Finanziamento previsto dal DOD W81XWH-1023/10/01 (ZJG), concessione P50 GM081879 dal Centro UCSF per sistemi e Biologia Sintetica (ZJG), NIH 5R21EB015088-02 (YJ) e NIH 1R21EB018044 (ZJG &amp; YJ). DS è stato sostenuto da Human Frontier Science Program Cross postdoc disciplinare Research Fellowship.

1 Produzione di monovalente Quantum Dots <ol><li> Trasferimento di fase di QD da organico a fase acquosa <ol><li> Diluire 200 ml di una soluzione 1 mM di QD fase organica con 400 ml di cloroformio in un flaconcino di vetro da 5 ml. </li><li> Mescolare 400 ml di una soluzione 0.3 M tetrabutilammonio bromuro (TBAB) il cloroformio con 36 ml di pulito mPEG tiolo (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) e agitare O / N. </li><li> Aggiungere 800 ml di una soluzione acquosa 0,2 M di NaOH e agitare per 30 sec. Un trasferimento di fase si verifica entro pochi minuti, indicati dal trasferimento delle particelle colorate alla fase acquosa sopra la fase organica più densa. </li><li> Se le particelle si aggregano in una terza fase tra le fasi acquosa ed organica, aumentare il tempo di incubazione con il tiolo MPEG. Se la fase acquosa rimane chiaro, i QD non hanno fatto il trasferimento di fase (vedi Figura 3A). In alternativa, aumentare la concentrazione di mPEG tiolo al punto 2 per alleviare poveri trasferimento di fase. </li><li> Recuperare l&#39;(colorato) fase acquosa e quindi concentrare le QD raccolti con una colonna Centricon di spin (peso molecolare 30 kDa cut-off) a 1 ml. </li><li> Aggiungere la soluzione QD concentrata in una colonna Sephadex NAP10 pre-equilibrata con tampone Tris 10 mM contenente 30 mM NaCl (pH 8,0). Eluire i QD con 1,5 ml di tampone di eluizione di flusso di gravità. </li><li> Misurare la concentrazione di QD con spettroscopia di assorbimento a 350 nm. </li></ol></li><li> Preparazione di MQDS <ol><li> Acquisto (o sintetizzare) ptDNA. Questo protocollo utilizza la sequenza 5&#39;-A S 50 (CT) 10 (ACTG) 5 -3 &#39;(vedi Tabella 1). </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> DNA </td><td> Sequenza </td></tr><tr><td> 5&#39;-A S 50 (CT) 10 (ACTG) 5 </sub&gt; -3 &#39; </td><td> A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG </td></tr><tr><td> 5&#39;-NH 2 - (CT) 10 (CAGT) 5 -3 &#39; </td><td> NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr><tr><td> BG-DNA </td><td> BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr></tbody></table> Tabella 1. sequenze di DNA utilizzate per produrre e MQDS bersaglio. <ol start="2" style="margin-left: 40px;"><li> Preparare 1 ml di soluzione di QD 100 nM in tampone Tris 10 mM contenente 30 mM NaCl (pH 8). </li><li> Aggiungere una goccia saggi 500 microlitri della soluzione di 100 nM ptDNA ai QD acquosi per 1 min, mescolando energicamente. Mescolare o posizionare su un agitatore per un ulteriore 9 ore. Nota: Questo dovrebbe teoricamente produrre un rapporto di 1: 2 di ptDNA: QD. Tuttavia, la stechiometria reale è mai perfetta - solitamente il risultato è più vicino a 1: 1.5. Al fine di produrre un rapporto 1: 1 di ptDNA: QD, densitometria dopo elettroforesi su gel è necessario quantificare l&#39;esatto rapporto di coniugazione in volumi noti utilizzati in precedenza. </li><li> Rimuovere ~ 10 ml di miscela QD per funzionare su un gel di agarosio analitica. Rimuovere anche una simile concentrazione di QD non coniugati in fase acquosa (dal punto 1.2.1). <ol><li> Aggiungere ~ 2 μ; L di tampone di caricamento 6x Ficoll (per aumentare la densità della soluzione) ed eseguire questi due campioni insieme su un gel 0,8% p / v agarosio in tampone borato di sodio per 15 minuti a 150 V. Una singola banda nella corsia di controllo non coniugata migrazione vicino a il bene, e due bande in corsia con QD coniugati sono visti (vedi gel nella Figura 2B). </li></ol></li><li> Calcolare la frazione QD coniugato usando l&#39;intensità relativa delle due bande (vedere l&#39;equazione nella Figura 2B). Quindi utilizzare la frazione per calcolare il volume supplementare di 100 nM ptDNA soluzione necessaria per corrispondere al numero di QD. </li><li> Ripetere i passaggi da 1.2.3 a 1.2.5 ancora una volta con questo volume calcolato o fino a quando il QD coniugati crollo in una singola banda sul gel che indica la coniugazione completa di tutti i QD. </li><li> Aggiungere 100 ml di 10 mM (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carbossi PEG6 alcano tiolo) in 10 mM Tris buffer di containing 30 mM NaCl (pH 8) per i MQDS coniugati prodotte in precedenza, e agitare per 10 min. Nota: Questi ligandi PEG passivare la superficie QD. Un PEG sarà più meglio passivare i QD, tuttavia, sarà anche aumentare la loro dimensione. La funzionalità alcano tiolo idrofoba ha un&#39;affinità molto maggiore per i QD, nel complesso, rispetto al meno idrofobico PEG-tiolo utilizzato per il trasferimento di fase. Pertanto, non permettere che questo passaggio di procedere troppo a lungo o il ptDNA sarà sostituito dal alcano-PEG-tiolo. Dopo un min di incubazione ~ 30, una frazione significativa di DNA sarà stato spostato dai QD (Figura 3B). </li><li> Per rimuovere l&#39;eccesso di alcano PEG-tiolo, aggiungere 0,5 ml della soluzione QD per una colonna Sephadex NAP5 pre-equilibrata con tampone di eluizione (10 mM tampone Tris contenente NaCl 30 mM). Raccogliere le MQDS con 1,0 ml di tampone di eluizione di flusso di gravità. </li><li> Concentrare i QD raccolti con una colonna Centricon di spin (30 kDa). Conservare queste MQDS a 4 ° C per mesi. Non frli eeze. Nota: Se una pallina colorata nella parte inferiore del tubo è visto, i puntini si sono aggregati e sono probabilmente non più utilizzabili. </li></ol> 2 Produzione di targeting (Benzylguanine-) DNA <ol><li> Produrre o acquistare DNA ammina-terminato. Questo protocollo utilizza la sequenza 5&#39;-NH 2 - (CT) 10 - (CAGT) 5 -3 &#39;(vedi Tabella 1). Il linker poli-CT aumenta l&#39;accessibilità alla funzionalità sepolto nel profondo del glicocalice, ma potrebbe non essere necessario per tutte le applicazioni. Se vi è l&#39;accesso a un sintetizzatore di DNA, produrre DNA amino-modificato utilizzando un appropriato 5 &#39;amino-modificatore (5&#39; amino-modificatore C6). </li><li> Sciogliere BG-N-idrossisuccinimmide (BG-NHS) in dimetilsolfossido secco (DMSO) ad una concentrazione di 10 mg / ml. Nota: BG-NHS in grado di assorbire acqua dall&#39;aria e portare a idrolisi del reattiva NHS-estere, in particolare in solventi igroscopici come il DMSO e dimetilformammide (DMF). BG-NHS è miglior negoziod a -80 ° C come polvere nel suo flacone in un contenitore contenente essiccante secondario. Riscaldare a TA prima apertura del flacone. In alternativa, un&#39;aliquota immediatamente per uso singolo estere BG-NHS in un solvente polare asciutto e congelare a -80 ° C, o reagire completamente con il DNA ammina al punto 2.2. </li><li> Reagire mescolando il BG-NHS in DMSO dal punto 2.1 con il DNA ammina-terminato in HEPES (4-(2-idrossietil) -1 acido-piperazineethanesulfonic) tamponata (pH 8,5) di acqua. In un tipico reagire 20 ml di 10 mg / ml BG-NHS in DMSO con 2 ml di 2 mM NH 2 - (CT) 10 - (CAGT) 5 a 58 ml di acqua deionizzata tamponata con 20 microlitri 0,5 M HEPES pH 8,5. Effettuare reazioni in una provetta da 1,5 ml microcentrifuga. Mescolare rapidamente la reazione procede rapidamente e deve competere con NHS-estere idrolisi. </li><li> Sonicare per 5-10 min per garantire un&#39;accurata miscelazione. Incubare ~ 1 ora a temperatura ambiente. Il rapporto stechiometrico di BG: DNA può essere modificato per guidare la reazione al completamento. </li><li&gt; desalt la reazione utilizzando una colonna standard di NAP5 in 100 mM acetato di trietilammina (TEAA, pH 7). </li><li> Purificare il BG-DNA dal reagito ammina-DNA-HPLC in fase inversa esecuzione di un TEAA 100 mm: acetonitrile (ACN) pendenza tra l&#39;8% e il 95% acetonitrile oltre 30 min. L&#39;ammina-DNA che non ha reagito viene eluire prima che il BG-DNA. Raccogliere la frazione BG-DNA in un tubo conico. <ol><li> Utilizzare una colonna C 18 Zorbax per la purificazione oligonucleotide di serie e il seguente gradiente: 0 → 15 min: 8 → 30% ACN; 15 → 21 min: 30-90% ACN; 21 → 25 min: 90 → 8% ACN; 25 → 30 min: 8% ACN; </li></ol></li><li> Congelare in azoto liquido e liofilizzare la frazione raccolta. Risospendere il DNA in acqua deionizzata. Per essere molto attenti, liofilizzare altre due volte per rimuovere TEAA residuo. TEAA residuo può essere tossico per le cellule a concentrazioni più elevate. </li><li> Risospendere il liofilizzato BG-DNA in acqua, avendo cura di lavare i lati di the tubo, e portare a ~ 25 mM magazzino. Aliquota e conservare a 4 ° C. I campioni sono stati conservati per ~ 9 mesi senza degrado evidente. </li></ol> 3. Cellule Etichettatura diretta con monovalente Quantum Dots <ol><li> Facoltativamente, passivare le MQDS appena prima di un esperimento di imaging utilizzando reagenti quali caseina (0,5%) o albumina di siero bovino (BSA, 1-3%). </li><li> Cellule piastra che esprimono la proteina SNAP-tag sulla riflessione totale interna fluorescenza (TIRF) vetro -Qualità. In questo esperimento, si usa una linea cellulare U2OS esprimono un recettore Notch1 SNAP-tag e superfici in vetro di alta qualità. </li><li> Dopo che le cellule hanno attaccato al vetro (~ 24 ore), rimuovere i supporti di crescita, lavare con PBS, e incubare le cellule per 10-30 minuti a temperatura ambiente in ~ 100-150 ml di PBS o supporti cella contenente ~ 1 mM BG- DNA a partire dal punto 2.6. </li><li> Dopo l&#39;incubazione con BG, lavare accuratamente le cellule con PBS o supporti cellulare. Incubare le cellule per ~ 5-10 min con thE MQDS prodotte nella fase 1.2.9 (e facoltativamente passivazione al punto 3.1). </li><li> Facoltativamente, lavare i MQDS non legate e tornare alle cellule di un buffer / media adatto sia per l&#39;imaging e la cultura. Per le celle che dovevano essere ripreso in modalità TIRF, una fase di lavaggio finale è stato spesso inutili come MQDS sciolti in soluzione diffuse così rapidamente rispetto a MQDS legati da essere rilevabile durante l&#39;analisi. </li></ol> 4. Microscopia e analisi <ol><li> Immagine le cellule utilizzando un microscopio TIRF. Nota: Il campo di applicazione deve avere eccitazione separabili e filtri di emissione, o un filtro cubo QD personalizzato. QD sono meglio eccitato con un laser a bassa lunghezza d&#39;onda (405 o 488 nm). QD di diametro diverso hanno caratteristiche lunghezze d&#39;onda di emissione, in genere associato a un grande cambiamento di Stoke. </li><li> A causa della luminosità di MQDS, raccogliere immagini a frame rate elevati in TIRF mentre l&#39;imaging lato basale di una cellula dal vivo. Nota: In alternativa, dinamica singola molecola possono essere followed in altri piani focali utilizzando un microscopio confocale disco rotante. Automatizzato software di monitoraggio singola particella è generalmente efficace a seguire con precisione le MQDS luminose e fotostabili. </li></ol>

