reduced-size quantum dots for imaging receptors on living cells.</a> Nature Methods. 5 (5), 397-399 (2008).</li><li>Iyer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aromatic+aldehyde+and+hydrazine+activated+peptide+coated+quantum+dots+for+easy+bioconjugation+and+live+cell+imaging.">Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging.</a> Bioconjugate Chemistry. 22 (6), 1006-1011 (2011).</li><li>Tikhomirov, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+programming+of+quantum+dot+valency,+self-assembly+and+luminescence.">DNA-based programming of quantum dot valency, self-assembly and luminescence.</a> Nature Nanotechnology. 6 (8), 485-490 (2011).</li><li>Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+targeted+monovalent+quantum+dots+by+steric+exclusion.">Formation of targeted monovalent quantum dots by steric exclusion.</a> Nature Methods. 10 (12), 1203-1205 (2013).</li><li>Gartner, Z. J., Bertozzi, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmed+assembly+of+3-dimensional+microtissues+with+defined+cellular+connectivity.">Programmed assembly of 3-dimensional microtissues with defined cellular connectivity.</a> Proceeding of the National Academy of Sciences USA. 106 (12), 4606-4610 (2009).</li><li>Selden, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+programmed+cell+adhesion+with+membrane-anchored+oligonucleotides.">Chemically programmed cell adhesion with membrane-anchored oligonucleotides.</a> Journal of the American Chemical Society. 134 (2), 765-768 (2012).</li></ol>

The authors have nothing to disclose.

