Finanzierung durch DOD W81XWH-1023.10.01 (ZJG), Grant P50 GM081879 von der UCSF Zentrum für Systemtechnik und Synthetische Biologie (ZJG), NIH 5R21EB015088-02 (YJ) und NIH 1R21EB018044 (ZJG &amp; YJ) vorgesehen ist. DS wurde von Human Frontier Science Program Greifendes Postdoc Forschungsstipendium unterstützt.

1. Herstellung von monovalente Quantenpunkte <ol><li> Phasentransfer von QDs von organischer zu wässriger Phase <ol><li> Verdünnen 200 ul einer Lösung von 1 uM organische Phase QDs mit 400 ul Chloroform in einer 5-ml-Glasflasche. </li><li> Mischen 400 ul einer 0,3 M Tetrabutylammoniumbromid (TBAB) Chloroform-Lösung mit 36 ul ordentlich mPEG Thiol (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) und schütteln O / N. </li><li> Fügen Sie 800 ul einer 0,2 M NaOH-Lösung und schütteln für 30 Sekunden. Ein Phasentransfer erfolgt innerhalb von wenigen Minuten, nach der Übertragung der Farbpartikel in die wässrige Phase über dem dichteren organischen Phase zeigte. </li><li> Wenn die Teilchen aggregieren in einer dritten Phase zwischen den wässrigen und organischen Phasen, erhöhen die Inkubationszeit mit dem MPEG Thiol. Wenn die wässrige Phase klar bleibt, haben die QDs nicht Phasentransfer (siehe Abbildung 3a). Alternativ erhöhen Sie die concentRation von mPEG Thiol in Schritt 2, um schlechte Phasen-Transfer zu lindern. </li><li> Wiederherstellung der (farbigen) wässrige Phase und dann konzentrieren die gesammelten QDs mit einem Centricon-Spin-Säule (30 kDa Molekulargewicht cut-off) auf 1 ml. </li><li> Hinzufügen des konzentrierten QD Lösung in eine Sephadex NAP10 Säule mit 10 mM Tris-Puffer, enthaltend 30 mM NaCl (pH 8,0) äquilibriert. Eluieren QDs mit 1,5 ml Elutionspuffer durch die Schwerkraft fließen. </li><li> Messen die Konzentration von QDs mit Absorptionsspektroskopie bei 350 nm auf. </li></ol></li><li> Vorbereitung der mQDs <ol><li> Kauf (oder synthetisieren) ptDNA. Dieses Protokoll verwendet die Sequenz 5&#39;-A S 50 (CT) 10 (ACTG) 5 -3 &#39;(siehe Tabelle 1). </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> DNA </td><td> Folge </td></tr><tr><td> 5&#39;-A S 50 (CT) 10 (ACTG) 5 </sub&gt; -3 &#39; </td><td> A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG </td></tr><tr><td> 5&#39;-NH 2 - (CT) 10 (CAGT) 5 -3 &#39; </td><td> NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr><tr><td> BG-DNA </td><td> BG / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr></tbody></table> Tabelle 1. DNA-Sequenzen verwendet werden, um zu produzieren und Ziel mQDs. <ol start="2" style="margin-left: 40px;"><li> Vorbereitung 1 ml von 100 nM QD-Lösung in 10 mM Tris-Puffer, enthaltend 30 mM NaCl (pH 8). </li><li> Add-Drop-weise 500 ul der 100 nM ptDNA Lösung der wässrigen QDs für 1 min unter kräftigem Rühren. Rühren oder legen Sie auf einem Schüttler für eine weitere 9 Stunden. Hinweis: Dies sollte theoretisch produzieren eine 1: 2-Verhältnis von ptDNA: QD. Allerdings ist die tatsächliche Stöchiometrie nie perfekt - in der Regel das Ergebnis ist näher an 1: 1,5. Um ein 1: 1-Verhältnis von ptDNA: QD ist Densitometrie nach Gelelektrophorese notwendig, das genaue Verhältnis der Konjugation angesichts der bekannten Volumina oben verwendet quantifizieren. </li><li> Entfernen ~ 10 ul des Gemisches auf QD auf einem analytischen Agarosegel laufen gelassen. Auch entfernen, eine ähnliche Konzentration von unkonjugierten QDs in wässriger Phase (aus Schritt 1.2.1). <ol><li> Fügen Sie ~ 2 μ; L 6x Ficoll-Ladepuffer (Lösungsdichte zu erhöhen), und führen diese beiden Proben zusammen auf einem 0,8% wt / v Agarose-Gel in Natriumboratpuffer für 15 min bei 150 V eine einzige Bande in der Kontrollspur unkonjugierten Migration in der Nähe die gut, und zwei Bands in der Spur mit konjugierten QDs gesehen (siehe Gele in Abbildung 2b). </li></ol></li><li> Berechne den unkonjugierten QD Fraktion mit der relativen Intensität der beiden Banden (siehe Gleichung in 2B). Dann nutzen Sie diesen Bruch, um das zusätzliche Volumen von 100 erforderlich ist, um die Anzahl der Quantenpunkte entsprechen nM ptDNA Lösung zu berechnen. </li><li> Wiederholen Sie die Schritte 1.2.3 noch einmal mit diesem berechneten Volumen oder bis zum Zusammenbruch konjugierten QDs in einer einzigen Bande auf dem Gel, was eine vollständige Konjugation von allen QDs 1.2.5. </li><li> 100 ul 10 mM (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carboxy PEG6 Alkanthiol) in 10 mM Tris-Puffer Containing 30 mM NaCl (pH 8) auf die konjugierten mQDs oben hergestellt, und schüttelt 10 min. Hinweis: Diese PEG-Liganden zu passivieren, die QD-Oberfläche. Eine längere PEG wird besser-Passivieren der QDs, es wird jedoch auch ihre Größe zu erhöhen. Die hydrophobe Alkan Thiolfunktionalität hat eine viel höhere Affinität zu den QDs, in der Summe als für Phasentransfer der weniger hydrophoben PEG-Thiol. Daher erlauben dies nicht Schritt zu lang, um fortzufahren, oder ptDNA wird von der Alkan-PEG-Thiol ersetzt werden. Nach einer ~ 30 min Inkubation wird ein erheblicher Anteil der DNA aus den QDs (3B) vertrieben wurden. </li><li> Um überschüssige Alkan PEG-Thiol zu entfernen, mit 0,5 ml der QD-Lösung auf eine Sephadex NAP5 Säule mit Elutionspuffer äquilibriert (10 mM Tris-Puffer, enthaltend 30 mM NaCl). Sammle die mQDs mit 1,0 ml Elutionspuffer durch Schwerkraftströmung. </li><li> Konzentrieren die gesammelten QDs mit einem Centricon-Spin-Säule (30 kDa). Bewahren Sie diese mQDs bei 4 ° C