Le financement accordé par le DOD W81XWH-01.10.1023 (ZJG), subvention P50 GM081879 du Centre UCSF pour les systèmes et la biologie synthétique (ZJG), NIH 5R21EB015088-02 (YJ) et NIH 1R21EB018044 (ZJG &amp; YJ). DS a été soutenu par le programme Human Frontier Science croisée postdoc disciplinaire bourse de recherche.

1 Production de monovalent Quantum Dots <ol><li> transfert de la phase de boîtes quantiques de organique à la phase aqueuse <ol><li> Diluer 200 ul d&#39;une solution à 1 M de points quantiques de la phase organique avec 400 pi de chloroforme dans un flacon de 5 ml en verre. </li><li> Mélanger 400 ul d&#39;une solution 0,3 M de bromure de tétrabutylammonium (TBAB) de chloroforme avec 36 ul de mPEG pur thiol (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) et agiter O / N. </li><li> Ajouter 800 ul d&#39;une solution aqueuse 0,2 M de NaOH et agiter pendant 30 secondes. Un transfert de phase se produit au bout de quelques minutes, indiqués par le transfert des particules colorées dans la phase aqueuse au-dessus de la phase organique dense. </li><li> Si les particules se rassemblent dans une troisième phase entre les phases aqueuse et organique, augmenter le temps d&#39;incubation avec le thiol mPEG. Si la phase aqueuse reste clair, les points quantiques n&#39;ont pas transfert de phase (voir figure 3A). Sinon, augmenter la concentration de mPEG thiol à l&#39;étape 2 pour alléger transfert de phase pauvres. </li><li> Récupérer le (couleur) phase aqueuse, puis concentrer les boîtes quantiques recueillies avec une colonne Centricon de spin (30 kDa de poids moléculaire de coupure) à 1 ml. </li><li> Ajouter la solution de QD concentré dans une colonne de Sephadex NAP10 pré-équilibrée avec du tampon Tris 10 mM contenant 30 mM de NaCl (pH 8,0). On élue les points quantiques avec 1,5 ml de tampon d&#39;élution par un écoulement par gravité. </li><li> Mesurer la concentration de boîtes quantiques par spectroscopie d&#39;absorption à 350 nm. </li></ol></li><li> Préparation de mQDs <ol><li> Achat (ou synthétiser) ptDNA. Ce protocole utilise la séquence 5&#39;-A S 50 (CT) 10 (ACTG) 5 -3 &#39;(voir le tableau 1). </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> ADN </td><td> Séquence </td></tr><tr><td> 5&#39;-A S 50 (CT) 10 (ACTG) 5 </sub&gt; -3 &#39; </td><td> A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG </td></tr><tr><td> 5&#39;-NH 2 - (CT) 10 (CAGT) 5 -3 &#39; </td><td> NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr><tr><td> BG-ADN </td><td> BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr></tbody></table> Tableau 1: séquences d&#39;ADN et utilisés pour produire des mQDs cibles. <ol start="2" style="margin-left: 40px;"><li> Préparer 1 ml d&#39;une solution de QD 100 nM dans du tampon Tris 10 mM contenant 30 mM de NaCl (pH 8). </li><li> Ajoutez goutte à goutte 500 pi de la solution 100 nM ptDNA aux boîtes quantiques aqueuses pendant 1 min en remuant énergiquement. Mélanger ou placer sur un agitateur pendant une 9 heures supplémentaires. Remarque: Ce devrait théoriquement produire un rapport de 1: 2 de ptDNA: QD. Cependant, la stoechiométrie réelle n&#39;est jamais parfaite - habituellement le résultat est proche de 1: 1,5. Afin de produire un rapport de 1: 1 de ptDNA: QD, densitométrie après électrophorèse en gel est nécessaire de quantifier le rapport exact de conjugaison compte tenu des volumes connus utilisés ci-dessus. </li><li> Retirez ~ 10 pl du mélange de QD pour fonctionner sur un gel d&#39;agarose analytique. Retirez également une concentration similaire de points quantiques non conjugués en phase aqueuse (de l&#39;étape 1.2.1). <ol><li> Ajouter ~ 2 μ, L de tampon de charge 6x Ficoll (pour augmenter la densité de la solution) et d&#39;exécuter ces deux échantillons en même temps sur un gel à 0,8% en poids / volume d&#39;agarose dans un tampon de borate de sodium pendant 15 min à 150 V. Une seule bande de la voie de commande non conjugué migrer à proximité le bien, et deux bandes dans la voie de QDs conjugués sont considérés (voir gels dans la figure 2B). </li></ol></li><li> Calculer la fraction QD non conjugué en utilisant l&#39;intensité relative des deux bandes (voir l&#39;équation de la figure 2B). Puis, utilisez la fraction de calculer le volume supplémentaire de 100 nM solution ptDNA nécessaire pour correspondre au nombre de points quantiques. </li><li> Répétez les étapes 1.2.3 à 1.2.5 une fois de plus avec ce volume calculé ou jusqu&#39;à ce que l&#39;effondrement dans une seule bande de QDs conjugués sur le gel indiquant conjugaison complète de tous les points quantiques. </li><li> Ajouter 100 ul de 10 mM (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carboxy PEG6 alcane thiol) dans 10 mM Tris tampon containing 30 mM de NaCl (pH 8) pour les mQDs conjugués produits ci-dessus, et agiter pendant 10 min. Remarque: Ces ligands PEG passivent la surface de QD. A plus PEG sera mieux passiver les points quantiques, cependant, il permettra également d&#39;augmenter leur taille. La fonctionnalité alcane thiol hydrophobe a une affinité beaucoup plus élevée pour les points quantiques, dans l&#39;ensemble, à moins hydrophobe PEG-thiol utilisé pour le transfert de phase. Par conséquent, ne laissez pas cette étape pour poursuivre trop longtemps ou la ptDNA sera remplacé par l&#39;alcane-PEG-thiol. Après une incubation ~ 30 min, une fraction importante de l&#39;ADN aura été déplacé à partir des points quantiques (figure 3B). </li><li> Pour supprimer alcane-thiol PEG excès, ajouter 0,5 ml de la solution de QD une colonne Sephadex NAP5 de pré-équilibrée avec un tampon d&#39;élution (tampon Tris 10 mM contenant 30 mM de NaCl). Recueillir les mQDs avec 1,0 ml de tampon d&#39;élution par écoulement gravitaire. </li><li> Concentrer les boîtes quantiques recueillies avec une colonne Centricon de spin (30 kDa). Conservez ces mQDs à 4 ° C pendant