A modularidade do design de MQD permite um maior grau de flexibilidade experimental. Por exemplo, uma variedade de MQDS podem ser rapidamente preparadas de cores únicas que permitem a gravação simultânea de múltiplos alvos. A seqüência de alvos ssDNA pode direcionar MQDS às proteínas, açúcares, lipídios e 12 superfícies 13. Um número de marcas enzimáticas estão disponíveis com reacções ortogonais, permitindo que múltiplos alvos a ser trabalhada em simultâneo com MQDS diferencialmente direcionados. Além de visar com a tag SNAP, rotulagem de proteínas-alvo com MQDS usando a tag CLIP, a tag HALO, e proteínas bioestanhados também foi bem sucedida. Este protocolo demonstra a marcação específica de um receptor de superfície de células vivas com estes MQDS, mas o protocolo pode ser facilmente adaptado a um certo número de diferentes contextos. A visão metodológica significativa na produção MQDS com valência definido que é ~ 50-fosforotioato ligadoas bases são necessárias para envolver os QDs (e, assim, evitar que duas moléculas de ligação ao mesmo tempo). A poli-A seqüência S 50 reprodutível e estavelmente ligado 605 nm QDs da Life Technologies. Embora este produto foi descontinuado, a estratégia de exclusão espacial é generalizável a produtos similares de outros fornecedores com diferentes tamanhos, formas, propriedades espectrais. A eficiência ea estabilidade dos QDs ptDNA-embrulhadas depende criticamente da química de superfície e estrutura dos QDs. Por conseguinte, o sucesso de um protocolo dependerá da estrutura química e fonte comercial de QDs. Para efeitos do presente protocolo, três grandes pontos de diferença existe entre as várias fontes comerciais de QDs: uma diferença de condições necessárias para a transferência de fase; uma diferença na força inicial de PEG-tiol-ligando de ligação, possivelmente impedir o deslocamento pelo ptDNA; e uma diferença na quantidade de núcleo exposto CdSe, que pode leanúncio para a extinção do QD pelo MPEG condições de transferência de fase tiol. Como de publicação, QDs com a melhor estrutura para a produção de MQDS são 4-10 nm QDs CdSe / ZnS núcleo / invólucro adquiridos de Life Technologies, com espectros de emissão a 545, 585, 605 e 625 nm (Figura 2A). QDs baseados na formulação &#39;Viva &quot;(545, 605, etc) extinguir por adição de mPEG tiol e não são adequados para esta aplicação. QDs de Aldrich e Oceano Nanotech funcionam bem, mas requerem etapas de transferência de mais de fase e pré-tratamento com óxido trioctilfosfina. Este protocolo foi otimizado para QDs de Life Technologies. A sequência poli-A fosforotioato usado para embrulhar os QDs é encerrado com um rabo de DNA 20-mer nativa contendo a seqüência de (ACTG) 5 para que um fio de segmentação pode hibridizar. Esta sequência é conveniente, uma vez que tem pouca ou nenhuma estrutura secundária, e permanecerá hybridized, a 37 ° C em PBS. Se não há acesso a um sintetizador de DNA, o ptDNA pode ser sintetizado e, em seguida, purificado por meio de cromatografia líquida de alta eficiência de fase inversa (HPLC) utilizando uma coluna C 8. O ptDNA irá eluir mais tarde no HPLC de oligonucleótidos equivalentes com uma espinha dorsal nativa. Nós normalmente deixam o 5 &#39;grupo protector DMT nos nossos oligonucleótidos fosforotioato após purificação. Passivação das QDs ptDNA-embrulhados é geralmente necessária a fim de melhorar a estabilidade coloidal das QDs e reduzir a ligação de fundo para a maioria das aplicações experimentais. O protocolo utiliza um PEG-camada para passivar os QDs. Carboxi PEG tiol alcano com unidades de PEG adicional ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, carboxi-PEG12 alcano tiol) fornece significativamente reduzida fundo, embora os mais longos PEGs são tanto maiores, e geralmente mais caros. MQDS revestidos com PEG carboxi Alkaligandos tiol ne são altamente estáveis ​​em tampões fisiológicos tais como fosfato tamponado salinas e meios de cultura. Armazenamento de longo prazo (&gt; 8 meses) de MQDS a 4 ° C não mostrou agregação significativa ou ptDNA destacamento 11. Dependendo da experiência, a passivação de PEG QDs sozinho nem sempre suficientemente reduzir a ligação não específica das MQDS. A incubação de células e os dois MQDS em tampão fosfato salino (PBS) contendo 3% de BSA durante 20 min antes da utilização reduz substancialmente a ligação não específica de células, embora ele faz aumentar o raio hidrodinâmico aparente dos MQDS por ~ 50%. A passivação com 0,5% de caseína reduz a ligação não específica do mesmo, mas ainda aumenta o tamanho aparente de uma extensão maior do que o de BSA. A extremidade 5 &#39;de uma cadeia de ADN complementar às MQDS pode ser modificado para permitir a segmentação de uma série de diferentes biomoléculas. Há uma série de técnicas disponíveis estabelecidas para modificar covalentemente proteínas, lIPIDs e açúcares com ADN de cadeia simples (ssDNA). Enquanto o ADNcs é apresentada extracelularmente, é acessível a MQDS solúveis. MQDS com as sequências anteriores, irá hibridizar rapidamente com a sua cadeia de ADN complementar, em condições de cultura de células. Um 10-20x poli (CT) entre o espaçador ptDNA e a sequência de direccionamento pode ser necessária para a eficiente alvo, de modo a elevar a sequência de ligação acima do glicocálice espessura e de carga negativa da célula. Para este protocolo optou-se por produzir um DNA BG com uma sequência complementar de (CAGT) 5 que tanto hibridizada aos MQDS e covalente ligação-se a uma proteína SNAP-tag para marcação rápida e específica. Um protocolo semelhante também funções para acoplar outros ésteres NHS de oligonucleótidos modificados com amino. Para uma única molécula de imagem, uma baixa densidade de rotulagem é normalmente necessária para resolver moléculas individuais. A concentração final da MQD ~ 0,5 nM em PBS com agente passivadoré um bom alvo. No entanto, essas diluições elevadas, por vezes, resultando em sub-marcação das células. Se isto ocorrer, MQD adicional pode ser adicionado até uma densidade óptima de rotulagem é observada. No caso de SNAP-etiquetado Notch1 humana, concentrações de&gt; 10 nM MQD produzido células rotulagem densas enquanto 0,5 nM MQD resultou na ligação de ~ 20 MQDS na superfície basal da célula alvo (ver Figura 4B). Rotulagem celular com MQDS era altamente dependente da confluência das células plaqueadas. Excessivamente células confluentes não rotular, cujas superfícies basais. Em resumo, um método simples para gerar monovalente e QDs modulares foi descrito. Estes MQDS encontrar utilidade na vasta gama de aplicações de imagem de células vivas, como demonstrado pela imagem do receptor Notch em células U2OS vivos. Aplicabilidade do MQDS não se limita a este caso particular, mas pode ser potencialmente prolongado por outros alvos celulares, tais como outras proteínas, ácidos nucleicos, e enzimas.