<ol>
	<li>Sako, Y., Minoghchi, S., Yanagida, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+imaging+of+EGFR+signaling+on+the+surface+of+living+cells.">Single-molecule imaging of EGFR signaling on the surface of living cells.</a> Nature Cell Biology. 2 (3), 168-172 (2000).</li><li>Luo, W., He, K., Xia, T., Fang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+monitoring+in+living+cells+by+use+of+fluorescence+microscopy.">Single-molecule monitoring in living cells by use of fluorescence microscopy.</a> Analytical and Bioanalytical Chemistry. 405 (1), 43-49 (2013).</li><li>Chung, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+control+of+EGF+receptor+activation+by+reversible+dimerization+on+living+cells.">Spatial control of EGF receptor activation by reversible dimerization on living cells.</a> Nature. 464 (7289), 783-787 (2010).</li><li>Fern&#225;ndez-Su&#225;rez, M., Ting, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+probes+for+super-resolution+imaging+in+living+cells.">Fluorescent probes for super-resolution imaging in living cells.</a> Nature Reviews Molecular Cell Biology. 9 (12), 929-943 (2008).</li><li>Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photooxidation+and+photobleaching+of+single+CdSe/ZnS+quantum+dots+probed+by+room-temperature+time-resolved+spectroscopy.">Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy.</a> The Journal of Physical Chemistry B. 105 (35), 8281-8284 (2001).</li><li>Pinaud, F., Clarke, S., Sittner, A., Dahan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+cellular+events,+one+quantum+dot+at+a+time.">Probing cellular events, one quantum dot at a time.</a> Nature Methods. 7 (4), 275-285 (2010).</li><li>Michalet, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantum+dots+for+live+cells,+in+vivo+imaging,+and+diagnostics.">Quantum dots for live cells, in vivo imaging, and diagnostics.</a> Science. 307 (5709), 538-544 (2005).</li><li>Howarth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monovalent,+reduced-size+quantum+dots+for+imaging+receptors+on+living+cells.">Monovalent, reduced-size quantum dots for imaging receptors on living cells.</a> Nature Methods. 5 (5), 397-399 (2008).</li><li>Iyer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aromatic+aldehyde+and+hydrazine+activated+peptide+coated+quantum+dots+for+easy+bioconjugation+and+live+cell+imaging.">Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging.</a> Bioconjugate Chemistry. 22 (6), 1006-1011 (2011).</li><li>Tikhomirov, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+programming+of+quantum+dot+valency,+self-assembly+and+luminescence.">DNA-based programming of quantum dot valency, self-assembly and luminescence.</a> Nature Nanotechnology. 6 (8), 485-490 (2011).</li><li>Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+targeted+monovalent+quantum+dots+by+steric+exclusion.">Formation of targeted monovalent quantum dots by steric exclusion.</a> Nature Methods. 10 (12), 1203-1205 (2013).</li><li>Gartner, Z. J., Bertozzi, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmed+assembly+of+3-dimensional+microtissues+with+defined+cellular+connectivity.">Programmed assembly of 3-dimensional microtissues with defined cellular connectivity.</a> Proceeding of the National Academy of Sciences USA. 106 (12), 4606-4610 (2009).</li><li>Selden, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+programmed+cell+adhesion+with+membrane-anchored+oligonucleotides.">Chemically programmed cell adhesion with membrane-anchored oligonucleotides.</a> Journal of the American Chemical Society. 134 (2), 765-768 (2012).</li></ol>