für Monate. Fr nichteeze ihnen. Anmerkung: Wenn eine farbige Pellet in dem Boden des Rohres gesehen, haben die Punkte zusammengefasst und nicht mehr wahrscheinlich ist verwendbar. </li></ol> 2. Herstellung von Targeting (Benzylguanine-) DNA <ol><li> Produzieren oder kaufen, Amin-terminierte DNA. Dieses Protokoll verwendet die Sequenz 5&#39;-NH 2 - (CT) 10 - (CAGT) 5 -3 &#39;(siehe Tabelle 1). Die Poly-Linker CT erhöht Zugänglichkeit Funktionalität tief in der Glykokalyx begraben, aber möglicherweise nicht für alle Anwendungen benötigt werden. Wenn es Zugang zu einem DNA-Synthesizer erzeugen aminomodifizierten DNA unter Verwendung einer geeigneten 5&#39;-Amino-Modifikator (5&#39;-Amino-Modifier C6). </li><li> Auflösen BG-N-hydroxysuccinimid (NHS-BG) in trockenem Dimethylsulfoxid (DMSO) in einer Konzentration von 10 mg / ml. Hinweis: BG-NHS wird Wasser aus der Luft aufnehmen und führen zu Hydrolyse des reaktiven NHS-Ester, insbesondere in hygroskopischen Lösungsmittel wie DMSO und Dimethylformamid (DMF). BG-NHS ist beste Geschäftd bei -80 ° C als Pulver in einem eigenen Gefäß in einem zweiten Behälter, enthaltend Trockenmittel. Warm vor dem Öffnen der Fläschchen RT. Alternativ sofort aliquotiert zur Einzelnutzung der BG-NHS-Ester in ein trockenes polares Lösungsmittel und frieren bei -80 ° C oder vollständig reagieren mit der Amin-DNA in Schritt 2.2. </li><li> Reagieren, indem das BG-NHS in DMSO aus Schritt 2.1 mit Amin-terminierten DNA in HEPES (4-(2-hydroxyethyl)-1-piperazinethansulfonsäure)-gepufferter (pH 8,5) Wasser. In einer typischen Reaktion 20 ul 10 mg / ml BG-NHS in DMSO mit 2 ul 2 mM NH 2 - (CT) 10 - (CAGT) 5 in 58 ul entionisiertem Wasser mit 20 ul 0,5 M HEPES pH 8,5 gepuffert. Zuführen Reaktionen in einem 1,5-ml-Mikrozentrifugenröhrchen. Mischen schnell wie die Reaktion schnell und müssen mit NHS-Ester-Hydrolyse zu konkurrieren. </li><li> Beschallen für 5-10 min eine gute Durchmischung zu gewährleisten. Inkubieren ~ 1 h bei RT. Das stöchiometrische Verhältnis von BG: DNA kann verändert werden, um die Reaktion zu vervollständigen. </li><li&gt; Desalt die Reaktion mit einem Standard-NAP5 Spalte in 100 mM Triethylamin (TEAA, pH 7). </li><li> Reinige den BG-DNA von der nichtumgesetzten Amin-DNA mittels Umkehrphasen-HPLC ausgeführt 100 mM TEAA: Acetonitril (ACN)-Gradienten von 8% bis 95% Acetonitril über 30 min. Das nicht umgesetzte Amin-DNA wird vor der BG-DNA zu eluieren. Sammeln Sie die BG-DNA-Fraktion in einem konischen Rohr. <ol><li> Verwenden Sie ein C 18 Zorbax Spalte für Standard-Oligonukleotid-Reinigung und des folgenden Gradienten: 0 → 15 min: 8 → 30% ACN; 15 → 21 min: 30-90% ACN; 21 → 25 min: 90 → 8% ACN; 25 → 30 min: 8% ACN; </li></ol></li><li> Einfrieren in flüssigem Stickstoff und lyophilisiert die gesammelten Fraktion. Resuspendieren DNA in VE-Wasser. Um besonders vorsichtig sein, lyophilisieren zwei weitere Male, um Rest TEAA entfernen. Rest TEAA kann bei höheren Konzentrationen für Zellen toxisch sein. </li><li> Resuspendieren lyophilisiert BG-DNA in Wasser, und achten Sie auf die Seiten der th waschenE Rohr, und mit Wasser auf ~ 25 uM Lager. Aliquoten und bei 4 ° C. Die Proben wurden für ~ 9 Monate ohne merkliche Verschlechterung gespeichert. </li></ol> 3. Kennzeichnung lebenden Zellen mit monovalenten Quantum Dots <ol><li> Gegebenenfalls Passivieren der mQDs unmittelbar vor einem Abbildungsexperiment unter Verwendung von Reagenzien wie Casein (0,5%) oder Rinderserumalbumin (BSA, 1-3%). </li><li> Platte Zellen, die den SNAP-markierten Protein auf Totalreflexions-Fluoreszenz (TIRF) -Qualität Glas ausdrücken. In diesem Experiment verwenden wir eine U2OS-Zelllinie ein SNAP-tag Notch1-Rezeptor und hochwertige Glasflächen ausdrückt. </li><li> Nachdem die Zellen auf das Glas (~ 24 h) angebracht sind, entfernen Wachstumsmedien, waschen mit PBS und Inkubation der Zellen für 10-30 min bei RT in ~ 100-150 ul PBS oder Zell Medien mit ~ 1 uM BG DNA aus Schritt 2.6. </li><li> Nach Inkubation mit BG, sorgfältig waschen die Zellen mit PBS oder Zell Medien. Inkubieren Sie die Zellen für ca. 5-10 Minuten mit thin Schritt 1.2.9 hergestellten E mQDs (und gegebenenfalls die in Schritt 3.1 passiviert). </li><li> Optional, waschen Sie die ungebundenen mQDs und geben die Zellen zu einem Puffer / Medien sowohl für Bildgebung und Kultur. Für Zellen, die in TIRF-Modus abgebildet werden sollten, war eine letzte Waschschritt oft unnötig, da ungebundene mQDs in Lösung im Vergleich mit gebundenen mQDs als während der Analyse nicht nachweisbar zu sein diffundiert, so schnell. </li></ol> 4. Mikroskopie &amp; Analysis <ol><li> Bild die Zellen mit Hilfe eines TIRF-Mikroskop. Hinweis: Der Umfang muss trennbar Anregungs-und Emissionsfilter oder einen benutzerdefinierten QD Filterwürfel haben. QD am besten Anregung mit einer geringen Wellenlängen-Lasers (405 oder 488 nm). QDs unterschiedlicher Durchmesser haben charakteristische Emissionswellenlängen, in der Regel mit einer großen Stokes-Verschiebung verbunden. </li><li> Aufgrund der Helligkeit des mQDs, sammeln Bilder bei hohen Bildraten in TIRF, während die Abbildung der basalen Seite von einer lebenden Zelle. Hinweis: Alternativ können Einzelmoleküldynamik Follo seinbei anderen Brennebenen mit einer sich drehenden Scheibe konfokalen Mikroskop heiraten. Automatisierte Einzelpartikel-Tracking-Software ist in der Regel auf genau die Verfolgung der hellen und photo mQDs erfolgreich. </li></ol>