A dinâmica de moléculas individuais em células vivas contribui para a sua função biológica. Imaging molécula de fluorescência único é um método popular para estudar a dinâmica única molécula na superfície das células 1,2,3. No entanto, as sondas de imagem mais comumente usados ​​nestes estudos têm várias desvantagens importantes. Por exemplo, corantes orgânicos convencionais e as proteínas fluorescentes proporcionam brilho moderado, cerca de 10 5 a 10 6 M -1 cm -1, mas são fotoquimicamente instável, de branqueamento após a emissão de cerca de 10 5 -10 6 fotões sob condições típicas de processamento de imagens de células vivas 4,5. Em contraste, as nanopartículas de semicondutores, freqüentemente chamados de quantum dots (QDs), são significativamente mais brilhante e mais estável, com coeficientes de extinção na faixa de 10 6 -10 7 M -1 cm -1 e superior a 10 7 a 10 8 fótons emitidos antes photobleaching 5. O melhor luminosidade e fotoestabilidade de QDs mais de fluoróforos orgânicos permite a observação de moléculas individuais em taxas de quadro significativamente mais rápidas e mais muito mais tempo trajetórias 6. Apesar de suas vantagens e disponibilidade comercial, vários passivos permanecer para esses agentes de imagem poderosos. Em primeiro lugar, eles têm pouco definida valência de segmentação, o que pode resultar na ligação cruzada de biomoléculas-alvo 6. Em segundo lugar, eles geralmente têm um tamanho grande hidrodinâmico (&gt; 20 nm) que limita a acessibilidade a determinados ambientes celulares lotados 7. Terceiro, eles têm limitado visando modularidade 7. Várias estratégias têm tentado resolver estes problemas 8,9,10, mas geralmente exigem conhecimento e reagentes especializada para implementar. Para resolver estes problemas, informou recentemente uma estratégia &quot;de exclusão espacial&quot; para a preparação monovalente, pequenas emodulares QDs 11. Os QDs são envolvidos com um único polímero de DNA fosforotioato longa (ptDNA). O ptDNA se liga à superfície através de interacções múltiplas QD Zn-S entre átomos de Zn expostos à superfície e os grupos fosforotioato do polímero ptDNA. Um único polímero estericamente ligada electrostaticamente e exclui a ligação de equivalentes adicionais do polímero sem aumentar significativamente o tamanho total da partícula (cerca de 2 nm). Todos os reagentes estão comercialmente disponíveis, os produtos são formados com um rendimento elevado, e o processo requer poucos passos de dessalinização para purificação. Uma vez marcado, QDs embrulhados com um único ptDNA (MQDS) se ligam a cadeias de DNA complementares que ostentem domínios de segmentação (por exemplo, benzilguanina (BG), benzilcitosina, ou halogenetos de alquilo). Estas funcionalidades alvo as MQDS especificamente para etiquetas enzimáticas, tais como SNAP, CLIP &amp; HALO que são geneticamente fundido com a proteína de interesse. Este é um protocolo para a síntese, Direcionamento e imagem ao vivo de células de MQDS produzidos por exclusão estérica.

<table border="0" cellpadding="0" cellspacing="0" width="497">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:91px;">Comments/Description</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">mQD Production:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Phosphorothioate DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(A*)x50-(ACTG)x5</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Quantum Dots:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="127">
			<td height="127" style="height:127px;width:216px;">QDots 525, 585, 605 &#38; 625</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">Q21791MP (545), Q21711MP (585), Q21701MP (605)</td>
			<td style="width:91px;">Custom QD synthesis for QD625.</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">QD610</td>
			<td style="width:71px;">Ocean Nanotech</td>
			<td style="width:119px;">QSP-610-10&#160;</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">QD 610 lamda</td>
			<td style="width:71px;">Aldrich</td>
			<td style="width:119px;">731854</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Chloroform, 99.8%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">67-66-3</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Tetrabutylammonium bromide, 98.0%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">426288</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95%</td>
			<td style="width:71px;">Polypure</td>
			<td style="width:119px;">11156-0695</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:216px;">HSC11EG6CO2H&#160; [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H]</td>
			<td style="width:71px;">ProChimia</td>
			<td style="width:119px;">TH 003-m11.n6-0.1</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Boric Acid, 99.5%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">B0394</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Sodium Hydroxide, 99.0%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">S/4845</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Sodium Chloride, 98%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">310166</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Agarose LE</td>
			<td style="width:71px;">U.S. Biotech Sources</td>
			<td style="width:119px;">G02PD-125</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Ethanol</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">459828</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">BG-DNA Production:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Amine DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5(T)40-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">NHS-GLA-Benzylguanine</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">S9151</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">DMSO</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D8428</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">HEPES Buffer</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">83264</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">NAP5 Column</td>
			<td style="width:71px;">GE Healthcare</td>
			<td style="width:119px;">17-0853-01</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">C18 Column</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Acetonitrile</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">Mammalian Cell Culture &#38; Imaging:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Cell line expressing SNAP-tagged protein</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">E9100S</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">McCoys 5A</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">PBS</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Nunc Lab-tek II Chambered Coverglass</td>
			<td style="width:71px;">Thermo-Fischer Scientific</td>
			<td style="width:119px;">155409</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Matriplate 96-well plate</td>
			<td style="width:71px;">Brooks Life Science Systems</td>
			<td style="width:119px;">MGB096-1-2-LG-L</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">BSA</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">5% Alkali-soluble Casein</td>
			<td style="width:71px;">EMD Millipore</td>
			<td style="width:119px;">70955</td>
			<td style="width:91px;">Not all caseins are the same</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">(Optional) DNA Synthesis Reagents:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">5&#8217; Amine modifier C6</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">Oct-06</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">dA-Thiophosphoramidite</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">10-700</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Analysis Software:</td>
			<td></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">FIJI</td>
			<td colspan="3">http://valelab.ucsf.edu/~schindelin/</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">RyTrack.pro</td>
			<td colspan="3">http://sun.iwu.edu/~gspaldin/rytrack.html</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Tracker</td>
			<td colspan="3">http://www.gartnerlab.ucsf.edu/more/software</td>
		</tr>
	</tbody>
</table>