des mois. Ne frEEZE eux. Remarque: Si une pastille colorée dans la partie inférieure du tube est considéré, les points sont regroupés et sont susceptibles de ne plus utilisable. </li></ol> 2 Production de ciblage (Benzylguanine-) ADN <ol><li> Produire ou d&#39;acheter de l&#39;ADN à terminaison amine. Ce protocole utilise la séquence 5&#39;-NH 2 - (PM), 10 - (CAGT) 5 -3 &#39;(voir tableau 1). L&#39;éditeur de liens poly-CT augmente l&#39;accessibilité aux fonctionnalités enfoui au plus profond dans le glycocalyx mais ne peut pas être nécessaire pour toutes les applications. Si on a accès à un synthétiseur d&#39;ADN, produire de l&#39;ADN amino-modifié à l&#39;aide d&#39;un 5 &#39;amino-modificateur (5&#39; approprié amino-modificateur C6). </li><li> Dissoudre BG-N-hydroxysuccinimide (NHS-BG) dans le diméthylsulfoxyde sec (DMSO) à une concentration de 10 mg / ml. Remarque: BG-NHS va absorber l&#39;eau de l&#39;air et de conduire à une hydrolyse de l&#39;ester de NHS-réactif, en particulier dans des solvants hygroscopiques tels que le DMSO et le diméthylformamide (DMF). BG-NHS est le meilleur magasind à -80 ° C sous forme de poudre dans son flacon dans un récipient contenant un produit déshydratant secondaire. Réchauffer à température ambiante avant d&#39;ouvrir le flacon. Alternativement, aliquoter immédiatement à usage unique de l&#39;ester BG-NHS dans un solvant polaire sec et congeler à -80 ° C, ou de réagir pleinement avec l&#39;ADN d&#39;amine dans l&#39;étape 2.2. </li><li> Réagir en mélangeant le BG-NHS dans du DMSO à l&#39;étape 2.1 de l&#39;ADN à terminaison amine dans de l&#39;HEPES (4-(2-hydroxyéthyl) -1-piperazineethanesulfonic) tamponnée (pH 8,5) de l&#39;eau. Dans une réaction typique de 20 pi de 10 mg / ml BG-NHS dans du DMSO avec 2 ul de 2 mM de NH 2 - (PM), 10 - (CAGT) 5 à 58 pl d&#39;eau désionisée avec 20 pi de tampon de 0,5 M de HEPES pH 8,5. Réaliser des réactions dans un tube de 1,5 ml. Mélanger rapidement que la réaction se déroule rapidement et doit rivaliser avec hydrolyse NHS-ester. </li><li> Soniquer pendant 5-10 min pour bien mélanger. Incuber ~ 1 heure à température ambiante. Le rapport stoechiométrique de BG: ADN peut être modifiée pour conduire la réaction à son terme. </li><li&gt; dessaler la réaction en utilisant une colonne NAP5 standard en mM d&#39;acétate de 100 triéthylamine (TEAA, pH 7). </li><li> Purifier le BG-ADN à partir de l&#39;aminé n&#39;ayant pas réagi par l&#39;ADN-HPLC en phase inverse exécutant une TEAA 100 mM: acétonitrile (ACN), gradient de 8% à 95% d&#39;acétonitrile en 30 min. L&#39;amine-ADN n&#39;ayant pas réagi éluera avant l&#39;ADN BG. Recueillir la fraction BG-ADN dans un tube conique. <ol><li> Utilisez une colonne C 18 Zorbax pour la purification d&#39;oligonucléotides standard et le gradient suivant: 0 → 15 min: 8 → 30% d&#39;ACN; 15 → 21 min: 30-90% d&#39;ACN; 21 → 25 min: 90 → 8% d&#39;ACN; 25 → 30 min: 8% d&#39;ACN; </li></ol></li><li> Congeler dans l&#39;azote liquide et lyophiliser la fraction recueillie. Remettre en suspension l&#39;ADN dans de l&#39;eau déminéralisée. Pour être très prudent, lyophiliser deux fois de plus pour éliminer TEAA résiduelle. TEAA résiduel peut être toxique pour les cellules à des concentrations plus élevées. </li><li> Reprendre le BG-ADN lyophilisé dans l&#39;eau, en s&#39;assurant de laver les côtés de ee tube et diluer à environ 25 uM stock. Aliquote et conserver à 4 ° C. Les échantillons ont été conservés pendant ~ 9 mois sans dégradation notable. </li></ol> 3. cellules étiquetage direct avec monovalent Quantum Dots <ol><li> Eventuellement, passiver les mQDs juste avant une expérience d&#39;imagerie en utilisant des réactifs tels que la caséine (0,5%) ou l&#39;albumine de sérum bovin (BSA, 1 à 3%). </li><li> cellules des plaques exprimant la protéine SNAP-marqué sur le total de fluorescence à réflexion interne (FRBR) verre -quality. Dans cette expérience, nous utilisons une lignée cellulaire U2OS exprimant un récepteur Notch1 SNAP-marqués et les surfaces de verre de haute qualité. </li><li> Après que les cellules ont attaché au verre (~ 24 h), retirer le support de croissance, laver avec du PBS, et incuber les cellules à 10-30 min à température ambiante dans ~ 100-150 pi de PBS ou milieu cellulaire contenant ~ 1 uM BG- ADN de l&#39;étape 2.6 ci-dessus. </li><li> Après incubation avec BG, laver soigneusement les cellules avec du PBS ou milieu cellulaire. Incuber les cellules pendant ~ 5-10 min avec emQDs e produites dans l&#39;étape 1.2.9 (et éventuellement passivation à l&#39;étape 3.1). </li><li> Eventuellement, laver les mQDs non liés et retourner les cellules dans un tampon / media approprié à la fois pour l&#39;imagerie et de la culture. Pour les cellules qui étaient à imager en mode FRBR, une étape de lavage final est souvent inutile car mQDs non traitées dans la solution diffusés si rapidement par rapport à mQDs liées pour être indétectable lors de l&#39;analyse. </li></ol> 4. microscopie et analyse <ol><li> Image les cellules en utilisant un microscope TIRF. Remarque: Le champ doit avoir excitation séparée et filtres d&#39;émission, ou un filtre cube QD personnalisé. QDs sont les meilleurs excité avec un laser de faible longueur d&#39;onde (405 ou 488 nm). QD de diamètre différent ont des longueurs d&#39;onde d&#39;émission caractéristiques, généralement associée à un décalage de grande Stoke. </li><li> En raison de la luminosité de mQDs, recueillir des images à des cadences élevées dans la FRBR tandis que l&#39;imagerie du côté de base d&#39;une cellule vivante. Remarque: Vous pouvez également, la dynamique de molécules uniques peuvent être Follomarier à d&#39;autres plans focaux à l&#39;aide d&#39;un microscope confocal disque rotatif. Logiciel automatisé de suivi une particule est généralement couronnée de succès à un suivi précis des mQDs lumineuses et photostable. </li></ol>