The authors have nothing to disclose.

La modularità del disegno dell&#39;MQD consente una maggiore flessibilità sperimentale. Ad esempio, una varietà di MQDS può essere rapidamente preparato in colori unici consentano imaging simultaneo di più bersagli. La sequenza di targeting ssDNA può dirigere MQDS alle proteine, zuccheri, lipidi e 12 superfici 13. Un certo numero di tag enzimatiche sono disponibili con reattività ortogonali, consentendo a più obiettivi da essere ripreso in contemporanea con MQDS differenziale mirati. Oltre al targeting con il tag SNAP, l&#39;etichettatura delle proteine ​​bersaglio con MQDS utilizzando il tag CLIP, il tag HALO, e proteine ​​biotinilati era anche successo. Questo protocollo dimostra la marcatura specifica di un recettore di superficie su cellule vive con questi MQDS, ma il protocollo può essere facilmente adattato a diversi contesti differenti. L&#39;intuizione metodologica significativo nella produzione MQDS con valenza definita è che ~ 50 fosforotioato-linkedle basi sono tenuti ad avvolgere i QD (e quindi evitare che due molecole di legarsi contemporaneamente). Una poli-Una sequenza S 50 riproducibile e stabilmente vincolata 605 nm QD da Life Technologies. Anche se questo prodotto è fuori produzione, la strategia di esclusione sterica è generalizzabile a prodotti simili di altri produttori che hanno diverse dimensioni, forme, le proprietà spettrali. L&#39;efficienza e la stabilità dei QD ptDNA-avvolto dipende in modo critico dalla chimica di superficie e la struttura dei QD. Pertanto, il successo di un protocollo dipenderà dalla struttura sorgente e la chimica commerciale dei QD. Ai fini del presente protocollo, tre grandi punti di differenza esiste tra le varie fonti commerciali di QD: una differenza nelle condizioni necessarie per il trasferimento di fase; una differenza nella forza di iniziale PEG-tiolo-ligando vincolante, eventualmente ostacolare lo spostamento dal ptDNA; e una differenza nella quantità di nucleo CdSe esposto, che può leannuncio a la tempra del QD dalle condizioni di trasferimento di fase tiolo Mpeg. Come di pubblicazione, QD con la migliore struttura per la produzione di MQDS sono 4-10 nm QD CdSe / ZnS nucleo / guscio acquistati da Life Technologies con spettri di emissione a 545, 585, 605 e 625 nm (Figura 2A). QD basati sulla formulazione &#39;Vivid&#39; (545, 605, ecc) estinguono dopo l&#39;aggiunta di mPEG tiolo e non sono adatti per questa applicazione. QD da Aldrich e Ocean Nanotech funzionano bene, ma richiedono il trasferimento gradini e pre-trattamento con ossido trioctylphosphine fase più lunga. Questo protocollo è stato ottimizzato per QD da Life Technologies. La sequenza poly-A fosforotioato utilizzato per avvolgere i QD termina con una coda di DNA di 20-mer nativo contenente la sequenza di (ACTG) 5 a cui un filamento di targeting può ibridare. Questa sequenza è conveniente, in quanto ha poca o nessuna struttura secondaria, e rimarrà hybridized a 37 ° C in PBS. Se vi è l&#39;accesso a un sintetizzatore di DNA, il ptDNA può venire sintetizzato e poi purificato per cromatografia in fase inversa liquida ad alta prestazione (HPLC) utilizzando una colonna C 8. Il ptDNA si eluire in seguito alla HPLC di oligonucleotidi equivalenti con una spina dorsale nativo. Noi di solito lasciamo il 5 &#39;DMT gruppo protettivo sui nostri oligonucleotidi fosforotioati dopo la purificazione. Passivazione dei QD ptDNA-avvolto è di solito necessario per migliorare la stabilità colloidale del QD e ridurre vincolante per le applicazioni più sperimentali sfondo. Il protocollo utilizza un PEG-livello per passivare le QD. Carboxy PEG tiolo alcano con unità aggiuntive PEG ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, carbossi-PEG12 alcano tiolo) fornisce significativamente ridotto sfondo, anche se i PEG più lunghi sono entrambi più grandi, e generalmente più costosi. MQDS rivestiti con carbossi PEG alkaleganti tiolici ne sono altamente stabili nel buffer fisiologici come fosfato tamponata saline e terreni di coltura. Stoccaggio a lungo termine (&gt; 8 mesi) di MQDS a 4 ° C non ha mostrato alcuna significativa aggregazione o ptDNA distacco 11. A seconda l&#39;esperimento, PEG passivazione dei QD da sola non sempre sufficiente a ridurre legame non specifico delle MQDS. Incubare entrambe le cellule e MQDS in tampone fosfato salino (PBS) contenente il 3% di BSA per 20 minuti prima dell&#39;uso sostanzialmente riduce legame non specifico per le cellule, anche se non aumentare il raggio idrodinamico apparente delle MQDS da ~ 50%. Passivazione con 0,5% di caseina riduce il legame non specifico ulteriormente ma aumenta la dimensione apparente in misura maggiore di BSA. L&#39;estremità 5 &#39;di un filamento di DNA complementare ai MQDS può essere modificato per consentire il targeting di diverse biomolecole. Ci sono un certo numero di tecniche consolidate disponibili per modificare covalentemente proteine, lipids e zuccheri con DNA a singolo filamento (ssDNA). Finché il ssDNA viene presentato extracellulare, è accessibile a MQDS solubili. MQDS con le sequenze di cui sopra saranno rapidamente ibridare con il loro filamento di DNA complementare in condizioni di coltura cellulare. A 10-20x poli (CT) distanziale tra il ptDNA e la sequenza di targeting può essere richiesto per il targeting efficiente in modo da elevare la sequenza di legame sopra il glicocalice della cellula spessa e carica negativa. Per questo protocollo abbiamo scelto di produrre un BG-DNA con una sequenza complementare di (CAGT) 5 che sia ibridato ai MQDS e covalente si collegherà ad una proteina SNAP-tag per l&#39;etichettatura rapida e specifica. A funzioni di protocollo simili anche per l&#39;accoppiamento altre NHS-esteri di oligonucleotidi aminoacidi modificati. Per l&#39;imaging singola molecola, una bassa densità di etichettatura è in genere necessario per risolvere singole molecole. Una concentrazione finale MQD di ~ 0,5 nM in PBS con l&#39;agente passivanteè un buon obiettivo. Tuttavia, queste diluizioni elevate talvolta portato a sotto-etichettatura delle cellule. In questo caso, ulteriore MQD possono essere aggiunti fino a quando si osserva una densità ottimale di etichettatura. Nel caso di SNAP-tag Notch1 umano, concentrazioni&gt; 10 nM MQD prodotte cellule di etichettatura dense mentre 0,5 nM MQD portato l&#39;attaccamento di ~ 20 MQDS sulla superficie basale della cellula bersaglio (vedi Figura 4B). Etichettatura delle cellule con MQDS era altamente dipendente dalla confluenza delle cellule placcato. Eccessivamente cellule confluenti non etichettare a loro superfici basali. In sintesi, un metodo semplice per generare monovalenti e QD modulari è stato descritto. Questi MQDS trovano utilità in un&#39;ampia gamma di applicazioni di imaging cellulare dal vivo, come dimostra l&#39;imaging del recettore Notch sulle cellule U2OS dal vivo. Applicabilità MQDS non è limitata a questo caso specifico, ma può essere potenzialmente estesa per altri bersagli cellulari come altre proteine, acidi nucleici, ed enzimi.