production and targeting of monovalent quantum dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in biology, where clustering and the spatial organization of biomolecules is often the object of study. We describe here a protocol to produce monovalent quantum dots (mQDs) that can be accomplished in most biological research laboratories via a simple mixing of CdSe/ZnS core/shell QDs with phosphorothioate DNA (ptDNA) of defined length. After a single ptDNA strand has wrapped the QD, additional strands are excluded from the surface. Production of mQDs in this manner can be accomplished at small and large scale, with commercial reagents, and in minimal steps. These mQDs can be specifically directed to biological targets by hybridization to a complementary single stranded targeting DNA. We demonstrate the use of these mQDs as imaging probes by labeling SNAP-tagged Notch receptors on live mammalian cells, targeted by mQDs bearing a benzylguanine moiety.

A transferência de fase dos QDs de uma orgânica para uma fase aquosa é crítico para a produção de MQDS, mas pode ser tanto condicionamento e QD-específico. Transferência de fase na secção 1.1 deve aparecer tão limpo como os dois primeiros frascos na Figura 3. Se a transferência se parece mais com frasco 3, em seguida, deve-se tentar novamente com diferentes condições. Uma vez que os QDs são revestidas com o DNA carregado negativamente devem migrar num gel separadamente dos QDs não enrolado. Utilizando uma aliquota de QDs desembrulhados como um controlo, um segundo banda de migração mais rápida deve aparecer no momento da adição do ptDNA, como visto na primeira gel na Figura 2B. A formação completa do MQDS é demonstrado com a perda da banda de imóveis, e o seu colapso na faixa móvel, como visto na última gel na Figura 2B. Se uma alíquota de seu produto MQD migra como uma única banda separáveis ​​dos QDs Sugerido, então seus MQDS são monovalentes e r<html> eady para ser usado em passos adicionais. Rotulagem celular deve ser específico para o alvo de sua escolha e deve ser dependente de níveis de expressão de proteínas e concentração MQD. Otimização empírica de ambos concentração MQD e MQD passivation é muitas vezes necessária para uma determinada aplicação. 4B demonstra a marcação das células U2OS que expressam um receptor Notch SNAP-marcado com MQDS variando em concentração de 0,5 nM e 10 nM. <img fo:content-width="6in" width="600" alt="Figura 1" src="/files/ftp_upload/52198/52198fig1highres.jpg" /> Figura 1 direcionamento Modular de MQDS. MQDS hibridizam com ssDNA funcionalizada por várias moléculas alvo. Benzilguanina ligada alvos de ADN MQDS a SNAP-tag proteínas de fusão. Outras modificações 5 &#39;e sequências de ADN que permitem que o direccionamento de MQDS para uma variedade de outras biomoléculas.&quot;target =&quot; /files/ftp_upload/52198/52198fig1highres.jpg _blank &quot;&gt; Clique aqui para ver uma versão maior desta figura. <img fo:content-width="6in" width="600" alt="Figura 2" src="/files/ftp_upload/52198/52198fig2highres.jpg" /> Figura 2 Esquema para a produção de MQDS. (A) da fase orgânica QDs são transferidos para a fase aquosa por tratamento com mPEG tiol e TBAB, embrulhado com ptDNA e passivado com carboxi PEG6 alcano tiol. Imagens representativas TEM são QD545 orgânico, QD585 e QD605, respectivamente. (B) Um método para determinar empiricamente a estequiometria da interacção entre QDs ptDNA e no passo dois acima. QD &amp; ptDNA estequiometrias são empiricamente verificado por densitometria de tal modo que a estequiometria final da reacção é de 1: 1 (QD: ptDNA). O número inicial de moles de ptDNA é multiplicado pela relação de QD: MQD, e ajustado pela af volume real<html> ter conjugação para produzir o número de moles necessários para atingir 1: 1. conjugação <a href="https://www.jove.com/files/ftp_upload/52198/52198fig2highres.jpg" target="_blank">Por favor, clique aqui para ver uma versão maior desta figura.</a> <img fo:content-width="6in" width="600" alt="Figura 3" src="/files/ftp_upload/52198/52198fig3highres.jpg" /> Figura 3. detalhes experimentais para produção de MQDS. (A) fotos representativas de sucesso e falha de transferência de fase. QDs deve transferir visualmente entre a fase orgânica e densa da fase aquosa menos densa. Separação de fases indica incompleta pobre transferência. (B) ptDNA pode ser substituído por alcano-PEG-tiol. Dados gel Direito é representativa de uma reação em que uma fração significativa da ptDNA foram deslocados dos QDs devido ao excesso de passivação.&quot;target =&quot; es.jpg _blank &quot;&gt; Clique aqui para ver uma versão maior desta figura. <img fo:content-width="6in" width="600" alt="Figura 4" src="/files/ftp_upload/52198/52198fig4highres.jpg" /> Figura 4 proteínas Labeling SNAP-marcado em células vivas. (A) Esquema demonstrando a expressão, o apego e rotulagem de um receptor SNAP-identificado com o MQD BG-alvo. (B) rotulagem Representante de células que expressam a SNAP-Notch-mCherry construir em várias concentrações MQD. MQDS passivadas com PEG12 colocalize com mCherry indicando rotulagem específica. Menores densidades de rotulagem (&lt;0,5 nM) são geralmente preferíveis para rastreamento única partícula. Barra de escala é de 10 m. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig4highres.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>