<ol>
	<li>Sako, Y., Minoghchi, S., Yanagida, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+imaging+of+EGFR+signaling+on+the+surface+of+living+cells.">Single-molecule imaging of EGFR signaling on the surface of living cells.</a> Nature Cell Biology. 2 (3), 168-172 (2000).</li><li>Luo, W., He, K., Xia, T., Fang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+monitoring+in+living+cells+by+use+of+fluorescence+microscopy.">Single-molecule monitoring in living cells by use of fluorescence microscopy.</a> Analytical and Bioanalytical Chemistry. 405 (1), 43-49 (2013).</li><li>Chung, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+control+of+EGF+receptor+activation+by+reversible+dimerization+on+living+cells.">Spatial control of EGF receptor activation by reversible dimerization on living cells.</a> Nature. 464 (7289), 783-787 (2010).</li><li>Fern&#225;ndez-Su&#225;rez, M., Ting, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+probes+for+super-resolution+imaging+in+living+cells.">Fluorescent probes for super-resolution imaging in living cells.</a> Nature Reviews Molecular Cell Biology. 9 (12), 929-943 (2008).</li><li>Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photooxidation+and+photobleaching+of+single+CdSe/ZnS+quantum+dots+probed+by+room-temperature+time-resolved+spectroscopy.">Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy.</a> The Journal of Physical Chemistry B. 105 (35), 8281-8284 (2001).</li><li>Pinaud, F., Clarke, S., Sittner, A., Dahan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+cellular+events,+one+quantum+dot+at+a+time.">Probing cellular events, one quantum dot at a time.</a> Nature Methods. 7 (4), 275-285 (2010).</li><li>Michalet, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantum+dots+for+live+cells,+in+vivo+imaging,+and+diagnostics.">Quantum dots for live cells, in vivo imaging, and diagnostics.</a> Science. 307 (5709), 538-544 (2005).</li><li>Howarth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monovalent,+reduced-size+quantum+dots+for+imaging+receptors+on+living+cells.">Monovalent, reduced-size quantum dots for imaging receptors on living cells.</a> Nature Methods. 5 (5), 397-399 (2008).</li><li>Iyer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aromatic+aldehyde+and+hydrazine+activated+peptide+coated+quantum+dots+for+easy+bioconjugation+and+live+cell+imaging.">Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging.</a> Bioconjugate Chemistry. 22 (6), 1006-1011 (2011).</li><li>Tikhomirov, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+programming+of+quantum+dot+valency,+self-assembly+and+luminescence.">DNA-based programming of quantum dot valency, self-assembly and luminescence.</a> Nature Nanotechnology. 6 (8), 485-490 (2011).</li><li>Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+targeted+monovalent+quantum+dots+by+steric+exclusion.">Formation of targeted monovalent quantum dots by steric exclusion.</a> Nature Methods. 10 (12), 1203-1205 (2013).</li><li>Gartner, Z. J., Bertozzi, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmed+assembly+of+3-dimensional+microtissues+with+defined+cellular+connectivity.">Programmed assembly of 3-dimensional microtissues with defined cellular connectivity.</a> Proceeding of the National Academy of Sciences USA. 106 (12), 4606-4610 (2009).</li><li>Selden, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+programmed+cell+adhesion+with+membrane-anchored+oligonucleotides.">Chemically programmed cell adhesion with membrane-anchored oligonucleotides.</a> Journal of the American Chemical Society. 134 (2), 765-768 (2012).</li></ol>

The authors have nothing to disclose.

