המחברים מכירים בכך שהאדמה שעליה ביצעו את המחקר הזה היא הטריטוריה המסורתית, הקדומה והבלתי מוגבלת של אומת המוסקאם (xwməθkwəy̓əm). הארץ עליה היא ממוקמת תמיד הייתה מקום למידה עבור אנשי מוסקאם, שבמשך אלפי שנים העבירו הלאה את תרבותם, ההיסטוריה והמסורות שלהם מדור לדור באתר זה. אנו מעודדים אחרים ללמוד עוד על אדמות הילידים שבהן הם חיים ועובדים https://native-land.ca. המחברים מודים על תמיכת המועצה למדעי הטבע וההנדסה של קנדה (NSERC) מלגות לתואר שני - תואר שני (N.P.), פרס מייקל סמית 'מחקר בריאות BC Trainee Award (RT-2023-3174, ל- MH), מועצת המחקר למדעי הטבע וההנדסה של קנדה (NSERC) תוכנית מענקי גילוי (RGPIN-2019-04591 ל- C.T., RGPIN-2016-04282 ל- LCO), המכון הקנדי למחקר מתקדם / בני אדם והמיקרוביום (FL-001253 Appt 3362, ל-C.T.), פרס Michael Smith Foundation for Health Research Scholar Award (18239, ל-C.T.), המכונים הקנדיים לחקר הבריאות (PJT-159458 ל-LCO) והקרן הקנדית לחדשנות (34673 ל-LCO ו-38277 ל-CT). אנו אסירי תודה על התמיכה הטכנית ממרכז UBC למידול מחלות ו-ubcFLOW, הנתמך על ידי יוזמת החוסן הביולוגי UBC GREx, ולחברי מעבדות אוסבורן וטרופיני על דיונים קריטיים והערכה של כתב היד. איור 1A ואיור 2A נוצרו באמצעות Biorender.com.

חקר דינמיקה של חיידקי פאג'-מעיים במודלים של מורין באמצעות פאגים מסוג T4

למחברים אין מה לחשוף.

חקר הפאגים במיקרוביום מהווה אתגר משמעותי בהשוואה למקביליהם החיידקיים. באופן ספציפי, פאגים אינם מכילים סמן פילוגנטי שמור המשותף לכל הפאגים בדומה לתת-היחידות הריבוזומליות 16S ו-18S המאפשרות את הקלות בריצוף ובזיהוי של מינים פרוקריוטים ואיקריוטים, בהתאמה42. עם זאת, עם ההתקדמות בגיש...

בקטריופאג'ים, או פאגים, הם וירוסים שמדביקים והורגים חיידקים עם מינים וספציפיות ברמת הזן1. פאגים ממלאים תפקידים חשובים בקהילות חיידקים מורכבות כמו מיקרוביוטת המעיים, שם הם היו מעורבים בוויסות דינמיקת האוכלוסייה ובהנעת כושר חיידקי2. במהלך העשור האחרון, התעורר עניין מחודש במחקר פאגים עקב עלייתם של פתוגנים עמידים אנטי-מיקרוביאליים3, והפוטנציאל לטיפול בפאגים כאסטרטגיית טיפול אלטרנטיבית. בשנים האחרונות נעשה שימוש בקוקטיילים של פאגים ליטיים דרך הווריד בהצלחה מסוימת בזיהומים ספטיים חיידקיים חמורים ועמידים לאנטיביוטיקה בבני אדם 3,4. טיפול בפאגים דרך הפה הוצע גם כחלופה פוטנציאלית לאנטיביוטיקה לטיפול בדלקות מעיים ודלקות. יתר על כן, פאגים היו מעורבים בהצלחה של השתלות תסנין צואה (FFT), שהם תכשירי מיקרוביוטה צואתיים שסוננו לסילוק חיידקים, בטיפול בזיהום חוזר של Clostridioides difficile (rCDI)5,6, הפרעות מעי דלקתיות (IBD)7,8 ודלקת מעיים נמקית בפגים9. בהתחשב בתוצאות אלה, חשוב לקחת בחשבון אינטראקציות הן בין פאגים ומיקרוביוטת המעיים, והן בין פאגים לבין פונדקאי היונקים, שכן להוספת פאגים חדשים לקהילה קיימת עשויות להיות השפעות עקיפות על הקהילה כולה, ולא רק על חיידקי המטרה שלה 2,10.