<ol>
	<li>Sako, Y., Minoghchi, S., Yanagida, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+imaging+of+EGFR+signaling+on+the+surface+of+living+cells.">Single-molecule imaging of EGFR signaling on the surface of living cells.</a> Nature Cell Biology. 2 (3), 168-172 (2000).</li><li>Luo, W., He, K., Xia, T., Fang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+monitoring+in+living+cells+by+use+of+fluorescence+microscopy.">Single-molecule monitoring in living cells by use of fluorescence microscopy.</a> Analytical and Bioanalytical Chemistry. 405 (1), 43-49 (2013).</li><li>Chung, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+control+of+EGF+receptor+activation+by+reversible+dimerization+on+living+cells.">Spatial control of EGF receptor activation by reversible dimerization on living cells.</a> Nature. 464 (7289), 783-787 (2010).</li><li>Fern&#225;ndez-Su&#225;rez, M., Ting, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+probes+for+super-resolution+imaging+in+living+cells.">Fluorescent probes for super-resolution imaging in living cells.</a> Nature Reviews Molecular Cell Biology. 9 (12), 929-943 (2008).</li><li>Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photooxidation+and+photobleaching+of+single+CdSe/ZnS+quantum+dots+probed+by+room-temperature+time-resolved+spectroscopy.">Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy.</a> The Journal of Physical Chemistry B. 105 (35), 8281-8284 (2001).</li><li>Pinaud, F., Clarke, S., Sittner, A., Dahan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+cellular+events,+one+quantum+dot+at+a+time.">Probing cellular events, one quantum dot at a time.</a> Nature Methods. 7 (4), 275-285 (2010).</li><li>Michalet, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantum+dots+for+live+cells,+in+vivo+imaging,+and+diagnostics.">Quantum dots for live cells, in vivo imaging, and diagnostics.</a> Science. 307 (5709), 538-544 (2005).</li><li>Howarth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monovalent,+reduced-size+quantum+dots+for+imaging+receptors+on+living+cells.">Monovalent, reduced-size quantum dots for imaging receptors on living cells.</a> Nature Methods. 5 (5), 397-399 (2008).</li><li>Iyer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aromatic+aldehyde+and+hydrazine+activated+peptide+coated+quantum+dots+for+easy+bioconjugation+and+live+cell+imaging.">Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging.</a> Bioconjugate Chemistry. 22 (6), 1006-1011 (2011).</li><li>Tikhomirov, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+programming+of+quantum+dot+valency,+self-assembly+and+luminescence.">DNA-based programming of quantum dot valency, self-assembly and luminescence.</a> Nature Nanotechnology. 6 (8), 485-490 (2011).</li><li>Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+targeted+monovalent+quantum+dots+by+steric+exclusion.">Formation of targeted monovalent quantum dots by steric exclusion.</a> Nature Methods. 10 (12), 1203-1205 (2013).</li><li>Gartner, Z. J., Bertozzi, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmed+assembly+of+3-dimensional+microtissues+with+defined+cellular+connectivity.">Programmed assembly of 3-dimensional microtissues with defined cellular connectivity.</a> Proceeding of the National Academy of Sciences USA. 106 (12), 4606-4610 (2009).</li><li>Selden, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+programmed+cell+adhesion+with+membrane-anchored+oligonucleotides.">Chemically programmed cell adhesion with membrane-anchored oligonucleotides.</a> Journal of the American Chemical Society. 134 (2), 765-768 (2012).</li></ol>

The authors have nothing to disclose.