La dinamica di singole molecole sulle cellule vive contribuisce alla loro funzione biologica. Singola molecola di imaging di fluorescenza è un metodo popolare per studiare la dinamica di singola molecola sulla superficie cellulare 1,2,3. Tuttavia, le sonde di imaging più comunemente utilizzati in questi studi hanno diversi svantaggi importanti. Ad esempio, coloranti organici convenzionali e proteine ​​fluorescenti garantiscono luminosità moderata, circa 10 5 -10 6 M -1 cm -1, ma sono fotochimica instabili, sbiancamento dopo l&#39;emissione di circa 10 5 -10 6 fotoni in tipiche condizioni di imaging live-cell 4,5. Al contrario, le nanoparticelle di semiconduttori, spesso chiamati punti quantici (QD), sono significativamente più luminoso e più stabile, con coefficienti di estinzione nel range di 10 6 -10 7 M -1 cm -1 e superiore a 10 7 -10 8 fotoni emessi prima photoblNSEGNARE 5. La luminosità migliorata e fotostabilità di QD oltre fluorofori organici consente l&#39;osservazione delle singole molecole a frame rate notevolmente più veloci e più ancora a lungo traiettorie 6. Nonostante i loro vantaggi e disponibilità commerciale, alcune passività rimangono per questi potenti agenti di imaging. In primo luogo, essi hanno mal definito il targeting di valenza, che può provocare la reticolazione di biomolecole mirati 6. In secondo luogo, in genere hanno una grande dimensione idrodinamica (&gt; 20 nm) che limita l&#39;accessibilità per determinati ambienti affollati cellulari 7. In terzo luogo, essi hanno limitato il targeting modularità 7. Diverse strategie hanno tentato di affrontare questi problemi 8,9,10, ma in genere richiedono conoscenze e reagenti speciali implementare. Per affrontare questi problemi, abbiamo recentemente riportato una strategia di &quot;esclusione sterica&quot; ​​per la preparazione monovalente, piccolo, emodulari QD 11. I QD sono avvolti con un unico lungo DNA fosforotioato (ptDNA) polimero. Il ptDNA si lega alla superficie QD attraverso molteplici interazioni Zn-S tra gli atomi di Zn-superficie esposta ei gruppi fosforotioati del polimero ptDNA. Un unico polimero legato stericamente e elettrostaticamente esclude il legame di equivalenti aggiuntivi del polimero senza aumentare significativamente la dimensione complessiva della particella (circa 2 nm). Tutti i reagenti sono disponibili in commercio, i prodotti si formano in alto rendimento, e il processo richiede pochi passi dissalazione per la purificazione. Una volta etichettato, QD avvolto con un unico ptDNA (MQDS) si legano ai filamenti di DNA complementari recanti domini di targeting (ad esempio, benzylguanine (BG), benzylcytosine, o alkylhalides). Queste funzionalità di mira i MQDS specificamente per tag enzimatici come la SNAP, CLIP &amp; HALO che sono geneticamente fuse alla proteina di interesse. Questo è un protocollo per la sintesi, Targeting e live-cell imaging di MQDS prodotti per esclusione sterica.