La modularité de la conception MQD permet un accroissement du niveau de flexibilité expérimentale. Par exemple, une variété de mQDs peuvent être préparés rapidement en couleurs uniques permettant l&#39;imagerie simultanée de multiples cibles. La séquence de ciblage ADN simple brin peut diriger mQDs de protéines, de sucres, de lipides et 12 surfaces 13. Un certain nombre de balises enzymatiques sont disponibles avec des réactivités orthogonales, permettant à plusieurs cibles à imager simultanément avec mQDs différemment ciblées. En plus de cibler avec l&#39;étiquette de SNAP, l&#39;étiquetage des protéines cibles avec mQDs utilisant la balise CLIP, l&#39;étiquette de HALO, et des protéines biotinylées a également été couronnée de succès. Ce protocole montre le marquage spécifique d&#39;un récepteur de surface de cellules vivantes avec ces mQDs, mais le protocole peut être facilement adapté à un certain nombre de contextes différents. L&#39;idée méthodologique important dans la production de mQDs de valence est défini que ~ 50 phosphorothioate-liébases sont nécessaires pour envelopper les boîtes quantiques (et éviter ainsi deux molécules de liaison simultanément). A-Une séquence poly S 50 reproductible et liée de façon stable 605 nm boîtes quantiques de Life Technologies. Bien que ce produit a été abandonné, la stratégie d&#39;exclusion stérique est généralisable à des produits similaires d&#39;autres fournisseurs ayant des tailles différentes, des formes, des propriétés spectrales. L&#39;efficacité et la stabilité des boîtes quantiques ptDNA emballés dépendent essentiellement de la chimie de surface et la structure des boîtes quantiques. Par conséquent, la réussite d&#39;un protocole dépend de la structure chimique et de la source commerciale des points quantiques. Pour les fins du présent protocole, il existe trois principaux points de divergence entre les différentes sources commerciales de boîtes quantiques: une différence dans les conditions nécessaires pour le transfert de phase; une différence dans la force initiale de PEG-thiol-ligand de liaison, peut entraver le déplacement par ptDNA; et une différence dans la quantité de CdSe noyau exposé, qui peut leannonce à la trempe de la QD par les conditions de transfert de phase thiol MPEG. Dès la publication, les points quantiques avec la meilleure structure pour la production de mQDs sont les points quantiques 4-10 nm CdSe / ZnS base / shell achetés auprès de Life Technologies avec des spectres d&#39;émission à 545, 585, 605 et 625 nm (figure 2A). QD basées sur la formulation «Vivid» (545, 605, etc) étanchent lors de l&#39;ajout de mPEG thiol et ne conviennent pas pour cette application. QD de Aldrich et océan Nanotech fonctionnent bien, mais nécessitent des étapes de transfert de phase et plus prétraitement avec de l&#39;oxyde de trioctylphosphine. Ce protocole a été optimisé pour les points quantiques de Life Technologies. La séquence poly-A phosphorothioate utilisé pour envelopper les boîtes quantiques est terminé par une queue d&#39;ADN 20-mère contenant la séquence native de (ACTG) 5 dans laquelle un brin de ciblage peut s&#39;hybrider. Cette séquence est commode, car il a peu ou pas de structure secondaire, et restera hybridized à 37 ° C dans du PBS. Si on a accès à un synthétiseur d&#39;ADN, par la ptDNA peut alors synthétisé et purifié par Chromatographie liquide à haute performance en phase inverse (HPLC) utilisant une colonne C 8. Le ptDNA éluera plus tard sur la HPLC que oligonucléotides équivalentes à squelette natif. Nous laissons généralement 5 &#39;DMT groupe protecteur sur nos oligonucléotides phosphorothioates après purification. Passivation des boîtes quantiques ptDNA-emballés est généralement nécessaire pour améliorer la stabilité colloïdale des boîtes quantiques et réduire la liaison pour les applications les plus expérimentales fond. Le protocole utilise un PEG-couche de passivation les boîtes quantiques. Carboxy PEG de alcanethiol avec des unités supplémentaires de PEG ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, carboxy-PEG12 alcane thiol) contribuent à réduire de manière significative fond, si les PEG plus sont à la fois plus grande, et généralement plus coûteux. mQDs revêtus de carboxy PEG alkaligands thiols nes sont très stable dans des tampons physiologiques tels que le phosphate tamponnée salines et les milieux de culture. Stockage à long terme (&gt; 8 mois) de mQDs à 4 ° C n&#39;a montré aucune agrégation significative ou détachement ptDNA 11. En fonction de l&#39;expérience, le PEG passivation des points quantiques ne pas toujours seul réduire suffisamment la liaison non spécifique des mQDs. L&#39;incubation des cellules et les deux mQDs dans une solution saline tamponnée au phosphate (PBS) contenant 3% de BSA pendant 20 minutes avant utilisation permet de réduire sensiblement la liaison non spécifique à des cellules, bien que cela augmente le rayon hydrodynamique apparent des mQDs de ~ 50%. Passivation avec 0,5% de caséine réduit la liaison non spécifique, mais encore elle augmente la taille apparente d&#39;une plus grande mesure que la BSA. L&#39;extrémité 5 &#39;d&#39;un brin d&#39;ADN complémentaire à la mQDs peut être modifié pour permettre le ciblage d&#39;un certain nombre de différentes biomolécules. Il existe un certain nombre de techniques disponibles établies pour modifier de manière covalente les protéines, lipids et des sucres à l&#39;ADN simple brin (ADN simple brin). Tant que l&#39;ADNsb est présentée de façon extracellulaire, il est accessible à mQDs solubles. mQDs avec les séquences ci-dessus seront rapidement s&#39;hybrider avec leur brin d&#39;ADN complémentaire dans des conditions de culture cellulaire. Un 10-20x poly (CT) entretoise entre la ptDNA et la séquence de ciblage peut être nécessaire pour le ciblage efficace de façon à élever la séquence de liaison au-dessus de la glycocalyx épaisse et chargée négativement de la cellule. Pour ce protocole, on a choisi pour produire un ADN-BG avec une séquence complémentaire de (CAGT) 5 qui sera hybridée à la fois aux mQDs covalente et se lier à une protéine SNAP-tag pour le marquage rapide et précis. A fonctions protocolaires similaires bien pour le couplage d&#39;autres esters NHS à oligonucléotides aminés modifiés. Pour l&#39;imagerie de molécules simples, une faible densité de marquage est typiquement nécessaire pour résoudre des molécules individuelles. Une concentration MQD finale de ~ 0,5 nM dans du PBS avec agent de passivationest une bonne cible. Cependant, ces dilutions élevées parfois donné lieu à une sous-marquage des cellules. Si cela se produit, MQD supplémentaire peut être ajouté jusqu&#39;à une densité optimale de marquage n&#39;est observé. Dans le cas de Notch1 humain SNAP-marqués, les concentrations de&gt; 10 nM MQD cellules produites à l&#39;étiquetage denses tandis que 0,5 nM MQD conduit à la fixation de ~ 20 mQDs à la surface de base de cellule cible (voir la figure 4B). étiquetage portable avec mQDs était fortement tributaire de la confluence de cellules étalées. Trop cellules confluentes ne pas étiqueter leurs surfaces de base. En résumé, une méthode simple pour générer monovalent et boîtes quantiques modulaires a été décrite. Ces mQDs trouvent une utilité dans une large gamme d&#39;applications d&#39;imagerie des cellules, tel que démontré par l&#39;imagerie du récepteur Notch sur les cellules vivantes U2OS. Applicabilité de mQDs n&#39;est pas limitée à ce cas particulier, mais peut être étendu à d&#39;autres potentiellement des cibles cellulaires tels que d&#39;autres protéines, acides nucléiques et les enzymes.

La dynamique de molécules uniques sur cellules vivantes contribue à leur fonction biologique. Simple fluorescence de molécules imagerie est une méthode populaire pour étudier la dynamique de molécules uniques sur le 1,2,3 de la surface cellulaire. Cependant, les sondes d&#39;imagerie les plus couramment utilisés dans ces études présentent plusieurs inconvénients importants. Par exemple, les colorants organiques et les protéines fluorescentes conventionnelles offrent luminosité modérée, environ 10 5 à 10 6 M -1 cm -1, mais sont photochimiquement instable, le blanchiment après l&#39;émission de l&#39;ordre de 10 5 -10 6 photons dans les conditions typiques d&#39;imagerie en temps réel des cellules 4,5. En revanche, les nanoparticules semi-conductrices, souvent appelés points quantiques (QD), sont nettement plus brillant et plus stable, avec des coefficients d&#39;extinction dans la gamme de 10 6 à 10 7 M -1 cm -1 et de plus de 10 7 -10 8 photons émis avant photoblENSEIGNEMENT 5. La luminosité améliorée et photostabilité des boîtes quantiques plus de fluorophores organiques permet l&#39;observation de molécules uniques à une accélération significative du taux de trame et trajectoires sur beaucoup plus longtemps 6. Malgré leurs avantages et la disponibilité commerciale, plusieurs engagements restent pour ces agents d&#39;imagerie puissantes. Tout d&#39;abord, ils ont mal défini ciblage valence, ce qui peut entraîner une réticulation des biomolécules cibles 6. Deuxièmement, ils ont généralement une taille hydrodynamique (&gt; 20 nm) qui limite l&#39;accès à certains environnements cellulaires encombrés 7. Troisièmement, ils ont limité le ciblage modularité 7. Plusieurs stratégies ont tenté de répondre à ces problèmes 8,9,10, mais exigent généralement des connaissances et des réactifs spécialisés pour la mise en œuvre. Pour résoudre ces problèmes, nous avons récemment signalé une stratégie «d&#39;exclusion stérique&quot; pour préparer monovalent, petites etmodulaires QD 11. Les points quantiques sont emballés avec un seul polymère ADN phosphorothioate longue (ptDNA). Le ptDNA se lie à la surface par l&#39;intermédiaire d&#39;interactions multiples QD Zn-S entre les atomes de Zn exposées à la surface et les groupes phosphorothioate du polymère ptDNA. Un seul polymère lié de manière électrostatique et stérique exclut la liaison des équivalents supplémentaires du polymère sans augmenter de manière significative la taille globale de la particule (environ 2 nm). Tous les réactifs sont disponibles dans le commerce, les produits sont formés avec un rendement élevé, et le procédé nécessite seulement des étapes de purification de dessalage. Une fois marqué, les points quantiques emballés avec un seul bind ptDNA (mQDs) à des brins d&#39;ADN complémentaires portant ciblant les domaines (par exemple, benzylguanine (BG), benzylcytosine ou alkylhalogénures). Ces fonctionnalités ciblent spécifiquement les mQDs à étiquettes enzymatiques tels que la SNAP, CLIP &amp; HALO qui sont génétiquement fusionnés à la protéine d&#39;intérêt. Il s&#39;agit d&#39;un protocole de synthèse, Le ciblage et l&#39;imagerie des cellules vivantes de mQDs produites par exclusion stérique.