Die Modularität des MQD Design ermöglicht einen erhöhten Grad der experimentellen Flexibilität. Zum Beispiel kann eine Vielzahl von mQDs schnell in einzigartige Farben ermöglicht die gleichzeitige Darstellung von mehreren Zielen hergestellt werden. Die ssDNA-Zielsequenz können zu Proteinen mQDs lenken, Zucker 12, Lipide und Flächen 13. Eine Reihe von enzymatischen Tags sind mit orthogonaler Reaktivität, so dass mehrere Ziele gleichzeitig mit unterschiedlich gezielte mQDs abgebildet werden. Neben der Ausrichtung mit der SNAP-Tag, war auch die Kennzeichnung von Zielproteinen mit mQDs mit der CLIP-Tag, das HALO-Tag und biotinylierte Proteine ​​erfolgreich. Dieses Protokoll zeigt die spezifische Markierung von einem Oberflächenrezeptor auf lebende Zellen mit diesen mQDs, aber das Protokoll könnte leicht zu einer Reihe von verschiedenen Kontexten angepasst werden. Die erhebliche methodische Einblick in die Herstellung mQDs mit definierten Wertigkeit ist, dass ~ 50 Phosphorothioat- gebundenenBasen sind erforderlich, um die Quantenpunkte wickeln (und damit verhindern zwei Moleküle gleichzeitig Bindung). Eine Poly-A-S 50-Sequenz reproduzierbar und stabil gebunden 605 nm QDs von Life Technologies. Obwohl dieses Produkt wurde eingestellt, ist die sterische Ausschluss Strategie verallgemeinerbar zu ähnlichen Produkten von anderen Anbietern mit unterschiedlichen Größen, Formen, spektralen Eigenschaften. Die Effizienz und Stabilität der ptDNA-wickelte QDs hängt entscheidend von der Oberflächenchemie und Struktur der Quantenpunkte. Daher wird der Erfolg eines Protokolls von der kommerziellen Quelle und der chemischen Struktur der Quantenpunkte abhängen. Für die Zwecke dieses Protokoll drei Hauptpunkte der Unterschied existiert zwischen verschiedenen kommerziellen Quellen QD: ein Unterschied in der Phasentransferbedingungen erforderlich; ein Unterschied in der Stärke der ersten PEG-Thiol-Liganden-Bindung, möglicherweise behindern Verschiebung der ptDNA; und ein Unterschied in der Menge des belichteten CdSe-Kern, der LEAnzeige an der Löschung der QD von der MPEG-Thiol Phasentransferbedingungen. Wie der Veröffentlichung, QDs mit der besten Struktur für die Produktion von mQDs sind 4-10 nm CdSe / ZnS Kern / Schale-QDs von Life Technologies bei 545, 585, 605 &amp; 625 nm (Abbildung 2A) gekauft mit Emissionsspektren. QD auf der Basis der &quot;Klare&quot;-Formulierung (545, 605, etc.) zu löschen bei Zugabe von mPEG Thiol und sind nicht geeignet für diese Anwendung. QDs von Aldrich und Ocean Nanotech gut funktionieren, benötigen aber mehr Phasentransferschritte und Vorbehandlung mit Trioctylphosphinoxid. Dieses Protokoll wurde für QDs von Life Technologies optimiert. Die Poly-A-Phosphorothioat-Sequenz verwendet, um die Quantenpunkte wickeln mit einer nativen 20-mer DNA-Schwanz, der die Sequenz von (ACTG) 5, an die ein Targeting-Strang hybridisieren beendet. Diese Sequenz ist praktisch, da es wenig bis gar keine Sekundärstruktur und wird hybridiz bleibenED bei 37 ° C in PBS. Wenn es Zugang zu einem DNA-Synthesizer, kann die ptDNA synthetisiert und dann durch Umkehrphasen-Hochleistungs-Flüssigkeitschromatographie (HPLC) gereinigt, unter Verwendung eines C 8-Säule. Die ptDNA wird später auf der HPLC als gleichwertige Oligonukleotide mit einer nativen Rückgrat eluieren. Wir in der Regel verlassen die 5 &#39;DMT-Schutzgruppe an unserer Phosphorothioatoligonukleotide nach der Reinigung. Passivierung der ptDNA-wickelte QDs ist in der Regel, um kolloidale Stabilität der QDs zu verbessern und die Hintergrundbindung für die meisten experimentellen Anwendungen erforderlich ist. Das Protokoll verwendet eine PEG-Schicht, um die QDs zu passivieren. Carboxy PEG Alkanthiol mit zusätzlichen PEG-Einheiten ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, Carboxy-PEG12 Alkanthiol) sieht der Hintergrund reduziert, wenn die längeren PEGs sind beide größer, und in der Regel teurer. mQDs mit Carboxy PEG Alka beschichtetne Thiolliganden sind in physiologischen Puffern sehr stabil, wie Phosphat-gepufferte Salzlösungen und Kulturmedien. Langfristigen Lagerung (&gt; 8 Monate) von mQDs bei 4 ° C zeigte keine signifikante Aggregation oder ptDNA Ablösung 11. In Abhängigkeit von dem Versuch, PEG Passivierung der QD allein nicht immer ausreichend nicht-spezifische Bindung der mQDs reduzieren. Inkubieren sowohl Zellen und mQDs in phosphatgepufferter Salzlösung (PBS), enthaltend 3% BSA für 20 min vor dem Einsatz verringert wesentlichen nicht-spezifische Bindung an Zellen, obwohl es die scheinbare hydrodynamische Radius der mQDs von ~ 50%. Passivierung mit 0,5% Casein reduziert die nicht-spezifische Bindung noch weiter aber die scheinbare Größe in einem größeren Ausmaß als BSA erhöht. Das 5&#39;-Ende eines DNA-Strangs komplementär zu den mQDs kann modifiziert werden, um gezielt aus einer Anzahl von verschiedenen Biomolekülen ermöglichen. Es gibt eine Anzahl von etablierten Techniken zur Verfügung, um Proteine ​​kovalent zu modifizieren, lipids &amp; Zucker mit Einzelstrang-DNA (ssDNA). Solange die ssDNA extrazellulär dargestellt, ist es zugänglich löslichen mQDs. mQDs mit den vorstehenden Sequenzen schnell hybridisieren mit komplementären DNA-Strang unter Zellkulturbedingungen. Ein 10-20x Poly (CT) Abstandshalter zwischen dem ptDNA und der Targeting-Sequenz für eine effiziente Ziel erforderlich, um die Bindungssequenz über der dicken und negativ geladenen Glykokalyx der Zelle erhöhen zu sein. Aus diesem Protokoll haben wir uns für einen BG-DNA mit einer komplementären Sequenz von (CAGT) 5, die sowohl zu den mQDs hybridisiert und kovalent selbst einen Link zu einer SNAP-tag-Protein für eine schnelle und spezifische Markierung produzieren wird. Ein ähnliches Protokoll-Funktionen auch für die Kopplung anderen NHS-Ester zu Amino-modifizierte Oligonukleotide. Für Einzelmolekülbildgebung, eine geringe Dichte der Markierung in der Regel erforderlich, um einzelne Moleküle zu lösen. Eine endgültige MQD Konzentration von ~ 0,5 nm in PBS mit Passivierungsmittelsist ein gutes Ziel. Allerdings führte unter-Markierung der Zellen diese hohen Verdünnungen manchmal. Wenn dies auftritt, können zusätzliche MQD zugegeben, bis eine optimale Dichte der Markierung beobachtet werden. Im Fall von SNAP-markierten menschlichen Notch1 Konzentrationen von&gt; 10 nM MQD erzeugt dichte Markierung von Zellen unter 0,5 nM MQD in Folge der Anbringung ~ 20 mQDs an der Grundfläche der Zielzelle (siehe Abbildung 4b). Zellmarkierung mit mQDs war stark abhängig von der Konfluenz der Zellen plattiert. Mäßig konfluenten Zellen nicht an ihren Grundflächen zu kennzeichnen. Zusammenfassend, ein einfaches Verfahren zur Erzeugung monovalenten und modulare QD wurde beschrieben. Diese mQDs finden in breite Palette von Live Cell Imaging-Anwendungen, wie durch Abbildung der Notch-Rezeptor auf Live-U2OS-Zellen demonstriert. Anwendbarkeit mQDs nicht auf diesen speziellen Fall beschränkt, sondern kann möglicherweise für andere zelluläre Ziele, wie andere Proteine, Nukleinsäuren und Enzymen verlängert werden.

Die Dynamik einzelner Moleküle an lebenden Zellen beiträgt, ihre biologische Funktion. Einzelmolekül-Fluoreszenz-Bildgebung ist eine beliebte Methode, um einzelne Molekül Dynamik auf der Zelloberfläche 1,2,3 studieren. Die am häufigsten verwendeten Bildgebungssonden in diesen Studien haben jedoch mehrere wesentliche Nachteile. Zum Beispiel herkömmliche organische Farbstoffe und fluoreszierende Proteine ​​liefern moderate Helligkeit, etwa 10 5 bis 10 6 M -1 cm -1, sind aber photochemisch instabil, Bleichen nach der Emission von etwa 10 5 bis 10 6 Photonen unter typischen Live-Cell-Imaging Bedingungen 4,5. Im Gegensatz dazu Halbleiter-Nanopartikel, häufig als Quantenpunkte (QP), sind deutlich heller und stabil, mit Extinktionskoeffizienten im Bereich von 10 6 bis 10 7 M -1 cm -1, und mehr als 10 7 -10 8 emittierten Photonen vor photoblEACHING 5. Die verbesserte Helligkeit und Photo QDs über organische Farbstoffe ermöglicht die Beobachtung von einzelnen Molekülen zu deutlich schnellere Bildwiederholraten und über wesentlich längere Flugbahnen 6. Trotz ihrer Vorteile und kommerzielle Verfügbarkeit, bleiben mehrere Verbindlichkeiten für diese leistungsfähige Imaging-Agenten. Erstens, sie schlecht definierten Ziel Wertigkeit, die Vernetzung der Biomoleküle gezielt 6 führen kann. Zweitens, sie haben in der Regel eine große hydrodynamische Größe (&gt; 20 nm), die Zugänglichkeit zu bestimmten zellulären Umgebungen überfüllten 7 begrenzt. Drittens, sie beschränkt Targeting Modularität 7. Mehrere Strategien sind versucht, diese Probleme anzugehen 8,9,10, aber im Allgemeinen erfordern spezielle Kenntnisse und Reagenzien zu implementieren. Um diese Probleme anzugehen, die vor kurzem beschrieben wir eine &quot;sterische Ausschlußchromatographie&quot; Strategie zur Herstellung einwertiger, klein, undmodulare QDs 11. Die QDs sind mit einem einzigen langen Phosphorothioat- DNA (ptDNA) Polymer gewickelt. Die ptDNA bindet an den QD-Oberfläche durch mehrere Zn-S-Wechselwirkungen zwischen oberflächenexponierten Zn-Atome und der Phosphorthioat-Gruppen des Polymers ptDNA. Ein einzelnes Polymer gebunden sterisch und elektrostatisch schließt die Bindung von zusätzlichen Mitteln des Polymers ohne Gesamtgröße des Partikels (ca. 2 nm) deutlich zu erhöhen. Alle Reagenzien sind im Handel erhältlich, Produkte in hoher Ausbeute gebildet wird, und das Verfahren erfordert nur Entsalzungsschritte zur Reinigung. Einmal markiert, QDs mit einem einzigen ptDNA (mQDs) binden an komplementäre DNA-Stränge Lager Targeting-Domains (zB Benzylguanin (BG), benzylcytosine oder Alkylhalogenide) gewickelt. Diese Funktionalitäten gezielt die mQDs spezifisch an enzymatischen Tags wie SNAP, CLIP-HALO, das genetisch mit dem interessierenden Protein fusioniert sind. Ein Protokoll für die Synthese, Targeting, und Live-Cell-Imaging von mQDs durch sterische Ausschluss produziert.