<table border="0" cellpadding="0" cellspacing="0" width="497">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:91px;">Comments/Description</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">mQD Production:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Phosphorothioate DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(A*)x50-(ACTG)x5</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Quantum Dots:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="127">
			<td height="127" style="height:127px;width:216px;">QDots 525, 585, 605 &#38; 625</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">Q21791MP (545), Q21711MP (585), Q21701MP (605)</td>
			<td style="width:91px;">Custom QD synthesis for QD625.</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">QD610</td>
			<td style="width:71px;">Ocean Nanotech</td>
			<td style="width:119px;">QSP-610-10&#160;</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">QD 610 lamda</td>
			<td style="width:71px;">Aldrich</td>
			<td style="width:119px;">731854</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Chloroform, 99.8%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">67-66-3</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Tetrabutylammonium bromide, 98.0%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">426288</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95%</td>
			<td style="width:71px;">Polypure</td>
			<td style="width:119px;">11156-0695</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:216px;">HSC11EG6CO2H&#160; [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H]</td>
			<td style="width:71px;">ProChimia</td>
			<td style="width:119px;">TH 003-m11.n6-0.1</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Boric Acid, 99.5%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">B0394</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Sodium Hydroxide, 99.0%</td>
			<td style="width:71px;">ACROS</td>
			<td style="width:119px;">S/4845</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Sodium Chloride, 98%</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">310166</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Agarose LE</td>
			<td style="width:71px;">U.S. Biotech Sources</td>
			<td style="width:119px;">G02PD-125</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Ethanol</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">459828</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">BG-DNA Production:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Amine DNA:</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">(CAGT)5(T)40-NH2</td>
			<td style="width:71px;">IDT</td>
			<td style="width:119px;">N/A</td>
			<td style="width:91px;">Most DNA Synthesis companies</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">NHS-GLA-Benzylguanine</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">S9151</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">DMSO</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D8428</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">HEPES Buffer</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">83264</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">NAP5 Column</td>
			<td style="width:71px;">GE Healthcare</td>
			<td style="width:119px;">17-0853-01</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">C18 Column</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Acetonitrile</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">Mammalian Cell Culture &#38; Imaging:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Cell line expressing SNAP-tagged protein</td>
			<td style="width:71px;">New England Biosciences</td>
			<td style="width:119px;">E9100S</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">McCoys 5A</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;">Specific to U2OS culture</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">PBS</td>
			<td style="width:71px;">UCSF Cell Culture Facility (?)</td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">Nunc Lab-tek II Chambered Coverglass</td>
			<td style="width:71px;">Thermo-Fischer Scientific</td>
			<td style="width:119px;">155409</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:216px;">Matriplate 96-well plate</td>
			<td style="width:71px;">Brooks Life Science Systems</td>
			<td style="width:119px;">MGB096-1-2-LG-L</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">BSA</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:216px;">5% Alkali-soluble Casein</td>
			<td style="width:71px;">EMD Millipore</td>
			<td style="width:119px;">70955</td>
			<td style="width:91px;">Not all caseins are the same</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;">(Optional) DNA Synthesis Reagents:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">5&#8217; Amine modifier C6</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">Oct-06</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">dA-Thiophosphoramidite</td>
			<td style="width:71px;">Glen Research</td>
			<td style="width:119px;">10-700</td>
			<td style="width:91px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Analysis Software:</td>
			<td></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">FIJI</td>
			<td colspan="3">http://valelab.ucsf.edu/~schindelin/</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">RyTrack.pro</td>
			<td colspan="3">http://sun.iwu.edu/~gspaldin/rytrack.html</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Tracker</td>
			<td colspan="3">http://www.gartnerlab.ucsf.edu/more/software</td>
		</tr>
	</tbody>
</table>

production and targeting of monovalent quantum dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in biology, where clustering and the spatial organization of biomolecules is often the object of study. We describe here a protocol to produce monovalent quantum dots (mQDs) that can be accomplished in most biological research laboratories via a simple mixing of CdSe/ZnS core/shell QDs with phosphorothioate DNA (ptDNA) of defined length. After a single ptDNA strand has wrapped the QD, additional strands are excluded from the surface. Production of mQDs in this manner can be accomplished at small and large scale, with commercial reagents, and in minimal steps. These mQDs can be specifically directed to biological targets by hybridization to a complementary single stranded targeting DNA. We demonstrate the use of these mQDs as imaging probes by labeling SNAP-tagged Notch receptors on live mammalian cells, targeted by mQDs bearing a benzylguanine moiety.

Il trasferimento di fase dei QD da un organico ad una fase acquosa è critica per la produzione di MQDS, ma può essere sia condizionamento e QD-specifico. Trasferimento di fase nella sezione 1.1 dovrebbe apparire pulito come i primi due flaconcini in Figura 3. Se il trasferimento appare più come fiala 3, allora si dovrebbe cercare di nuovo con condizioni diverse. Una volta che i QD sono rivestite con il DNA caricata negativamente dovrebbero migrare su un gel separatamente dai QD non avvolto. Utilizzando una aliquota di QD da scartare come un controllo, una seconda, fascia più veloce la migrazione dovrebbe apparire sulla aggiunta del ptDNA, come si è visto nel primo gel in figura 2B. Formazione completa a MQDS è dimostrato con la perdita della banda immobile, e la sua caduta nella banda cellulare come visto nell&#39;ultimo gel in Figura 2B. Se una aliquota di prodotto dell&#39;MQD migra come una singola banda separabili dai QD da scartare, quindi i vostri MQDS sono monovalenti e r<html> Eady per essere utilizzato in ulteriori passi. Etichettatura delle cellule dovrebbe essere specifico per il target di vostra scelta e dovrebbe essere dipendente da livelli di espressione di proteine ​​e concentrazione MQD. Ottimizzazione empirica sia di concentrazione MQD e MQD passivazione è spesso necessaria per una determinata applicazione. Figura 4B mostra l&#39;etichettatura delle cellule U2OS che esprimono un recettore Notch SNAP-tag con MQDS che variano in concentrazione da 0,5 Nm a 10 Nm. <img fo:content-width="6in" width="600" alt="Figura 1" src="/files/ftp_upload/52198/52198fig1highres.jpg" /> Figura 1 modulare il targeting di MQDS. MQDS ibridano a ssDNA funzionalizzati da varie molecole di targeting. Benzylguanine-legata obiettivi DNA MQDS di SNAP-tag proteine ​​di fusione. Altri 5 &#39;modifiche e sequenze di DNA permettono la presa di mira di MQDS a una varietà di altre biomolecole./files/ftp_upload/52198/52198fig1highres.jpg &quot;target =&quot; _blank &quot;&gt; Clicca qui per visualizzare una versione più grande di questa figura. <img fo:content-width="6in" width="600" alt="Figura 2" src="/files/ftp_upload/52198/52198fig2highres.jpg" /> Figura 2 Schema per la produzione di MQDS. (A) QD Organic-fase vengono trasferite alla fase acquosa mediante trattamento con mPEG tiolo e TBAB, avvolto con ptDNA, e passivato con carbossi PEG6 tiolo alcani. Immagini rappresentative TEM sono QD545 organico, QD585, e QD605 rispettivamente. (B) Un metodo per determinare empiricamente la stechiometria di interazione tra QD e ptDNA al precedente punto due. QD &amp; ptDNA stechiometrie sono empiricamente verificate da densitometria tale che la stechiometria di reazione finale è di 1: 1 (QD: ptDNA). Il numero iniziale di moli di ptDNA è moltiplicato per il rapporto di QD: MQD, e regolata dal af effettivo volume di<html> ter coniugazione di cedere il numero di moli necessari per raggiungere 1:. 1 coniugazione <a href="https://www.jove.com/files/ftp_upload/52198/52198fig2highres.jpg" target="_blank">Cliccare qui per visualizzare una versione più grande di questa figura.</a> <img fo:content-width="6in" width="600" alt="Figura 3" src="/files/ftp_upload/52198/52198fig3highres.jpg" /> Figura 3. dettagli sperimentali per la produzione di MQDS. (A) foto rappresentative di successo e fallito il trasferimento di fase. QD dovrebbe trasferire visivamente tra la fase organica densa e la fase acquosa meno densa. Separazione di fase incompleta indica scarsa trasferimento. (B) ptDNA può essere sostituito dal alcano-PEG-tiolo. Dati gel di destra è rappresentativo di una reazione in cui una frazione significativa di ptDNA sono stati sfollati dai QD a causa di eccesso di passivazione.ES.jpg &quot;target =&quot; _blank &quot;&gt; Clicca qui per visualizzare una versione più grande di questa figura. <img fo:content-width="6in" width="600" alt="Figura 4" src="/files/ftp_upload/52198/52198fig4highres.jpg" /> Figura 4 Etichettatura proteine ​​SNAP-tag su cellule vive. (A) Schema che dimostra l&#39;espressione, l&#39;attaccamento e l&#39;etichettatura di un recettore SNAP-tag con un MQD BG-targeting. (B) l&#39;etichettatura Rappresentante di cellule che esprimono una SNAP-Notch-mCherry costruire a varie concentrazioni MQD. MQDS passivato con PEG12 colocalizzano con mCherry indica etichettatura specifica. Densità di etichettatura più bassi (&lt;0,5 nM) sono generalmente preferibili per l&#39;inseguimento singola particella. Barra della scala è di 10 micron. <a href="https://www.jove.com/files/ftp_upload/52198/52198fig4highres.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a>