<table border="0" cellpadding="0" cellspacing="0" width="497">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:91px;">Comments/Description</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">mQD Production:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Phosphorothioate DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(A*)x50-(ACTG)x5</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Quantum Dots:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="127">
			<td height="127" style="height:127px;width:216px;">QDots 525, 585, 605 &#38; 625</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">Q21791MP (545), Q21711MP (585), Q21701MP (605)</td>
			<td style="width:91px;">Custom QD synthesis for QD625.</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">QD610</td>
			<td style="width:71px;">Ocean Nanotech</td>
			<td style="width:119px;">QSP-610-10&#160;</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">QD 610 lamda</td>
			<td style="width:71px;">Aldrich</td>
			<td style="width:119px;">731854</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Chloroform, 99.8%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">67-66-3</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Tetrabutylammonium bromide, 98.0%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">426288</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95%</td>
			<td style="width:71px;">Polypure</td>
			<td style="width:119px;">11156-0695</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:216px;">HSC11EG6CO2H&#160; [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H]</td>
			<td style="width:71px;">ProChimia</td>
			<td style="width:119px;">TH 003-m11.n6-0.1</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Boric Acid, 99.5%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">B0394</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Sodium Hydroxide, 99.0%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">S/4845</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Sodium Chloride, 98%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">310166</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Agarose LE</td>
			<td style="width:71px;">U.S. Biotech Sources</td>
			<td style="width:119px;">G02PD-125</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Ethanol</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">459828</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">BG-DNA Production:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Amine DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5(T)40-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">NHS-GLA-Benzylguanine</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">S9151</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">DMSO</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D8428</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">HEPES Buffer</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">83264</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">NAP5 Column</td>
			<td style="width:71px;">GE Healthcare</td>
			<td style="width:119px;">17-0853-01</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">C18 Column</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Acetonitrile</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">Mammalian Cell Culture &#38; Imaging:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Cell line expressing SNAP-tagged protein</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">E9100S</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">McCoys 5A</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">PBS</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Nunc Lab-tek II Chambered Coverglass</td>
			<td style="width:71px;">Thermo-Fischer Scientific</td>
			<td style="width:119px;">155409</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Matriplate 96-well plate</td>
			<td style="width:71px;">Brooks Life Science Systems</td>
			<td style="width:119px;">MGB096-1-2-LG-L</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">BSA</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">5% Alkali-soluble Casein</td>
			<td style="width:71px;">EMD Millipore</td>
			<td style="width:119px;">70955</td>
			<td style="width:91px;">Not all caseins are the same</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">(Optional) DNA Synthesis Reagents:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">5&#8217; Amine modifier C6</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">Oct-06</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">dA-Thiophosphoramidite</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">10-700</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Analysis Software:</td>
			<td></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">FIJI</td>
			<td colspan="3">http://valelab.ucsf.edu/~schindelin/</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">RyTrack.pro</td>
			<td colspan="3">http://sun.iwu.edu/~gspaldin/rytrack.html</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Tracker</td>
			<td colspan="3">http://www.gartnerlab.ucsf.edu/more/software</td>
		</tr>
	</tbody>
</table>

production and targeting of monovalent quantum dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in biology, where clustering and the spatial organization of biomolecules is often the object of study. We describe here a protocol to produce monovalent quantum dots (mQDs) that can be accomplished in most biological research laboratories via a simple mixing of CdSe/ZnS core/shell QDs with phosphorothioate DNA (ptDNA) of defined length. After a single ptDNA strand has wrapped the QD, additional strands are excluded from the surface. Production of mQDs in this manner can be accomplished at small and large scale, with commercial reagents, and in minimal steps. These mQDs can be specifically directed to biological targets by hybridization to a complementary single stranded targeting DNA. We demonstrate the use of these mQDs as imaging probes by labeling SNAP-tagged Notch receptors on live mammalian cells, targeted by mQDs bearing a benzylguanine moiety.