<table border="0" cellpadding="0" cellspacing="0" width="497">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:91px;">Comments/Description</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">mQD Production:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Phosphorothioate DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(A*)x50-(ACTG)x5</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Quantum Dots:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="127">
			<td height="127" style="height:127px;width:216px;">QDots 525, 585, 605 &#38; 625</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">Q21791MP (545), Q21711MP (585), Q21701MP (605)</td>
			<td style="width:91px;">Custom QD synthesis for QD625.</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">QD610</td>
			<td style="width:71px;">Ocean Nanotech</td>
			<td style="width:119px;">QSP-610-10&#160;</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">QD 610 lamda</td>
			<td style="width:71px;">Aldrich</td>
			<td style="width:119px;">731854</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Chloroform, 99.8%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">67-66-3</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Tetrabutylammonium bromide, 98.0%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">426288</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95%</td>
			<td style="width:71px;">Polypure</td>
			<td style="width:119px;">11156-0695</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:216px;">HSC11EG6CO2H&#160; [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H]</td>
			<td style="width:71px;">ProChimia</td>
			<td style="width:119px;">TH 003-m11.n6-0.1</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Boric Acid, 99.5%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">B0394</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Sodium Hydroxide, 99.0%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">S/4845</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Sodium Chloride, 98%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">310166</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Agarose LE</td>
			<td style="width:71px;">U.S. Biotech Sources</td>
			<td style="width:119px;">G02PD-125</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Ethanol</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">459828</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">BG-DNA Production:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Amine DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5(T)40-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">NHS-GLA-Benzylguanine</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">S9151</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">DMSO</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D8428</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">HEPES Buffer</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">83264</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">NAP5 Column</td>
			<td style="width:71px;">GE Healthcare</td>
			<td style="width:119px;">17-0853-01</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">C18 Column</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Acetonitrile</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">Mammalian Cell Culture &#38; Imaging:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Cell line expressing SNAP-tagged protein</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">E9100S</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">McCoys 5A</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">PBS</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Nunc Lab-tek II Chambered Coverglass</td>
			<td style="width:71px;">Thermo-Fischer Scientific</td>
			<td style="width:119px;">155409</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Matriplate 96-well plate</td>
			<td style="width:71px;">Brooks Life Science Systems</td>
			<td style="width:119px;">MGB096-1-2-LG-L</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">BSA</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">5% Alkali-soluble Casein</td>
			<td style="width:71px;">EMD Millipore</td>
			<td style="width:119px;">70955</td>
			<td style="width:91px;">Not all caseins are the same</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">(Optional) DNA Synthesis Reagents:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">5&#8217; Amine modifier C6</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">Oct-06</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">dA-Thiophosphoramidite</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">10-700</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Analysis Software:</td>
			<td></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">FIJI</td>
			<td colspan="3">http://valelab.ucsf.edu/~schindelin/</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">RyTrack.pro</td>
			<td colspan="3">http://sun.iwu.edu/~gspaldin/rytrack.html</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Tracker</td>
			<td colspan="3">http://www.gartnerlab.ucsf.edu/more/software</td>
		</tr>
	</tbody>
</table>

production and targeting of monovalent quantum dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in biology, where clustering and the spatial organization of biomolecules is often the object of study. We describe here a protocol to produce monovalent quantum dots (mQDs) that can be accomplished in most biological research laboratories via a simple mixing of CdSe/ZnS core/shell QDs with phosphorothioate DNA (ptDNA) of defined length. After a single ptDNA strand has wrapped the QD, additional strands are excluded from the surface. Production of mQDs in this manner can be accomplished at small and large scale, with commercial reagents, and in minimal steps. These mQDs can be specifically directed to biological targets by hybridization to a complementary single stranded targeting DNA. We demonstrate the use of these mQDs as imaging probes by labeling SNAP-tagged Notch receptors on live mammalian cells, targeted by mQDs bearing a benzylguanine moiety.