המחקר של אינטראקציות פאגים עם חיידקי המטרה שלהם במבחנה הוכח כיעיל להבנת המנגנונים וההשפעות של אינטראקציות פאגים וחיידקים במעיים. במסגרת זו, הוכח כי פאגים T4 ספציפיים ל- Escherichia coli מסדר Caudovirales דורשים תחומים דמויי אימונוגלובולין (Ig) הממוקמים בתוך חלבוני קפסיד חיצוני אנטיגני מאוד (Hoc) על פני השטח של הנגיפים כדי להיצמד לליחה במעי11. בנוסף, מבחני טרנסוול הראו כי פאגים מסוג T4 מסוגלים לקיים אינטראקציה עם תרביות תאי אפיתל ולבצע טרנסלוקציה דרך שכבות התא על ידי מקרופינוציטוזה12,13. תוצאות אלה תומכות בהשערה שפאגים יכולים לתקשר עם הפונדקאי המטזואני שלהם, אף על פי שהם אינם מסוגלים להדביק תאים איקריוטים. מודלים אלה, למרות שהם שימושיים, חסרים את כל טווח האינטראקציות המורכבות המתרחשות במערכת האקולוגית של המעיים הדרושות לחקירה מקיפה של האינטראקציה המשולשת בין פאגים, חיידקים והפונדקאי המטזואני.
מודלים של עכברים הם כלי חשוב לחקר פאגים בסביבות מורכבות. יישום רצוי של מתן פאגים הוא כאסטרטגיה חלופית לטיפול בזיהומים עמידים מיקרוביאליים או פתוביונטים הקשורים למחלות דלקתיות כרוניות, כולל IBD. עם זאת, ספרות חדשה מציעה כי התנהגות פאגים במבחנה אינה מייצגת באופן מלא פונקציות in vivo. Buttimer et al.14 הראו כי קוקטייל פאגים היה מסוגל לרוקן את חיידקי המטרה בקונסורציום מיקרוביוטה אנושית פשוטה במבחנה, אך לא ניתן היה לשכפל אותו in vivo בעכברים גנוטוביוטיים שהתיישבו באותו קונסורציום חיידקים-פאגים. יתר על כן, במיקרוביום עכבר קונבנציונלי, פאג T7 הוביל לדלדול סלקטיבי של חיידקי המעיים שלו, אם כי נצפתה התאוששות הדרגתית לאורך זמן, המעידה על עמידות מפותחת15. מחקרים אחרים הוכיחו דו-קיום של פאגים הניתנים דרך הפה וזני חיידקי המטרה שלהם in vivo 2,16. ואכן, מעבר לדו-קיום של פאגים/חיידקים, מתן פאגים הוביל לשינויים נרחבים בהרכב ובתפקוד הכולל של קהילת המיקרוביוטה 2,16. זה רלוונטי במצבי מחלה, שכן מספר מחקרים מצאו קשרים בין שפע יחסי מוגבר של Caudovirales ו- IBD 7,8,17 שהיו בלתי תלויים בשינויים בשפע חיידקים7. עדיין לא ידוע אם זהו מניע או תוצאה של פתוגנזה של המחלה.