Watch this Scientific Journal Video about Production and Targeting of Monovalent Quantum Dots at JoVE.com

Production and Targeting of Monovalent Quantum Dots

We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications.

Produzione e Targeting di monovalente Quantum Dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in ...

production-and-targeting-of-monovalent-quantum-dots

Research

JoVE Journal

Bioengineering

25.4K Views.  University of California, San Francisco. We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications. 

Video: Production and Targeting of Monovalent Quantum Dots

Solubilization and Bio-conjugation of Quantum Dots and Bacterial Toxicity Assays by Growth Curve and Plate Count

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. QDs have attracted a lot of interest for imaging, diagnostics, and therapy due to their bright, stable fluorescence1,2 3,4,5. QDs can be conjugated to a variety of bio-active molecules for binding to bacteria and mammalian cells6.
QDs are also being widely investigated as cytotoxic agents for targeted killing of bacteria. The emergence of multiply-resistant bacterial strains is rapidly becoming a public health crisis, particularly in the case of Gram negative pathogens 7. Because of the well-known antimicrobial effect of certain nanomaterials, especially Ag, there are hundreds of studies examining the toxicity of nanoparticles to bacteria 8. Bacterial studies have been performed with other types of semiconductor nanoparticles as well, especially TiO2 9,10-11, but also ZnO12 and others including CuO 13. Some comparisons of bacterial strains have been performed in these studies, usually comparing a Gram negative strain with a Gram positive. With all of these particles, mechanisms of toxicity are attributed to oxidation: either the photogeneration of reactive oxygen species (ROS) by the particles or the direct release of metal ions that can cause oxidative toxicity. Even with these materials, results of different studies vary greatly. In some studies the Gram positive test strain is reportedly more sensitive than the Gram negative 10; in others it is the opposite 14. These studies have been well reviewed 15.
In all nanoparticle studies, particle composition, size, surface chemistry, sample aging/breakdown, and wavelength, power, and duration of light exposure can all dramatically affect the results. In addition, synthesis byproducts and solvents must be considered16 17. High-throughput screening techniques are needed to be able to develop effective new nanomedicine agents.
CdTe QDs have anti-microbial effects alone18 or in combination with antibiotics. In a previous study, we showed that coupling of antibiotics to CdTe can increase toxicity to bacteria but decrease toxicity to mammalian cells, due to decreased production of reactive oxygen species from the conjugates19. Although it is unlikely that cadmium-containing compounds will be approved for use in humans, such preparations could be used for disinfection of surfaces or sterilization of water.
In this protocol, we give a straightforward approach to solubilizing CdTe QDs with mercaptopropionic acid (MPA). The QDs are ready to use within an hour. We then demonstrate coupling to an antimicrobial agent.
The second part of the protocol demonstrates a 96-well bacterial inhibition assay using the conjugated and unconjugated QDs. The optical density is read over many hours, permitting the effects of QD addition and light exposure to be evaluated immediately as well as after a recovery period. We also illustrate a colony count for quantifying bacterial survival.

Nanoparticles such as semiconductor quantum dots (QDs) can be used to create photoactivatable agents for anti-microbial or anti-cancer applications. This technique shows how to water-solubilize cadmium telluride (CdTe) QDs, conjugate them to an antibiotic, and perform a bacterial inhibition assay based upon growth curves and plate count.

Solubilizzazione e Bio-coniugazione dei punti quantici e test di tossicità batterica curva di crescita e conta in piastra

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. ...

Ricerca

Bioingegneria

Cell Labeling and Targeting with Superparamagnetic Iron Oxide Nanoparticles

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the target site while minimizing deleterious effects to off-target sites. Magnetic cell targeting is an efficient, safe, and straightforward delivery technique. Superparamagnetic iron oxide nanoparticles (SPION) are biodegradable, biocompatible, and can be endocytosed into cells to render them responsive to magnetic fields. The synthesis process involves creating magnetite (Fe3O4) nanoparticles followed by high-speed emulsification to form a poly(lactic-co-glycolic acid) (PLGA) coating. The PLGA-magnetite SPIONs are approximately 120 nm in diameter including the approximately 10 nm diameter magnetite core. When placed in culture medium, SPIONs are naturally endocytosed by cells and stored as small clusters within cytoplasmic endosomes. These particles impart sufficient magnetic mass to the cells to allow for targeting within magnetic fields. Numerous cell sorting and targeting applications are enabled by rendering various cell types responsive to magnetic fields. SPIONs have a variety of other biomedical applications as well including use as a medical imaging contrast agent, targeted drug or gene delivery, diagnostic assays, and generation of local hyperthermia for tumor therapy or tissue soldering.

Targeted cell delivery is useful in a variety of biomedical applications. The goal of this protocol is to use superparamagnetic iron oxide nanoparticles (SPION) to label cells and thereby enable magnetic cell targeting approaches for a high degree of control over cell delivery and localization.