Der Phasenübergang der Quantenpunkte aus einem organischen in eine wässrige Phase ist entscheidend für die Herstellung von mQDs, kann aber auch Konditionierung und QD-spezifisch sein. Phasentransfer in Abschnitt 1.1 sollte so sauber wie die ersten beiden Fläschchen in Abbildung 3 angezeigt. Wenn Übertragung erscheint mehr wie Fläschchen 3, dann sollte man wieder mit unterschiedlichen Bedingungen zu versuchen. Nachdem die Quantenpunkte mit der negativ geladenen DNA beschichtet sie auf einem Gel getrennt von den nicht-umhüllt QD migrieren. Verwendung eines Aliquots der ungeöffneten QP als Kontrolle wurde eine zweite, sollte schneller wandernde Bande bei Zugabe des ptDNA erscheinen, wie in dem ersten Gel in 2B zu sehen. Vollständige Bildung mQDs ist mit dem Verlust des unbeweglichen Band und deren Zusammenbruch in den mobilen Band, wie in der letzten Gel in 2B gesehen gezeigt. Wenn ein Aliquot Ihre MQD Produkt wandert als eine einzelne Bande trennbar von den ungeöffneten QDs, dann wird Ihr mQDs monovalente und r<html> eady in weiteren Schritten verwendet werden. Zellmarkierung sollten speziell auf die Ziel Ihrer Wahl und sollte abhängig von Proteinexpressionsniveaus und MQD Konzentration sein. Für jede gegebene Anwendung wird oft empirische Optimierung sowohl MQD Konzentration und MQD Passivierung erforderlich. 4B zeigt die Markierung von U2OS-Zellen ein SNAP-markierte Notch-Rezeptors mit mQDs im Konzentrationsbereich von 0,5 nM bis 10 nM exprimieren. <img fo:content-width="6in" width="600" alt="Figur 1" src="/files/ftp_upload/52198/52198fig1highres.jpg" /> Abbildung 1. Modulare Ausrichtung der mQDs. MQDs hybridisieren ssDNA durch verschiedene Targeting-Moleküle funktionalisiert. Benzylguanin gebundenen DNA-Ziele mQDs Fusionsproteine ​​SNAP-tag. Modifikationen andere 5 &#39;und DNA-Sequenzen ermöglichen die Ausrichtung der mQDs zu einer Vielzahl von anderen Biomolekülen./files/ftp_upload/52198/52198fig1highres.jpg &quot;target =&quot; _blank &quot;&gt; Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen. <img fo:content-width="6in" width="600" alt="Figur 2" src="/files/ftp_upload/52198/52198fig2highres.jpg" /> Abbildung 2. Schema für die Produktion von mQDs. (A) Organische Phase QD werden in die wässrige Phase durch Behandlung mit mPEG Thiol und TBAB mit ptDNA gewickelt übertragen und mit Carboxy PEG6 Alkanthiol passiviert. TEM-Bilder sind organische QD545, QD585 und QD605 sind. (B) Ein Verfahren zum empirischen Bestimmen der Stöchiometrie der Wechselwirkung zwischen QD und ptDNA oben in Schritt zwei. QD-ptDNA Stöchiometrien werden empirisch durch Densitometrie verifiziert, so daß das endgültige Reaktions Stöchiometrie von 1: 1 (QD: ptDNA). Die anfängliche Anzahl der Mole ptDNA wird durch das Verhältnis von QD multipliziert: MQD und durch die tatsächliche AF eingestellt<html> ter Konjugation, um die Anzahl der Mole benötigt, um 1 zu erreichen. Ausbeute: 1 Konjugation <a href="https://www.jove.com/files/ftp_upload/52198/52198fig2highres.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img fo:content-width="6in" width="600" alt="Figur 3" src="/files/ftp_upload/52198/52198fig3highres.jpg" /> Abbildung 3. Experimentelle Details zur Herstellung von mQDs. (A) Repräsentative Fotos von erfolgreichen und gescheiterten Phasentransfer. QDs visuell zwischen dem dichten organischen Phase und der weniger dichten wässrigen Phase zu übertragen. Unvollständige Phasentrennung zeigt schlechte Übertragung. (B) ptDNA durch die Alkan-PEG-Thiol ersetzt. Rechts Gel Daten repräsentativ für eine Reaktion, bei der ein signifikanter Bruchteil ptDNA wurden aus der QD durch Über Passivierung vertrieben.ES.jpg &quot;target =&quot; _blank &quot;&gt; Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen. <img fo:content-width="6in" width="600" alt="Figur 4" src="/files/ftp_upload/52198/52198fig4highres.jpg" /> Abbildung 4. Labeling SNAP-markierten Proteine ​​an lebenden Zellen. (A) Schematische, welche die Expression, Befestigung und Kennzeichnung eines SNAP-markierten Rezeptors mit einem BG-Ziel MQD. (B) Repräsentative Kennzeichnung von Zellen, die ein SNAP-Notch-mCherry bauen bei verschiedenen Konzentrationen MQD. mQDs mit PEG12 passiviert colokalisieren mit mCherry zeigt spezifische Markierung. Nieder Kennzeichnung Dichten (&lt;0,5 nm) sind in der Regel für Einzelpartikelverfolgung vorzuziehen. Maßstab ist 10 um. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig4highres.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a>

Watch this Scientific Journal Video about Production and Targeting of Monovalent Quantum Dots at JoVE.com

Production and Targeting of Monovalent Quantum Dots

We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications.

Produktion und Targeting von Monovalenter Quantenpunkte

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in ...

production-and-targeting-of-monovalent-quantum-dots

Research

JoVE Journal

Bioengineering

25.4K Aufrufe.  University of California, San Francisco. We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications. 

Serie: Production and Targeting of Monovalent Quantum Dots

Solubilization and Bio-conjugation of Quantum Dots and Bacterial Toxicity Assays by Growth Curve and Plate Count

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. QDs have attracted a lot of interest for imaging, diagnostics, and therapy due to their bright, stable fluorescence1,2 3,4,5. QDs can be conjugated to a variety of bio-active molecules for binding to bacteria and mammalian cells6.
QDs are also being widely investigated as cytotoxic agents for targeted killing of bacteria. The emergence of multiply-resistant bacterial strains is rapidly becoming a public health crisis, particularly in the case of Gram negative pathogens 7. Because of the well-known antimicrobial effect of certain nanomaterials, especially Ag, there are hundreds of studies examining the toxicity of nanoparticles to bacteria 8. Bacterial studies have been performed with other types of semiconductor nanoparticles as well, especially TiO2 9,10-11, but also ZnO12 and others including CuO 13. Some comparisons of bacterial strains have been performed in these studies, usually comparing a Gram negative strain with a Gram positive. With all of these particles, mechanisms of toxicity are attributed to oxidation: either the photogeneration of reactive oxygen species (ROS) by the particles or the direct release of metal ions that can cause oxidative toxicity. Even with these materials, results of different studies vary greatly. In some studies the Gram positive test strain is reportedly more sensitive than the Gram negative 10; in others it is the opposite 14. These studies have been well reviewed 15.
In all nanoparticle studies, particle composition, size, surface chemistry, sample aging/breakdown, and wavelength, power, and duration of light exposure can all dramatically affect the results. In addition, synthesis byproducts and solvents must be considered16 17. High-throughput screening techniques are needed to be able to develop effective new nanomedicine agents.
CdTe QDs have anti-microbial effects alone18 or in combination with antibiotics. In a previous study, we showed that coupling of antibiotics to CdTe can increase toxicity to bacteria but decrease toxicity to mammalian cells, due to decreased production of reactive oxygen species from the conjugates19. Although it is unlikely that cadmium-containing compounds will be approved for use in humans, such preparations could be used for disinfection of surfaces or sterilization of water.
In this protocol, we give a straightforward approach to solubilizing CdTe QDs with mercaptopropionic acid (MPA). The QDs are ready to use within an hour. We then demonstrate coupling to an antimicrobial agent.
The second part of the protocol demonstrates a 96-well bacterial inhibition assay using the conjugated and unconjugated QDs. The optical density is read over many hours, permitting the effects of QD addition and light exposure to be evaluated immediately as well as after a recovery period. We also illustrate a colony count for quantifying bacterial survival.

Nanoparticles such as semiconductor quantum dots (QDs) can be used to create photoactivatable agents for anti-microbial or anti-cancer applications. This technique shows how to water-solubilize cadmium telluride (CdTe) QDs, conjugate them to an antibiotic, and perform a bacterial inhibition assay based upon growth curves and plate count.

Solubilisierung und Bio-Konjugation von Quantenpunkten und bakterielle Toxizitätstests von Wachstumskurve und Keimzahl

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. ...