המוקד ההיסטורי של חקר הפאגים היה סביב הקשר בין פאג לבין חיידק המטרה שלו. עם זאת, חשוב גם לקחת בחשבון אינטראקציות אפשריות בין פאגים לבין הרירית, האפיתל ומערכת החיסון של הפונדקאי המטזואני. כל האינטראקציות האלה ממלאות תפקיד חשוב בתגובה הכוללת לזיהום פאגים במעי. כדי להדגים זאת, פאגים נחקרו באמצעות עכברים נטולי חיידקים (GF) כדי להבהיר את השפעתם על מערכת החיסון ללא הפרעה של המיקרוביוטה8. במערכת זו, חומצות גרעין פאגים זוהו על ידי קולטנים דמויי טול (TLR) הממוקמים בתוך אנדוזומים של תאי חיסון פגוציטיים (מקרופאגים ותאים דנדריטיים). זה הפעיל איתות במורד הזרם ועורר ייצור תלוי תאי T של אינטרפרון (IFN)-γ8 או סוג I IFNs18. יתר על כן, Fluckiger et al.19 עירבו תאי זיכרון CD8+ T בזיהוי אנטיגנים מקודדי פאגים (פרופאג'ים), מה שהביא לתגובתיות צולבת של תאי T עם אנטיגנים סרטניים, וכתוצאה מכך נטל הגידול מופחת. לבסוף, ייצור נוגדנים ספציפיים לפאגים תועד במחקרי עכברים שבהם פאגים הועברו למודלים של בעלי חיים באופן מתמשך באמצעות מי שתייה 8,20, או על ידי גאגים פומיים חוזרים ונשנים במשך מספר חודשים20, מה שמדגים את יכולתם של חלבוני פאגים לקדם תגובות חיסוניות הומורליות. אף על פי ששיטות אלה של חיסון פאגים מאפשרות הכנה אופטימלית ומתמשכת של מערכת החיסון, ייתכן שהן אינן מייצגות את האינטראקציות הטבעיות בין פאגים לסביבת המעי, וגם לא את הקינטיקה של טיפול בפאגים המיושמים דרך הפה. עד כה, מספר מצומצם של מחקרים בחנו את יחסי הגומלין של פאגים עם מין חיידק יחיד במודלים של עכברים חד-מושבתיים21. עם זאת, עכברים חד-מושבתיים הוכיחו את עצמם כקריטיים בפענוח השפעות ספציפיות של חיידקים של מינים בודדים על מערכת העיכול (GI) ועל התפתחות מערכת החיסון 22,23,24, והם עדיין עשויים להיות שימושיים בהבנת אינטראקציות משולשות בין פאגים, חיידקי המטרה שלהם והפונדקאי המטזואני.
באופן מלהיב, יש עדיין הרבה מה ללמוד על יחסי הגומלין בין פאגים במעיים לבין חיידקי מעיים, כמו גם על יחסי הגומלין המתרחשים בין המאכסן המטזואני לבין הפאגים השוכנים בתוכו. פרוטוקול זה מספק סדרה של הליכים לחקר פאג T4 מבודד ומקבילו החיידקי, E. coli (K-12, BW25113), באמצעות מודל עכבר גנוטוביוטי. נהלים סטנדרטיים אלה מספקים גם בסיס לאופטימיזציה של דיאדות פאגים/חיידקים אחרות על ידי התאמת פרמטרי הגידול לזוגות המעניינים. השיטות המתוארות כאן מתארות: (1) הכנת פאגים מסוג T4 וליזאטים של כלי רכב לגידול אוראלי של עכברים; (2) מתן פומי של פאג T4 לעכברים גנוטוביוטיים חד-מושבתיים מסוג E. coli ; (3) ניטור רמות הפאגים מסוג T4 בצואת עכברים וברקמות לאורך זמן.