Watch this Scientific Journal Video about Production and Targeting of Monovalent Quantum Dots at JoVE.com

Production and Targeting of Monovalent Quantum Dots

We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications.

Produção e Segmentação de Monovalent Quantum Dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in ...

production-and-targeting-of-monovalent-quantum-dots

Research

JoVE Journal

Bioengineering

25.4K visualizações.  University of California, San Francisco. We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications. 

Vídeo: Production and Targeting of Monovalent Quantum Dots

Solubilization and Bio-conjugation of Quantum Dots and Bacterial Toxicity Assays by Growth Curve and Plate Count

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. QDs have attracted a lot of interest for imaging, diagnostics, and therapy due to their bright, stable fluorescence1,2 3,4,5. QDs can be conjugated to a variety of bio-active molecules for binding to bacteria and mammalian cells6.
QDs are also being widely investigated as cytotoxic agents for targeted killing of bacteria. The emergence of multiply-resistant bacterial strains is rapidly becoming a public health crisis, particularly in the case of Gram negative pathogens 7. Because of the well-known antimicrobial effect of certain nanomaterials, especially Ag, there are hundreds of studies examining the toxicity of nanoparticles to bacteria 8. Bacterial studies have been performed with other types of semiconductor nanoparticles as well, especially TiO2 9,10-11, but also ZnO12 and others including CuO 13. Some comparisons of bacterial strains have been performed in these studies, usually comparing a Gram negative strain with a Gram positive. With all of these particles, mechanisms of toxicity are attributed to oxidation: either the photogeneration of reactive oxygen species (ROS) by the particles or the direct release of metal ions that can cause oxidative toxicity. Even with these materials, results of different studies vary greatly. In some studies the Gram positive test strain is reportedly more sensitive than the Gram negative 10; in others it is the opposite 14. These studies have been well reviewed 15.
In all nanoparticle studies, particle composition, size, surface chemistry, sample aging/breakdown, and wavelength, power, and duration of light exposure can all dramatically affect the results. In addition, synthesis byproducts and solvents must be considered16 17. High-throughput screening techniques are needed to be able to develop effective new nanomedicine agents.
CdTe QDs have anti-microbial effects alone18 or in combination with antibiotics. In a previous study, we showed that coupling of antibiotics to CdTe can increase toxicity to bacteria but decrease toxicity to mammalian cells, due to decreased production of reactive oxygen species from the conjugates19. Although it is unlikely that cadmium-containing compounds will be approved for use in humans, such preparations could be used for disinfection of surfaces or sterilization of water.
In this protocol, we give a straightforward approach to solubilizing CdTe QDs with mercaptopropionic acid (MPA). The QDs are ready to use within an hour. We then demonstrate coupling to an antimicrobial agent.
The second part of the protocol demonstrates a 96-well bacterial inhibition assay using the conjugated and unconjugated QDs. The optical density is read over many hours, permitting the effects of QD addition and light exposure to be evaluated immediately as well as after a recovery period. We also illustrate a colony count for quantifying bacterial survival.

Nanoparticles such as semiconductor quantum dots (QDs) can be used to create photoactivatable agents for anti-microbial or anti-cancer applications. This technique shows how to water-solubilize cadmium telluride (CdTe) QDs, conjugate them to an antibiotic, and perform a bacterial inhibition assay based upon growth curves and plate count.

Solubilização e Bio conjugação de pontos quânticos e ensaios de toxicidade bacterianas por curva de crescimento e Contagem

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. ...