Le transfert de phase des points quantiques d&#39;une organique à une phase aqueuse est critique pour la production de mQDs, mais peut être à la fois et de condition-QD-spécifique. transfert de phase dans la section 1.1 devrait apparaître aussi propre que les deux premiers flacons de la figure 3. Si le transfert apparaît plus comme flacon 3, alors il faut essayer de nouveau avec des conditions différentes. Une fois que les points quantiques sont revêtues avec l&#39;ADN chargé négativement, ils doivent migrer sur un gel séparément des boîtes quantiques non-enveloppé. Utilisation d&#39;une aliquote de points quantiques déballé en tant que contrôle, une deuxième, une bande à migration plus rapide doit apparaître lors de l&#39;addition de la ptDNA, comme on le voit dans le premier gel à la figure 2B. Formation complète de mQDs est démontré par la perte de la bande immobile, et sa chute dans la bande du service mobile tel que vu dans le dernier gel sur la figure 2B. Si une aliquote de votre produit MQD migre sous forme d&#39;une bande unique séparable des boîtes quantiques déballé, vos mQDs sont monovalents et r<html> eady à être utilisé dans d&#39;autres étapes. étiquetage cellulaire doit être spécifique à la cible de votre choix et devrait dépendre du niveau d&#39;expression de protéines et la concentration MQD. L&#39;optimisation empirique de deux concentration MQD et MQD passivation est souvent nécessaire pour une application donnée. Figure 4B montre le marquage des cellules U2OS exprimant un récepteur Notch SNAP-marqués avec mQDs des concentrations allant de 0,5 à 10 nm. <img fo:content-width="6in" width="600" alt="Figure 1" src="/files/ftp_upload/52198/52198fig1highres.jpg" /> Figure 1: ciblage de mQDs modulaire. MQDs s&#39;hybrident à l&#39;ADN sb fonctionnalisé par différentes molécules de ciblage. Benzylguanine-liée cibles d&#39;ADN mQDs SNAP-marqués protéines de fusion. D&#39;autres modifications en 5 &#39;et les séquences d&#39;ADN permettent le ciblage des mQDs à une variété d&#39;autres biomolécules./files/ftp_upload/52198/52198fig1highres.jpg &quot;target =&quot; _blank &quot;&gt; S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure. <img fo:content-width="6in" width="600" alt="Figure 2" src="/files/ftp_upload/52198/52198fig2highres.jpg" /> Figure 2 Schéma de production de mQDs. (A) en phase organique les points quantiques sont transférés vers la phase aqueuse par traitement avec un thiol et mPEG TBAB, enveloppé avec ptDNA, et passivées par un groupe carboxy PEG6 alcane thiol. Images représentant TEM sont QD545 organique, QD585, et QD605, respectivement. (B) Un procédé pour déterminer de manière empirique la stoechiométrie de l&#39;interaction entre les boîtes quantiques et ptDNA en deux étapes ci-dessus. &amp; QD ptDNA stoechiométries sont vérifiées empiriquement par densitométrie de telle sorte que la stoechiométrie de la réaction finale est de 1: 1 (QD: ptDNA). Le nombre initial de moles de ptDNA est multiplié par le rapport entre QD: MQD, et ajustée par le volume réel d&#39;af<html> ter la conjugaison pour donner le nombre de moles nécessaires pour atteindre 1: 1. conjugaison <a href="https://www.jove.com/files/ftp_upload/52198/52198fig2highres.jpg" target="_blank">S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <img fo:content-width="6in" width="600" alt="Figure 3" src="/files/ftp_upload/52198/52198fig3highres.jpg" /> Figure 3: Les détails expérimentaux pour la production de mQDs. (A) photos représentatifs de succès et à l&#39;échec de transfert de phase. QD devrait visuellement transférer entre la phase organique dense et la phase aqueuse moins dense. Séparation de phase incomplète indique un mauvais transfert. (B) ptDNA peut être remplacé par l&#39;alcane-thiol-PEG. Droit de données gel est représentatif d&#39;une réaction dans laquelle une fraction importante de ptDNA ont été déplacés à partir des points quantiques due à une sur-passivation.es.jpg &quot;target =&quot; _blank &quot;&gt; S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure. <img fo:content-width="6in" width="600" alt="Figure 4" src="/files/ftp_upload/52198/52198fig4highres.jpg" /> Figure 4 protéines SNAP-étiquetage marqué sur des cellules vivantes. (A) Schéma montrant l&#39;expression, l&#39;attachement et l&#39;étiquetage d&#39;un récepteur SNAP-marqué d&#39;un MQD BG-ciblée. (B) de l&#39;étiquetage représentant de cellules exprimant un SNAP-Notch-mCherry construire à différentes concentrations MQD. mQDs passives avec PEG12 colocalisent avec mCherry indiquant un étiquetage spécifique. Densités plus faibles en matière d&#39;étiquetage (&lt;0,5 nM) sont généralement préférables pour le suivi de particules isolées. La barre d&#39;échelle est de 10 um. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig4highres.jpg" target="_blank">S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a>

Watch this Scientific Journal Video about Production and Targeting of Monovalent Quantum Dots at JoVE.com

Production and Targeting of Monovalent Quantum Dots

We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications.

La production et le ciblage des monovalent Quantum Dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in ...

production-and-targeting-of-monovalent-quantum-dots

Research

JoVE Journal

Bioengineering

25.4K vues.  University of California, San Francisco. We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications. 

Vidéo: Production and Targeting of Monovalent Quantum Dots

Solubilization and Bio-conjugation of Quantum Dots and Bacterial Toxicity Assays by Growth Curve and Plate Count

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. QDs have attracted a lot of interest for imaging, diagnostics, and therapy due to their bright, stable fluorescence1,2 3,4,5. QDs can be conjugated to a variety of bio-active molecules for binding to bacteria and mammalian cells6.
QDs are also being widely investigated as cytotoxic agents for targeted killing of bacteria. The emergence of multiply-resistant bacterial strains is rapidly becoming a public health crisis, particularly in the case of Gram negative pathogens 7. Because of the well-known antimicrobial effect of certain nanomaterials, especially Ag, there are hundreds of studies examining the toxicity of nanoparticles to bacteria 8. Bacterial studies have been performed with other types of semiconductor nanoparticles as well, especially TiO2 9,10-11, but also ZnO12 and others including CuO 13. Some comparisons of bacterial strains have been performed in these studies, usually comparing a Gram negative strain with a Gram positive. With all of these particles, mechanisms of toxicity are attributed to oxidation: either the photogeneration of reactive oxygen species (ROS) by the particles or the direct release of metal ions that can cause oxidative toxicity. Even with these materials, results of different studies vary greatly. In some studies the Gram positive test strain is reportedly more sensitive than the Gram negative 10; in others it is the opposite 14. These studies have been well reviewed 15.
In all nanoparticle studies, particle composition, size, surface chemistry, sample aging/breakdown, and wavelength, power, and duration of light exposure can all dramatically affect the results. In addition, synthesis byproducts and solvents must be considered16 17. High-throughput screening techniques are needed to be able to develop effective new nanomedicine agents.
CdTe QDs have anti-microbial effects alone18 or in combination with antibiotics. In a previous study, we showed that coupling of antibiotics to CdTe can increase toxicity to bacteria but decrease toxicity to mammalian cells, due to decreased production of reactive oxygen species from the conjugates19. Although it is unlikely that cadmium-containing compounds will be approved for use in humans, such preparations could be used for disinfection of surfaces or sterilization of water.
In this protocol, we give a straightforward approach to solubilizing CdTe QDs with mercaptopropionic acid (MPA). The QDs are ready to use within an hour. We then demonstrate coupling to an antimicrobial agent.
The second part of the protocol demonstrates a 96-well bacterial inhibition assay using the conjugated and unconjugated QDs. The optical density is read over many hours, permitting the effects of QD addition and light exposure to be evaluated immediately as well as after a recovery period. We also illustrate a colony count for quantifying bacterial survival.

Nanoparticles such as semiconductor quantum dots (QDs) can be used to create photoactivatable agents for anti-microbial or anti-cancer applications. This technique shows how to water-solubilize cadmium telluride (CdTe) QDs, conjugate them to an antibiotic, and perform a bacterial inhibition assay based upon growth curves and plate count.

Solubilisation et Bio-conjugaison de Quantum Dots et des tests de toxicité bactériennes par la courbe de croissance et le comte Plate

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. ...

Recherche

Bio-ingénierie

Cell Labeling and Targeting with Superparamagnetic Iron Oxide Nanoparticles

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the target site while minimizing deleterious effects to off-target sites. Magnetic cell targeting is an efficient, safe, and straightforward delivery technique. Superparamagnetic iron oxide nanoparticles (SPION) are biodegradable, biocompatible, and can be endocytosed into cells to render them responsive to magnetic fields. The synthesis process involves creating magnetite (Fe3O4) nanoparticles followed by high-speed emulsification to form a poly(lactic-co-glycolic acid) (PLGA) coating. The PLGA-magnetite SPIONs are approximately 120 nm in diameter including the approximately 10 nm diameter magnetite core. When placed in culture medium, SPIONs are naturally endocytosed by cells and stored as small clusters within cytoplasmic endosomes. These particles impart sufficient magnetic mass to the cells to allow for targeting within magnetic fields. Numerous cell sorting and targeting applications are enabled by rendering various cell types responsive to magnetic fields. SPIONs have a variety of other biomedical applications as well including use as a medical imaging contrast agent, targeted drug or gene delivery, diagnostic assays, and generation of local hyperthermia for tumor therapy or tissue soldering.