Forschung

Biotechnik

Cell Labeling and Targeting with Superparamagnetic Iron Oxide Nanoparticles

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the target site while minimizing deleterious effects to off-target sites. Magnetic cell targeting is an efficient, safe, and straightforward delivery technique. Superparamagnetic iron oxide nanoparticles (SPION) are biodegradable, biocompatible, and can be endocytosed into cells to render them responsive to magnetic fields. The synthesis process involves creating magnetite (Fe3O4) nanoparticles followed by high-speed emulsification to form a poly(lactic-co-glycolic acid) (PLGA) coating. The PLGA-magnetite SPIONs are approximately 120 nm in diameter including the approximately 10 nm diameter magnetite core. When placed in culture medium, SPIONs are naturally endocytosed by cells and stored as small clusters within cytoplasmic endosomes. These particles impart sufficient magnetic mass to the cells to allow for targeting within magnetic fields. Numerous cell sorting and targeting applications are enabled by rendering various cell types responsive to magnetic fields. SPIONs have a variety of other biomedical applications as well including use as a medical imaging contrast agent, targeted drug or gene delivery, diagnostic assays, and generation of local hyperthermia for tumor therapy or tissue soldering.

Targeted cell delivery is useful in a variety of biomedical applications. The goal of this protocol is to use superparamagnetic iron oxide nanoparticles (SPION) to label cells and thereby enable magnetic cell targeting approaches for a high degree of control over cell delivery and localization.

Zellmarkierung und Targeting mit superparamagnetische Eisenoxid-Nanopartikel

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the ...

Solid Lipid Nanoparticles (SLNs) for Intracellular Targeting Applications

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter cellular signaling and gene expression. In a previous investigation, the synthesis of ultra-small solid lipid nanoparticles (SLNs) for topical drug delivery and biomarker detection applications was demonstrated. SLNs are a well-studied example of a nanoparticle delivery system that has emerged as a promising drug delivery vehicle. In this study, SLNs were loaded with a fluorescent dye and used as a model to investigate particle-cell interactions. The phase inversion temperature (PIT) method was used for the synthesis of ultra-small populations of biocompatible nanoparticles. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylphenyltetrazolium bromide (MTT) assay was utilized in order to establish appropriate dosing levels prior to the nanoparticle-cell interaction studies. Furthermore, primary human dermal fibroblasts and mouse dendritic cells were exposed to dye-loaded SLN over time and the interactions with respect to toxicity and particle uptake were characterized using fluorescence microscopy and flow cytometry. This study demonstrated that ultra-small SLNs, as a nanoparticle delivery system, are suitable for intracellular targeting of different cell types.

Solid Lipid Nanoparticles SLNs for Intracellular Targeting Applications

In this study, a method for synthesizing ultra-small populations of biocompatible nanoparticles was described, as well as several in vitro methods by which to assess their cellular interactions.

Feste Lipidnanopartikel (SLN) für die intrazelluläre Targeting-Anwendungen

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter ...

A Rapid and Quantitative Fluorimetric Method for Protein-Targeting Small Molecule Drug Screening

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold nanoclusters (Au NCs) within the drug-loaded protein, based on the differential fluorescence signal emitted by the Au NCs. Albumin proteins such as human serum albumin (HSA) and bovine serum albumin (BSA) are selected as the model proteins. Four small molecular drugs (e.g., ibuprofen, warfarin, phenytoin, and sulfanilamide) of different binding affinities to the albumin proteins are tested. It was found that the formation rate of fluorescent Au NCs inside the drug loaded albumin protein under denaturing conditions (i.e., 60 &#176;C or in the presence of urea) is slower than that formed in the pristine protein (without drugs). Moreover, the fluorescent intensity of the as-formed NCs is found to be inversely correlated to the binding affinities of these drugs to the albumin proteins. Particularly, the higher the drug-protein binding affinity, the slower the rate of Au NCs formation, and thus a lower fluorescence intensity of the resultant Au NCs is observed. The fluorescence intensity of the resultant Au NCs therefore provides a simple measure of the relative binding strength of different drugs tested. This method is also extendable to measure the specific drug-protein binding constant (KD) by simply varying the drug content preloaded in the protein at a fixed protein concentration. The measured results match well with the values obtained using other prestige but more complicated methods.

A protocol for small molecular drug screening based on in-situ synthesis of ultrasmall fluorescent gold nanoclusters (Au NCs) using drug-loaded protein as template is presented. This method is simple to determine the binding affinity of drugs to a target protein by a visible fluorescent signal emitted from the protein-templated Au NCs.

Eine schnelle und quantitative fluorimetrische Verfahren zur Protein-Targeting kleines Molekül als Wirkstoff-Screening

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold ...

Correlative Light- and Electron Microscopy Using Quantum Dot Nanoparticles

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using widefield fluorescence light microscopy and transmission electron microscopy (TEM). To demonstrate the protocol we have immunolabeled ultrathin epoxy sections of human somatostatinoma tumor using a primary antibody to somatostatin, followed by a biotinylated secondary antibody and visualization with streptavidin conjugated 585 nm cadmium-selenium (CdSe) quantum dots (QDs). The sections are mounted on a TEM specimen grid then placed on a glass slide for observation by widefield fluorescence light microscopy. Light microscopy reveals 585 nm QD labeling as bright orange fluorescence forming a granular pattern within the tumor cell cytoplasm. At low to mid-range magnification by light microscopy the labeling pattern can be easily recognized and the level of non-specific or background labeling assessed. This is a critical step for subsequent interpretation of the immunolabeling pattern by TEM and evaluation of the morphological context. The same section is then blotted dry and viewed by TEM. QD probes are seen to be attached to amorphous material contained in individual secretory granules. Images are acquired from the same region of interest (ROI) seen by light microscopy for correlative analysis. Corresponding images from each modality may then be blended to overlay fluorescence data on TEM ultrastructure of the corresponding region.

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of epoxy embedded human pathology tissue. We employ commercial antibody fragment conjugated QDs that are visualized by widefield fluorescence light microscopy and transmission electron microscopy.

Korrelative Light- und Elektronenmikroskopie Quantum Dot Nanopartikel

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using ...

Initial Evaluation of Antibody-conjugates Modified with Viral-derived Peptides for Increasing Cellular Accumulation and Improving Tumor Targeting

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used in cancer treatment and imaging due to increased cellular accumulation over current ACs. During early AC in vitro development, fluorescence techniques and radioimmunoassays are sufficient for determining intracellular localization, accumulation efficiency, and target cell specificity. Currently, there is no consensus on standardized methods for preparing cells for evaluating AC intracellular accumulation and localization. The initial testing of ACs modified with virus-derived peptides is critical especially if several candidates have been constructed. Determining intracellular accumulation by fluorescence can be affected by background signal from ACs at the cell surface and complicate the interpretation of accumulation. For radioimmunoassays, typically treated cells are fractionated and the radioactivity in different cell compartments measured. However, cell lysis varies from cell to cell and often nuclear and cytoplasmic compartments are not adequately isolated. This can produce misleading data on payload delivery properties. The intravenous injection of radiolabeled virus-derived peptide-modified ACs in tumor bearing mice followed by radionuclide imaging is a powerful method for determining tumor targeting and payload delivery properties at the in vivo phase of development. However, this is a relatively recent advancement and few groups have evaluated virus-derived peptide-modified ACs in this manner. We describe the processing of treated cells to more accurately evaluate virus-derived peptide-modified AC accumulation when using confocal microscopy and radioimmunoassays. Specifically, a method for trypsinizing cells to remove cell surface bound ACs. We also provide a method for improving cellular fractionation. Lastly, this protocol provides an in vivo method using positron emission tomography (PET) for evaluating initial tumor targeting properties in tumor-bearing mice. We use the radioisotope 64Cu (t1/2 = 12.7 h) as an example payload in this protocol.