Bioengenharia

Cell Labeling and Targeting with Superparamagnetic Iron Oxide Nanoparticles

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the target site while minimizing deleterious effects to off-target sites. Magnetic cell targeting is an efficient, safe, and straightforward delivery technique. Superparamagnetic iron oxide nanoparticles (SPION) are biodegradable, biocompatible, and can be endocytosed into cells to render them responsive to magnetic fields. The synthesis process involves creating magnetite (Fe3O4) nanoparticles followed by high-speed emulsification to form a poly(lactic-co-glycolic acid) (PLGA) coating. The PLGA-magnetite SPIONs are approximately 120 nm in diameter including the approximately 10 nm diameter magnetite core. When placed in culture medium, SPIONs are naturally endocytosed by cells and stored as small clusters within cytoplasmic endosomes. These particles impart sufficient magnetic mass to the cells to allow for targeting within magnetic fields. Numerous cell sorting and targeting applications are enabled by rendering various cell types responsive to magnetic fields. SPIONs have a variety of other biomedical applications as well including use as a medical imaging contrast agent, targeted drug or gene delivery, diagnostic assays, and generation of local hyperthermia for tumor therapy or tissue soldering.

Targeted cell delivery is useful in a variety of biomedical applications. The goal of this protocol is to use superparamagnetic iron oxide nanoparticles (SPION) to label cells and thereby enable magnetic cell targeting approaches for a high degree of control over cell delivery and localization.

Rotulagem celular e Segmentação com nanopartículas de óxido de ferro superparamagnéticas

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the ...

Solid Lipid Nanoparticles (SLNs) for Intracellular Targeting Applications

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter cellular signaling and gene expression. In a previous investigation, the synthesis of ultra-small solid lipid nanoparticles (SLNs) for topical drug delivery and biomarker detection applications was demonstrated. SLNs are a well-studied example of a nanoparticle delivery system that has emerged as a promising drug delivery vehicle. In this study, SLNs were loaded with a fluorescent dye and used as a model to investigate particle-cell interactions. The phase inversion temperature (PIT) method was used for the synthesis of ultra-small populations of biocompatible nanoparticles. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylphenyltetrazolium bromide (MTT) assay was utilized in order to establish appropriate dosing levels prior to the nanoparticle-cell interaction studies. Furthermore, primary human dermal fibroblasts and mouse dendritic cells were exposed to dye-loaded SLN over time and the interactions with respect to toxicity and particle uptake were characterized using fluorescence microscopy and flow cytometry. This study demonstrated that ultra-small SLNs, as a nanoparticle delivery system, are suitable for intracellular targeting of different cell types.

Solid Lipid Nanoparticles SLNs for Intracellular Targeting Applications

In this study, a method for synthesizing ultra-small populations of biocompatible nanoparticles was described, as well as several in vitro methods by which to assess their cellular interactions.

Nanopartículas Lipídicas Sólidas (NLS) para intracelular Segmentação Aplicações

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter ...

A Rapid and Quantitative Fluorimetric Method for Protein-Targeting Small Molecule Drug Screening

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold nanoclusters (Au NCs) within the drug-loaded protein, based on the differential fluorescence signal emitted by the Au NCs. Albumin proteins such as human serum albumin (HSA) and bovine serum albumin (BSA) are selected as the model proteins. Four small molecular drugs (e.g., ibuprofen, warfarin, phenytoin, and sulfanilamide) of different binding affinities to the albumin proteins are tested. It was found that the formation rate of fluorescent Au NCs inside the drug loaded albumin protein under denaturing conditions (i.e., 60 &#176;C or in the presence of urea) is slower than that formed in the pristine protein (without drugs). Moreover, the fluorescent intensity of the as-formed NCs is found to be inversely correlated to the binding affinities of these drugs to the albumin proteins. Particularly, the higher the drug-protein binding affinity, the slower the rate of Au NCs formation, and thus a lower fluorescence intensity of the resultant Au NCs is observed. The fluorescence intensity of the resultant Au NCs therefore provides a simple measure of the relative binding strength of different drugs tested. This method is also extendable to measure the specific drug-protein binding constant (KD) by simply varying the drug content preloaded in the protein at a fixed protein concentration. The measured results match well with the values obtained using other prestige but more complicated methods.

A protocol for small molecular drug screening based on in-situ synthesis of ultrasmall fluorescent gold nanoclusters (Au NCs) using drug-loaded protein as template is presented. This method is simple to determine the binding affinity of drugs to a target protein by a visible fluorescent signal emitted from the protein-templated Au NCs.

Uma rápida e quantitativa método fluorimétrico para-Targeting proteína pequena molécula Rastreio de drogas

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold ...