Targeted cell delivery is useful in a variety of biomedical applications. The goal of this protocol is to use superparamagnetic iron oxide nanoparticles (SPION) to label cells and thereby enable magnetic cell targeting approaches for a high degree of control over cell delivery and localization.

Cellule étiquetage et le ciblage des nanoparticules d&#39;oxyde de fer Superparamagnetic

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the ...

Solid Lipid Nanoparticles (SLNs) for Intracellular Targeting Applications

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter cellular signaling and gene expression. In a previous investigation, the synthesis of ultra-small solid lipid nanoparticles (SLNs) for topical drug delivery and biomarker detection applications was demonstrated. SLNs are a well-studied example of a nanoparticle delivery system that has emerged as a promising drug delivery vehicle. In this study, SLNs were loaded with a fluorescent dye and used as a model to investigate particle-cell interactions. The phase inversion temperature (PIT) method was used for the synthesis of ultra-small populations of biocompatible nanoparticles. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylphenyltetrazolium bromide (MTT) assay was utilized in order to establish appropriate dosing levels prior to the nanoparticle-cell interaction studies. Furthermore, primary human dermal fibroblasts and mouse dendritic cells were exposed to dye-loaded SLN over time and the interactions with respect to toxicity and particle uptake were characterized using fluorescence microscopy and flow cytometry. This study demonstrated that ultra-small SLNs, as a nanoparticle delivery system, are suitable for intracellular targeting of different cell types.

Solid Lipid Nanoparticles SLNs for Intracellular Targeting Applications

In this study, a method for synthesizing ultra-small populations of biocompatible nanoparticles was described, as well as several in vitro methods by which to assess their cellular interactions.

Solide Lipid nanoparticules (SLN) Applications pour le ciblage intracellulaire

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter ...

A Rapid and Quantitative Fluorimetric Method for Protein-Targeting Small Molecule Drug Screening

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold nanoclusters (Au NCs) within the drug-loaded protein, based on the differential fluorescence signal emitted by the Au NCs. Albumin proteins such as human serum albumin (HSA) and bovine serum albumin (BSA) are selected as the model proteins. Four small molecular drugs (e.g., ibuprofen, warfarin, phenytoin, and sulfanilamide) of different binding affinities to the albumin proteins are tested. It was found that the formation rate of fluorescent Au NCs inside the drug loaded albumin protein under denaturing conditions (i.e., 60 &#176;C or in the presence of urea) is slower than that formed in the pristine protein (without drugs). Moreover, the fluorescent intensity of the as-formed NCs is found to be inversely correlated to the binding affinities of these drugs to the albumin proteins. Particularly, the higher the drug-protein binding affinity, the slower the rate of Au NCs formation, and thus a lower fluorescence intensity of the resultant Au NCs is observed. The fluorescence intensity of the resultant Au NCs therefore provides a simple measure of the relative binding strength of different drugs tested. This method is also extendable to measure the specific drug-protein binding constant (KD) by simply varying the drug content preloaded in the protein at a fixed protein concentration. The measured results match well with the values obtained using other prestige but more complicated methods.

A protocol for small molecular drug screening based on in-situ synthesis of ultrasmall fluorescent gold nanoclusters (Au NCs) using drug-loaded protein as template is presented. This method is simple to determine the binding affinity of drugs to a target protein by a visible fluorescent signal emitted from the protein-templated Au NCs.

Un rapide et quantitative Méthode fluorimétrique pour Small Molecule dépistage du médicament protéique Ciblage

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold ...

Correlative Light- and Electron Microscopy Using Quantum Dot Nanoparticles

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using widefield fluorescence light microscopy and transmission electron microscopy (TEM). To demonstrate the protocol we have immunolabeled ultrathin epoxy sections of human somatostatinoma tumor using a primary antibody to somatostatin, followed by a biotinylated secondary antibody and visualization with streptavidin conjugated 585 nm cadmium-selenium (CdSe) quantum dots (QDs). The sections are mounted on a TEM specimen grid then placed on a glass slide for observation by widefield fluorescence light microscopy. Light microscopy reveals 585 nm QD labeling as bright orange fluorescence forming a granular pattern within the tumor cell cytoplasm. At low to mid-range magnification by light microscopy the labeling pattern can be easily recognized and the level of non-specific or background labeling assessed. This is a critical step for subsequent interpretation of the immunolabeling pattern by TEM and evaluation of the morphological context. The same section is then blotted dry and viewed by TEM. QD probes are seen to be attached to amorphous material contained in individual secretory granules. Images are acquired from the same region of interest (ROI) seen by light microscopy for correlative analysis. Corresponding images from each modality may then be blended to overlay fluorescence data on TEM ultrastructure of the corresponding region.

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of epoxy embedded human pathology tissue. We employ commercial antibody fragment conjugated QDs that are visualized by widefield fluorescence light microscopy and transmission electron microscopy.

Corrélative Light- et Microscopie électronique Utilisation de Quantum Dot Nanoparticules

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using ...

Initial Evaluation of Antibody-conjugates Modified with Viral-derived Peptides for Increasing Cellular Accumulation and Improving Tumor Targeting

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used in cancer treatment and imaging due to increased cellular accumulation over current ACs. During early AC in vitro development, fluorescence techniques and radioimmunoassays are sufficient for determining intracellular localization, accumulation efficiency, and target cell specificity. Currently, there is no consensus on standardized methods for preparing cells for evaluating AC intracellular accumulation and localization. The initial testing of ACs modified with virus-derived peptides is critical especially if several candidates have been constructed. Determining intracellular accumulation by fluorescence can be affected by background signal from ACs at the cell surface and complicate the interpretation of accumulation. For radioimmunoassays, typically treated cells are fractionated and the radioactivity in different cell compartments measured. However, cell lysis varies from cell to cell and often nuclear and cytoplasmic compartments are not adequately isolated. This can produce misleading data on payload delivery properties. The intravenous injection of radiolabeled virus-derived peptide-modified ACs in tumor bearing mice followed by radionuclide imaging is a powerful method for determining tumor targeting and payload delivery properties at the in vivo phase of development. However, this is a relatively recent advancement and few groups have evaluated virus-derived peptide-modified ACs in this manner. We describe the processing of treated cells to more accurately evaluate virus-derived peptide-modified AC accumulation when using confocal microscopy and radioimmunoassays. Specifically, a method for trypsinizing cells to remove cell surface bound ACs. We also provide a method for improving cellular fractionation. Lastly, this protocol provides an in vivo method using positron emission tomography (PET) for evaluating initial tumor targeting properties in tumor-bearing mice. We use the radioisotope 64Cu (t1/2 = 12.7 h) as an example payload in this protocol.