Etichettatura delle cellule e Targeting con superparamagnetico ossido di ferro nanoparticelle

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the ...

Solid Lipid Nanoparticles (SLNs) for Intracellular Targeting Applications

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter cellular signaling and gene expression. In a previous investigation, the synthesis of ultra-small solid lipid nanoparticles (SLNs) for topical drug delivery and biomarker detection applications was demonstrated. SLNs are a well-studied example of a nanoparticle delivery system that has emerged as a promising drug delivery vehicle. In this study, SLNs were loaded with a fluorescent dye and used as a model to investigate particle-cell interactions. The phase inversion temperature (PIT) method was used for the synthesis of ultra-small populations of biocompatible nanoparticles. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylphenyltetrazolium bromide (MTT) assay was utilized in order to establish appropriate dosing levels prior to the nanoparticle-cell interaction studies. Furthermore, primary human dermal fibroblasts and mouse dendritic cells were exposed to dye-loaded SLN over time and the interactions with respect to toxicity and particle uptake were characterized using fluorescence microscopy and flow cytometry. This study demonstrated that ultra-small SLNs, as a nanoparticle delivery system, are suitable for intracellular targeting of different cell types.

Solid Lipid Nanoparticles SLNs for Intracellular Targeting Applications

In this study, a method for synthesizing ultra-small populations of biocompatible nanoparticles was described, as well as several in vitro methods by which to assess their cellular interactions.

Solid Lipid nanoparticelle (linfonodi sentinella) Applicazioni per intracellulare targeting

Nanoparticle-based delivery vehicles have shown great promise for intracellular targeting applications, providing a mechanism to specifically alter ...

A Rapid and Quantitative Fluorimetric Method for Protein-Targeting Small Molecule Drug Screening

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold nanoclusters (Au NCs) within the drug-loaded protein, based on the differential fluorescence signal emitted by the Au NCs. Albumin proteins such as human serum albumin (HSA) and bovine serum albumin (BSA) are selected as the model proteins. Four small molecular drugs (e.g., ibuprofen, warfarin, phenytoin, and sulfanilamide) of different binding affinities to the albumin proteins are tested. It was found that the formation rate of fluorescent Au NCs inside the drug loaded albumin protein under denaturing conditions (i.e., 60 &#176;C or in the presence of urea) is slower than that formed in the pristine protein (without drugs). Moreover, the fluorescent intensity of the as-formed NCs is found to be inversely correlated to the binding affinities of these drugs to the albumin proteins. Particularly, the higher the drug-protein binding affinity, the slower the rate of Au NCs formation, and thus a lower fluorescence intensity of the resultant Au NCs is observed. The fluorescence intensity of the resultant Au NCs therefore provides a simple measure of the relative binding strength of different drugs tested. This method is also extendable to measure the specific drug-protein binding constant (KD) by simply varying the drug content preloaded in the protein at a fixed protein concentration. The measured results match well with the values obtained using other prestige but more complicated methods.

A protocol for small molecular drug screening based on in-situ synthesis of ultrasmall fluorescent gold nanoclusters (Au NCs) using drug-loaded protein as template is presented. This method is simple to determine the binding affinity of drugs to a target protein by a visible fluorescent signal emitted from the protein-templated Au NCs.

Una rapida e quantitativa metodo fluorimetrico per lo screening di stupefacenti piccole molecole di proteine ​​Targeting

We demonstrate a new drug screening method for determining the binding affinity of small drug molecules to a target protein by forming fluorescent gold ...

Correlative Light- and Electron Microscopy Using Quantum Dot Nanoparticles

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using widefield fluorescence light microscopy and transmission electron microscopy (TEM). To demonstrate the protocol we have immunolabeled ultrathin epoxy sections of human somatostatinoma tumor using a primary antibody to somatostatin, followed by a biotinylated secondary antibody and visualization with streptavidin conjugated 585 nm cadmium-selenium (CdSe) quantum dots (QDs). The sections are mounted on a TEM specimen grid then placed on a glass slide for observation by widefield fluorescence light microscopy. Light microscopy reveals 585 nm QD labeling as bright orange fluorescence forming a granular pattern within the tumor cell cytoplasm. At low to mid-range magnification by light microscopy the labeling pattern can be easily recognized and the level of non-specific or background labeling assessed. This is a critical step for subsequent interpretation of the immunolabeling pattern by TEM and evaluation of the morphological context. The same section is then blotted dry and viewed by TEM. QD probes are seen to be attached to amorphous material contained in individual secretory granules. Images are acquired from the same region of interest (ROI) seen by light microscopy for correlative analysis. Corresponding images from each modality may then be blended to overlay fluorescence data on TEM ultrastructure of the corresponding region.

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of epoxy embedded human pathology tissue. We employ commercial antibody fragment conjugated QDs that are visualized by widefield fluorescence light microscopy and transmission electron microscopy.

Correlativo luce e microscopia elettronica Utilizzando Quantum Dot nanoparticelle

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using ...

Initial Evaluation of Antibody-conjugates Modified with Viral-derived Peptides for Increasing Cellular Accumulation and Improving Tumor Targeting

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used in cancer treatment and imaging due to increased cellular accumulation over current ACs. During early AC in vitro development, fluorescence techniques and radioimmunoassays are sufficient for determining intracellular localization, accumulation efficiency, and target cell specificity. Currently, there is no consensus on standardized methods for preparing cells for evaluating AC intracellular accumulation and localization. The initial testing of ACs modified with virus-derived peptides is critical especially if several candidates have been constructed. Determining intracellular accumulation by fluorescence can be affected by background signal from ACs at the cell surface and complicate the interpretation of accumulation. For radioimmunoassays, typically treated cells are fractionated and the radioactivity in different cell compartments measured. However, cell lysis varies from cell to cell and often nuclear and cytoplasmic compartments are not adequately isolated. This can produce misleading data on payload delivery properties. The intravenous injection of radiolabeled virus-derived peptide-modified ACs in tumor bearing mice followed by radionuclide imaging is a powerful method for determining tumor targeting and payload delivery properties at the in vivo phase of development. However, this is a relatively recent advancement and few groups have evaluated virus-derived peptide-modified ACs in this manner. We describe the processing of treated cells to more accurately evaluate virus-derived peptide-modified AC accumulation when using confocal microscopy and radioimmunoassays. Specifically, a method for trypsinizing cells to remove cell surface bound ACs. We also provide a method for improving cellular fractionation. Lastly, this protocol provides an in vivo method using positron emission tomography (PET) for evaluating initial tumor targeting properties in tumor-bearing mice. We use the radioisotope 64Cu (t1/2 = 12.7 h) as an example payload in this protocol.

Viral-derived peptides coupled to antibody-conjugates (ACs) is an approach gaining momentum due to the potential of delivering molecular payloads with increased tumor cell accumulation. Utilizing common methods to evaluate peptide conjugation, AC and payload intracellular accumulation, and tumor targeting, this protocol helps researchers during the key initial development phases.