Correlative Light- and Electron Microscopy Using Quantum Dot Nanoparticles

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using widefield fluorescence light microscopy and transmission electron microscopy (TEM). To demonstrate the protocol we have immunolabeled ultrathin epoxy sections of human somatostatinoma tumor using a primary antibody to somatostatin, followed by a biotinylated secondary antibody and visualization with streptavidin conjugated 585 nm cadmium-selenium (CdSe) quantum dots (QDs). The sections are mounted on a TEM specimen grid then placed on a glass slide for observation by widefield fluorescence light microscopy. Light microscopy reveals 585 nm QD labeling as bright orange fluorescence forming a granular pattern within the tumor cell cytoplasm. At low to mid-range magnification by light microscopy the labeling pattern can be easily recognized and the level of non-specific or background labeling assessed. This is a critical step for subsequent interpretation of the immunolabeling pattern by TEM and evaluation of the morphological context. The same section is then blotted dry and viewed by TEM. QD probes are seen to be attached to amorphous material contained in individual secretory granules. Images are acquired from the same region of interest (ROI) seen by light microscopy for correlative analysis. Corresponding images from each modality may then be blended to overlay fluorescence data on TEM ultrastructure of the corresponding region.

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of epoxy embedded human pathology tissue. We employ commercial antibody fragment conjugated QDs that are visualized by widefield fluorescence light microscopy and transmission electron microscopy.

Correlativa luz e de Microscopia Eletrônica Usando Quantum Dot Nanopartículas

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using ...

Initial Evaluation of Antibody-conjugates Modified with Viral-derived Peptides for Increasing Cellular Accumulation and Improving Tumor Targeting

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used in cancer treatment and imaging due to increased cellular accumulation over current ACs. During early AC in vitro development, fluorescence techniques and radioimmunoassays are sufficient for determining intracellular localization, accumulation efficiency, and target cell specificity. Currently, there is no consensus on standardized methods for preparing cells for evaluating AC intracellular accumulation and localization. The initial testing of ACs modified with virus-derived peptides is critical especially if several candidates have been constructed. Determining intracellular accumulation by fluorescence can be affected by background signal from ACs at the cell surface and complicate the interpretation of accumulation. For radioimmunoassays, typically treated cells are fractionated and the radioactivity in different cell compartments measured. However, cell lysis varies from cell to cell and often nuclear and cytoplasmic compartments are not adequately isolated. This can produce misleading data on payload delivery properties. The intravenous injection of radiolabeled virus-derived peptide-modified ACs in tumor bearing mice followed by radionuclide imaging is a powerful method for determining tumor targeting and payload delivery properties at the in vivo phase of development. However, this is a relatively recent advancement and few groups have evaluated virus-derived peptide-modified ACs in this manner. We describe the processing of treated cells to more accurately evaluate virus-derived peptide-modified AC accumulation when using confocal microscopy and radioimmunoassays. Specifically, a method for trypsinizing cells to remove cell surface bound ACs. We also provide a method for improving cellular fractionation. Lastly, this protocol provides an in vivo method using positron emission tomography (PET) for evaluating initial tumor targeting properties in tumor-bearing mice. We use the radioisotope 64Cu (t1/2 = 12.7 h) as an example payload in this protocol.

Viral-derived peptides coupled to antibody-conjugates (ACs) is an approach gaining momentum due to the potential of delivering molecular payloads with increased tumor cell accumulation. Utilizing common methods to evaluate peptide conjugation, AC and payload intracellular accumulation, and tumor targeting, this protocol helps researchers during the key initial development phases.

Avaliação inicial do anticorpo cojugado modificado com peptídeos virais-derivado para aumentar a acumulação celular e melhorando o direcionamento do Tumor

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used ...

20 mJ, 1 ps Yb:YAG Thin-disk Regenerative Amplifier

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with turn-key performance and microjoule-level pulse energy is used to seed the regenerative chirped-pulse amplifier. The amplifier is placed in airtight housing. It operates at room temperature and exhibits stable operation at a 5 kHz repetition rate, with a pulse-to-pulse stability less than 1%. By employing a 1.5 mm-thick beta barium borate crystal, the frequency of the laser output is doubled to 515 nm, with an average power of 70 W, which corresponds to an optical-to-optical efficiency of 70%. This superior performance makes the system an attractive pump source for optical parametric chirped-pulse amplifiers in the near-infrared and mid-infrared spectral range. Combining the turn-key performance and the superior stability of the regenerative amplifier, the system facilitates the generation of a broadband, CEP-stable seed. Providing the seed and pump of the optical parametric chirped-pulse amplification (OPCPA) from one laser source eliminates the demand of active temporal synchronization between these pulses. This work presents a detailed guide to set up and operate a Yb:YAG thin-disk regenerative amplifier, based on chirped-pulse amplification (CPA), as a pump source for an optical parametric chirped-pulse amplifier.