Viral-derived peptides coupled to antibody-conjugates (ACs) is an approach gaining momentum due to the potential of delivering molecular payloads with increased tumor cell accumulation. Utilizing common methods to evaluate peptide conjugation, AC and payload intracellular accumulation, and tumor targeting, this protocol helps researchers during the key initial development phases.

Évaluation initiale des anticorps-conjugués modifié avec Peptides viraux dérivés pour accroître l’Accumulation cellulaire et améliorer le ciblage tumoral

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used ...

20 mJ, 1 ps Yb:YAG Thin-disk Regenerative Amplifier

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with turn-key performance and microjoule-level pulse energy is used to seed the regenerative chirped-pulse amplifier. The amplifier is placed in airtight housing. It operates at room temperature and exhibits stable operation at a 5 kHz repetition rate, with a pulse-to-pulse stability less than 1%. By employing a 1.5 mm-thick beta barium borate crystal, the frequency of the laser output is doubled to 515 nm, with an average power of 70 W, which corresponds to an optical-to-optical efficiency of 70%. This superior performance makes the system an attractive pump source for optical parametric chirped-pulse amplifiers in the near-infrared and mid-infrared spectral range. Combining the turn-key performance and the superior stability of the regenerative amplifier, the system facilitates the generation of a broadband, CEP-stable seed. Providing the seed and pump of the optical parametric chirped-pulse amplification (OPCPA) from one laser source eliminates the demand of active temporal synchronization between these pulses. This work presents a detailed guide to set up and operate a Yb:YAG thin-disk regenerative amplifier, based on chirped-pulse amplification (CPA), as a pump source for an optical parametric chirped-pulse amplifier.

A protocol for the operation of a high-energy, high-power optical parametric chirped pulse amplifier pump source based on an Yb:YAG thin-disk regenerative amplifier is presented here.

20 mJ, 1 ps Yb: YAG amplificateur régénérateur à disque mince

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with ...

Synthesis of Monocyte-targeting Peptide Amphiphile Micelles for Imaging of Atherosclerosis

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. Atherosclerosis is also the leading cause of sudden death and myocardial infarction, instigated by unstable plaques that rupture and occlude the blood vessel without warning. Current imaging modalities cannot differentiate between stable and unstable plaques that rupture. Peptide amphiphiles micelles (PAMs) can overcome this drawback as they can be modified with a variety of targeting moieties that bind specifically to diseased tissue. Monocytes have been shown to be early markers of atherosclerosis, while large accumulation of monocytes is associated with plaques prone to rupture. Hence, nanoparticles that can target monocytes can be used to discriminate different stages of atherosclerosis. To that end, here, we describe a protocol for the preparation of monocyte-targeting PAMs (monocyte chemoattractant protein-1 (MCP-1) PAMs). MCP-1 PAMs are self-assembled through synthesis under mild conditions to form nanoparticles of 15 nm in diameter with near neutral surface charge. In vitro, PAMs were found to be biocompatible and had a high binding affinity for monocytes. The methods described herein show promise for a wide range of applications in atherosclerosis as well as other inflammatory diseases.

This paper presents a method involving the synthesis and characterization of monocyte-targeting peptide amphiphile micelles and the corresponding assays to test for biocompatibility and ability of the micelle to bind to monocytes.

Synthèse de ciblage de Monocyte Peptide Amphiphile Micelles pour l’imagerie de l’athérosclérose

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. ...

Synthesis of Functionalized 10-nm Polymer-coated Gold Particles for Endothelium Targeting and Drug Delivery

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting and drug delivery are some of the applications of these AuNPs, but endothelial extracellular matrices&#39; defensive properties hamper particle uptake. To address this issue, we describe a synthesis method for ultrasmall gold nanoparticles to improve vascular delivery, with customizable functional groups and polymer lengths for further adjustments. The protocol yields 2.5 nm AuNPs that are capped with tetrakis(hydroxymethyl)phosphonium chloride (THPC). The replacement of THPC with hetero-functional polyethylene glycol (PEG) on the surface of the AuNP increases the hydrodynamic radius to 10.5 nm while providing various functional groups on the surface. The last part of the protocol includes an optional addition of a fluorophore to allow the AuNPs to be visualized under fluorescence to track nanoparticle uptake. Dialysis and lyophilization were used to purify and isolate the AuNPs. These fluorescent nanoparticles can be visualized in both in vitro and in vivo experiments due to the biocompatible PEG coating and fluorescent probes. Additionally, the size range of these nanoparticles render them an ideal candidate for probing the glycocalyx without disrupting normal vasculature function, which may lead to improved delivery and therapeutics.

We describe a method of synthesizing biocompatible 10-nm gold nanoparticles, functionalized by coating poly-ethylene glycol onto the surface. These particles can be used in vitro and in vivo for delivering therapeutics to nanoscale cellular and extracellular spaces that are difficult to access with conventional nanoparticle sizes.

Synthèse des fonctionnalisées 10 nm revêtement polymère des particules d’or pour le ciblage de l’endothélium et MEDICAMENTS

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting ...

Targeting Neuronal Fiber Tracts for Deep Brain Stimulation Therapy Using Interactive, Patient-Specific Models

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for movement disorders and is being applied to a growing number of disorders. Computational modeling has been successfully used to predict the clinical effects of DBS; however, there is a need for novel modeling techniques to keep pace with the growing complexity of DBS devices. These models also need to generate predictions quickly and accurately. The goal of this project is to develop an image processing pipeline to incorporate structural magnetic resonance imaging (MRI) and diffusion weighted imaging (DWI) into an interactive, patient specific model to simulate the effects of DBS. A virtual DBS lead can be placed inside of the patient model, along with active contacts and stimulation settings, where changes in lead position or orientation generate a new finite element mesh and solution of the bioelectric field problem in near real-time, a timespan of approximately 10 seconds. This system also enables the simulation of multiple leads in close proximity to allow for current steering by varying anodes and cathodes on different leads. The techniques presented in this paper reduce the burden of generating and using computational models while providing meaningful feedback about the effects of electrode position, electrode design, and stimulation configurations to researchers or clinicians who may not be modeling experts.

The goal of this project is to develop an interactive, patient-specific modeling pipeline to simulate the effects of deep brain stimulation in near real-time and provide meaningful feedback as to how these devices influence neural activity in the brain.

Ciblage des fibres neuronales Tracts pour la thérapie de Stimulation cérébrale profonde à l’aide de modèles interactifs, spécifiques à un Patient

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for ...