Valutazione iniziale di anticorpo-coniugati modificate con peptidi virali-derivati per accumulo cellulare di aumentare e migliorare il Targeting tumorale

Antibody-conjugates (ACs) modified with virus-derived peptides are a potentially powerful class of tumor cell delivery agents for molecular payloads used ...

20 mJ, 1 ps Yb:YAG Thin-disk Regenerative Amplifier

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with turn-key performance and microjoule-level pulse energy is used to seed the regenerative chirped-pulse amplifier. The amplifier is placed in airtight housing. It operates at room temperature and exhibits stable operation at a 5 kHz repetition rate, with a pulse-to-pulse stability less than 1%. By employing a 1.5 mm-thick beta barium borate crystal, the frequency of the laser output is doubled to 515 nm, with an average power of 70 W, which corresponds to an optical-to-optical efficiency of 70%. This superior performance makes the system an attractive pump source for optical parametric chirped-pulse amplifiers in the near-infrared and mid-infrared spectral range. Combining the turn-key performance and the superior stability of the regenerative amplifier, the system facilitates the generation of a broadband, CEP-stable seed. Providing the seed and pump of the optical parametric chirped-pulse amplification (OPCPA) from one laser source eliminates the demand of active temporal synchronization between these pulses. This work presents a detailed guide to set up and operate a Yb:YAG thin-disk regenerative amplifier, based on chirped-pulse amplification (CPA), as a pump source for an optical parametric chirped-pulse amplifier.

A protocol for the operation of a high-energy, high-power optical parametric chirped pulse amplifier pump source based on an Yb:YAG thin-disk regenerative amplifier is presented here.

20 mJ, 1 ps Yb: YAG Amplificatore rigenerativo a disco rigido

This is a report on a 100 W, 20 mJ, 1 ps Yb:YAG thin-disk regenerative amplifier. A homemade Yb:YAG thin-disk, Kerr-lens mode-locked oscillator with ...

Synthesis of Monocyte-targeting Peptide Amphiphile Micelles for Imaging of Atherosclerosis

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. Atherosclerosis is also the leading cause of sudden death and myocardial infarction, instigated by unstable plaques that rupture and occlude the blood vessel without warning. Current imaging modalities cannot differentiate between stable and unstable plaques that rupture. Peptide amphiphiles micelles (PAMs) can overcome this drawback as they can be modified with a variety of targeting moieties that bind specifically to diseased tissue. Monocytes have been shown to be early markers of atherosclerosis, while large accumulation of monocytes is associated with plaques prone to rupture. Hence, nanoparticles that can target monocytes can be used to discriminate different stages of atherosclerosis. To that end, here, we describe a protocol for the preparation of monocyte-targeting PAMs (monocyte chemoattractant protein-1 (MCP-1) PAMs). MCP-1 PAMs are self-assembled through synthesis under mild conditions to form nanoparticles of 15 nm in diameter with near neutral surface charge. In vitro, PAMs were found to be biocompatible and had a high binding affinity for monocytes. The methods described herein show promise for a wide range of applications in atherosclerosis as well as other inflammatory diseases.

This paper presents a method involving the synthesis and characterization of monocyte-targeting peptide amphiphile micelles and the corresponding assays to test for biocompatibility and ability of the micelle to bind to monocytes.

Sintesi del monocito-targeting Peptide Amphiphile micelle per l'Imaging di aterosclerosi

Atherosclerosis is a major contributor to cardiovascular disease, the leading cause of death worldwide, which claims 17.3 million lives annually. ...

Synthesis of Functionalized 10-nm Polymer-coated Gold Particles for Endothelium Targeting and Drug Delivery

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting and drug delivery are some of the applications of these AuNPs, but endothelial extracellular matrices&#39; defensive properties hamper particle uptake. To address this issue, we describe a synthesis method for ultrasmall gold nanoparticles to improve vascular delivery, with customizable functional groups and polymer lengths for further adjustments. The protocol yields 2.5 nm AuNPs that are capped with tetrakis(hydroxymethyl)phosphonium chloride (THPC). The replacement of THPC with hetero-functional polyethylene glycol (PEG) on the surface of the AuNP increases the hydrodynamic radius to 10.5 nm while providing various functional groups on the surface. The last part of the protocol includes an optional addition of a fluorophore to allow the AuNPs to be visualized under fluorescence to track nanoparticle uptake. Dialysis and lyophilization were used to purify and isolate the AuNPs. These fluorescent nanoparticles can be visualized in both in vitro and in vivo experiments due to the biocompatible PEG coating and fluorescent probes. Additionally, the size range of these nanoparticles render them an ideal candidate for probing the glycocalyx without disrupting normal vasculature function, which may lead to improved delivery and therapeutics.

We describe a method of synthesizing biocompatible 10-nm gold nanoparticles, functionalized by coating poly-ethylene glycol onto the surface. These particles can be used in vitro and in vivo for delivering therapeutics to nanoscale cellular and extracellular spaces that are difficult to access with conventional nanoparticle sizes.

Sintesi di particelle d'oro rivestite di polimeri 10-nm funzionalizzate per il Targeting di endotelio e Drug Delivery

Gold nanoparticles (AuNPs) have been used extensively in medical research due to their size, biocompatibility, and modifiable surface. Specific targeting ...

Targeting Neuronal Fiber Tracts for Deep Brain Stimulation Therapy Using Interactive, Patient-Specific Models

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for movement disorders and is being applied to a growing number of disorders. Computational modeling has been successfully used to predict the clinical effects of DBS; however, there is a need for novel modeling techniques to keep pace with the growing complexity of DBS devices. These models also need to generate predictions quickly and accurately. The goal of this project is to develop an image processing pipeline to incorporate structural magnetic resonance imaging (MRI) and diffusion weighted imaging (DWI) into an interactive, patient specific model to simulate the effects of DBS. A virtual DBS lead can be placed inside of the patient model, along with active contacts and stimulation settings, where changes in lead position or orientation generate a new finite element mesh and solution of the bioelectric field problem in near real-time, a timespan of approximately 10 seconds. This system also enables the simulation of multiple leads in close proximity to allow for current steering by varying anodes and cathodes on different leads. The techniques presented in this paper reduce the burden of generating and using computational models while providing meaningful feedback about the effects of electrode position, electrode design, and stimulation configurations to researchers or clinicians who may not be modeling experts.

The goal of this project is to develop an interactive, patient-specific modeling pipeline to simulate the effects of deep brain stimulation in near real-time and provide meaningful feedback as to how these devices influence neural activity in the brain.

Tratti della fibra di un neurone di targeting per la terapia di stimolazione cerebrale profonda utilizzando modelli interattivi, specifico per ogni paziente

Deep brain stimulation (DBS), which involves insertion of an electrode to deliver stimulation to a localized brain region, is an established therapy for ...