Viral-derived peptides coupled to antibody-conjugates (ACs) is an approach gaining momentum due to the potential of delivering molecular payloads with increased tumor cell accumulation. Utilizing common methods to evaluate peptide conjugation, AC and payload intracellular accumulation, and tumor targeting, this protocol helps researchers during the key initial development phases.

Erstbewertung der Antikörper-Konjugate mit Viral-abgeleitete Peptide zur Erhöhung der zellulären Akkumulation und Verbesserung der Tumor gezielt modifiziert

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used ...

20 mJ, 1 ps Yb:YAG Thin-disk Regenerative Amplifier

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with turn-key performance and microjoule-level pulse energy is used to seed the regenerative chirped-pulse amplifier. The amplifier is placed in airtight housing. It operates at room temperature and exhibits stable operation at a 5 kHz repetition rate, with a pulse-to-pulse stability less than 1%. By employing a 1.5 mm-thick beta barium borate crystal, the frequency of the laser output is doubled to 515 nm, with an average power of 70 W, which corresponds to an optical-to-optical efficiency of 70%. This superior performance makes the system an attractive pump source for optical parametric chirped-pulse amplifiers in the near-infrared and mid-infrared spectral range. Combining the turn-key performance and the superior stability of the regenerative amplifier, the system facilitates the generation of a broadband, CEP-stable seed. Providing the seed and pump of the optical parametric chirped-pulse amplification (OPCPA) from one laser source eliminates the demand of active temporal synchronization between these pulses. This work presents a detailed guide to set up and operate a Yb:YAG thin-disk regenerative amplifier, based on chirped-pulse amplification (CPA), as a pump source for an optical parametric chirped-pulse amplifier.

A protocol for the operation of a high-energy, high-power optical parametric chirped pulse amplifier pump source based on an Yb:YAG thin-disk regenerative amplifier is presented here.

20 mJ, 1 ps Yb: YAG Dünnschicht-Regenerationsverstärker

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with ...

Synthesis of Monocyte-targeting Peptide Amphiphile Micelles for Imaging of Atherosclerosis

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. Atherosclerosis is also the leading cause of sudden death and myocardial infarction, instigated by unstable plaques that rupture and occlude the blood vessel without warning. Current imaging modalities cannot differentiate between stable and unstable plaques that rupture. Peptide amphiphiles micelles (PAMs) can overcome this drawback as they can be modified with a variety of targeting moieties that bind specifically to diseased tissue. Monocytes have been shown to be early markers of atherosclerosis, while large accumulation of monocytes is associated with plaques prone to rupture. Hence, nanoparticles that can target monocytes can be used to discriminate different stages of atherosclerosis. To that end, here, we describe a protocol for the preparation of monocyte-targeting PAMs (monocyte chemoattractant protein-1 (MCP-1) PAMs). MCP-1 PAMs are self-assembled through synthesis under mild conditions to form nanoparticles of 15 nm in diameter with near neutral surface charge. In vitro, PAMs were found to be biocompatible and had a high binding affinity for monocytes. The methods described herein show promise for a wide range of applications in atherosclerosis as well as other inflammatory diseases.

This paper presents a method involving the synthesis and characterization of monocyte-targeting peptide amphiphile micelles and the corresponding assays to test for biocompatibility and ability of the micelle to bind to monocytes.

Synthese von Monocyte-targeting Peptid Amphiphile Micellen für die Bildgebung der Atherosklerose

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. ...

Synthesis of Functionalized 10-nm Polymer-coated Gold Particles for Endothelium Targeting and Drug Delivery

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting and drug delivery are some of the applications of these AuNPs, but endothelial extracellular matrices&#39; defensive properties hamper particle uptake. To address this issue, we describe a synthesis method for ultrasmall gold nanoparticles to improve vascular delivery, with customizable functional groups and polymer lengths for further adjustments. The protocol yields 2.5 nm AuNPs that are capped with tetrakis(hydroxymethyl)phosphonium chloride (THPC). The replacement of THPC with hetero-functional polyethylene glycol (PEG) on the surface of the AuNP increases the hydrodynamic radius to 10.5 nm while providing various functional groups on the surface. The last part of the protocol includes an optional addition of a fluorophore to allow the AuNPs to be visualized under fluorescence to track nanoparticle uptake. Dialysis and lyophilization were used to purify and isolate the AuNPs. These fluorescent nanoparticles can be visualized in both in vitro and in vivo experiments due to the biocompatible PEG coating and fluorescent probes. Additionally, the size range of these nanoparticles render them an ideal candidate for probing the glycocalyx without disrupting normal vasculature function, which may lead to improved delivery and therapeutics.

We describe a method of synthesizing biocompatible 10-nm gold nanoparticles, functionalized by coating poly-ethylene glycol onto the surface. These particles can be used in vitro and in vivo for delivering therapeutics to nanoscale cellular and extracellular spaces that are difficult to access with conventional nanoparticle sizes.

Synthese von funktionalisierten 10 nm Polymer beschichteten Goldpartikeln für Targeting Endothel und Drug-Delivery

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting ...

Targeting Neuronal Fiber Tracts for Deep Brain Stimulation Therapy Using Interactive, Patient-Specific Models

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for movement disorders and is being applied to a growing number of disorders. Computational modeling has been successfully used to predict the clinical effects of DBS; however, there is a need for novel modeling techniques to keep pace with the growing complexity of DBS devices. These models also need to generate predictions quickly and accurately. The goal of this project is to develop an image processing pipeline to incorporate structural magnetic resonance imaging (MRI) and diffusion weighted imaging (DWI) into an interactive, patient specific model to simulate the effects of DBS. A virtual DBS lead can be placed inside of the patient model, along with active contacts and stimulation settings, where changes in lead position or orientation generate a new finite element mesh and solution of the bioelectric field problem in near real-time, a timespan of approximately 10 seconds. This system also enables the simulation of multiple leads in close proximity to allow for current steering by varying anodes and cathodes on different leads. The techniques presented in this paper reduce the burden of generating and using computational models while providing meaningful feedback about the effects of electrode position, electrode design, and stimulation configurations to researchers or clinicians who may not be modeling experts.

The goal of this project is to develop an interactive, patient-specific modeling pipeline to simulate the effects of deep brain stimulation in near real-time and provide meaningful feedback as to how these devices influence neural activity in the brain.

Targeting neuronalen Faser Traktate für Deep Brain Stimulationstherapie mit interaktiven, patientenspezifische Modelle

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for ...