A protocol for the operation of a high-energy, high-power optical parametric chirped pulse amplifier pump source based on an Yb:YAG thin-disk regenerative amplifier is presented here.

20 mJ, 1 ps Yb: amplificador regenerativo de disco fino YAG

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with ...

Synthesis of Monocyte-targeting Peptide Amphiphile Micelles for Imaging of Atherosclerosis

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. Atherosclerosis is also the leading cause of sudden death and myocardial infarction, instigated by unstable plaques that rupture and occlude the blood vessel without warning. Current imaging modalities cannot differentiate between stable and unstable plaques that rupture. Peptide amphiphiles micelles (PAMs) can overcome this drawback as they can be modified with a variety of targeting moieties that bind specifically to diseased tissue. Monocytes have been shown to be early markers of atherosclerosis, while large accumulation of monocytes is associated with plaques prone to rupture. Hence, nanoparticles that can target monocytes can be used to discriminate different stages of atherosclerosis. To that end, here, we describe a protocol for the preparation of monocyte-targeting PAMs (monocyte chemoattractant protein-1 (MCP-1) PAMs). MCP-1 PAMs are self-assembled through synthesis under mild conditions to form nanoparticles of 15 nm in diameter with near neutral surface charge. In vitro, PAMs were found to be biocompatible and had a high binding affinity for monocytes. The methods described herein show promise for a wide range of applications in atherosclerosis as well as other inflammatory diseases.

This paper presents a method involving the synthesis and characterization of monocyte-targeting peptide amphiphile micelles and the corresponding assays to test for biocompatibility and ability of the micelle to bind to monocytes.

Síntese de monócitos-direcionamento do Peptide Amphiphile micelas para a imagem latente da aterosclerose

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. ...

Synthesis of Functionalized 10-nm Polymer-coated Gold Particles for Endothelium Targeting and Drug Delivery

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting and drug delivery are some of the applications of these AuNPs, but endothelial extracellular matrices&#39; defensive properties hamper particle uptake. To address this issue, we describe a synthesis method for ultrasmall gold nanoparticles to improve vascular delivery, with customizable functional groups and polymer lengths for further adjustments. The protocol yields 2.5 nm AuNPs that are capped with tetrakis(hydroxymethyl)phosphonium chloride (THPC). The replacement of THPC with hetero-functional polyethylene glycol (PEG) on the surface of the AuNP increases the hydrodynamic radius to 10.5 nm while providing various functional groups on the surface. The last part of the protocol includes an optional addition of a fluorophore to allow the AuNPs to be visualized under fluorescence to track nanoparticle uptake. Dialysis and lyophilization were used to purify and isolate the AuNPs. These fluorescent nanoparticles can be visualized in both in vitro and in vivo experiments due to the biocompatible PEG coating and fluorescent probes. Additionally, the size range of these nanoparticles render them an ideal candidate for probing the glycocalyx without disrupting normal vasculature function, which may lead to improved delivery and therapeutics.

We describe a method of synthesizing biocompatible 10-nm gold nanoparticles, functionalized by coating poly-ethylene glycol onto the surface. These particles can be used in vitro and in vivo for delivering therapeutics to nanoscale cellular and extracellular spaces that are difficult to access with conventional nanoparticle sizes.

Síntese de funcionalizados 10 nm polímero-revestida com partículas de ouro para o direcionamento do endotélio e entrega da droga

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting ...

Targeting Neuronal Fiber Tracts for Deep Brain Stimulation Therapy Using Interactive, Patient-Specific Models

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for movement disorders and is being applied to a growing number of disorders. Computational modeling has been successfully used to predict the clinical effects of DBS; however, there is a need for novel modeling techniques to keep pace with the growing complexity of DBS devices. These models also need to generate predictions quickly and accurately. The goal of this project is to develop an image processing pipeline to incorporate structural magnetic resonance imaging (MRI) and diffusion weighted imaging (DWI) into an interactive, patient specific model to simulate the effects of DBS. A virtual DBS lead can be placed inside of the patient model, along with active contacts and stimulation settings, where changes in lead position or orientation generate a new finite element mesh and solution of the bioelectric field problem in near real-time, a timespan of approximately 10 seconds. This system also enables the simulation of multiple leads in close proximity to allow for current steering by varying anodes and cathodes on different leads. The techniques presented in this paper reduce the burden of generating and using computational models while providing meaningful feedback about the effects of electrode position, electrode design, and stimulation configurations to researchers or clinicians who may not be modeling experts.

The goal of this project is to develop an interactive, patient-specific modeling pipeline to simulate the effects of deep brain stimulation in near real-time and provide meaningful feedback as to how these devices influence neural activity in the brain.

Segmentação Neuronal fibra folhetos para a terapia de estimulação profunda do cérebro usando modelos interativos, paciente específico

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for ...