עבור התוצאות המייצגות שהוצגו כאן, ליזטים מטוהרים של פאגים מסוג T4 הופצו ממניות בנק פאגים שהוחזקו על ידי מעבדת רוהוור. שיטת פאג-און-ברז להפצת פאג T4 הותאמה25, כפי שמוזכר בפרוטוקול זה. השיטה מניבה מלאי פאגים גבוה ואנדוטוקסין נמוך תוך שלושה ימים. באמצעות גישה זו, 10 מ"ל של ≥ 1010 יחידות יוצרות פלאק (pfu)/מ"ל של פאג T4 עם < 0.5 יחידות אנדוטוקסין (EU)/מ"ל נאספו באופן שגרתי. רמות האנדוטוקסין המומלצות למתן פומי או תוך ורידי בעכברים הן ≤ 20 EU/מ"ל ו-≤ 5 EU/kg/h (או 0.1 EU מנוהל מעל שעה אחת עבור עכבר במשקל 20 גרם), בהתאמה, מה שהופך זאת לשיטה מתאימה להכנת פאגים לחיסון in vivo . כל מלאי הפאגים אוחסן בטמפרטורה של 4°C במאגר פאגים של מגנזיום מלוחים (SM) (מתכון סופק בשלב 1.1.5.1). E. coli טופח במדיה LB. עבור זוגות שונים של חיידקי פאג'ים, ניתן להתאים מצעי תרבית ותנאי גדילה מגוונים מפרוטוקול זה. פאגים יכולים גם להיות מופקים מהסביבה, כגון שפכים, מים ימיים, קרקע ותכולת מעיים, וניתן לבודד ולטהר אותם לפי סמברוק וראסל26 לפני ההכנה תוך שימוש בתנאי הגידול והריבוי המתאימים לכל זוג פאגים-פונדקאים25 . לחלופין, ניתן לקבל פאגים ממקורות מסחריים (ראו טבלת חומרים) או מבנקי פאגים.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1-octanol (99%)</td>
			<td>Thermofisher</td>
			<td>CAAAA15977-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>50 ml PES Steriflip Sterile Disposable Vacuum Filter Units</td>
			<td>Millipore Sigma&#160;</td>
			<td>SCGP00525</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose (Low-EEO/Multi-Purpose/Molecular Biology Grade)</td>
			<td>Fisher BioReagents&#160;</td>
			<td>BP160-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon&#174; 100kDa Ultra-15 centrifugal filter device, Ultracel-100</td>
			<td>Millipore Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr>
			<td>BD Microtainer&#174; Tubes, SST</td>
			<td>BD Medical</td>
			<td>365967</td>
			<td></td>
		</tr>
		<tr>
			<td>Bioexclusion airtight cages (ISO cages)&#160;</td>
			<td>Techiplast</td>
			<td>1245ISOCAGE</td>
			<td></td>
		</tr>
		<tr>
			<td>C1000 Touch&#8482; Thermal Cycler with 96-Well Fast Reaction Module</td>
			<td>BioRad</td>
			<td>1851196</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium Chloride Dihydrate (White Crystals to Powder)</td>
			<td>Fisher BioReagents</td>
			<td>BP510-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Cap Locks For 1.5ML Tube 100/pk</td>
			<td>Andwin Scientific&#160;</td>
			<td>16812612</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform (Ethanol as Preservative/Certified ACS)</td>
			<td>Fisher</td>
			<td>C298-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Copper coated steel beads (4.5 mm)</td>
			<td>Crosman Corporation</td>
			<td>0767</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kit (50)</td>
			<td>Thermo Scientific&#160;</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>DreamTaq Green PCR Master Mix (2X)</td>
			<td>Thermo Scientific&#160;</td>
			<td>K1081</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA) disodium salt solution, for molecular biology, 0.5 M in H2O</td>
			<td>Sigma Aldrich</td>
			<td>E7889</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisher BioReagents&#8482; Agar, Powder / Flakes, Fisher BioReagents&#8482;&#160;</td>
			<td>Fisher Bioreagents</td>
			<td>BP1423-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisher BioReagents&#8482; Microbiology Media: LB Broth (Powder) - Lennox&#160;</td>
			<td>Fisher Bioreagents</td>
			<td>BP1427-500</td>
			<td></td>
		</tr>
		<tr>
			<td>GeneRuler 100 bp DNA Ladder</td>
			<td>Thermo Scientific&#160;</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr>
			<td>Green FastMix&#174; qPCR mix, 1250 rxns</td>
			<td>QuantaBio</td>
			<td>95072-012</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPA filters for isocage lids, AUTOCLAVABLE H14 FILTERS FOR ISO LINE- IRRADIATED</td>
			<td>Techiplast</td>
			<td>UISOHEPAXTBOX-300</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium sulfate heptahydrate</td>
			<td>Fisher BioReagents</td>
			<td>BP213-1</td>
			<td></td>
		</tr>
		<tr>
			<td>MaxQ 6000 Incubated Shaker</td>
			<td>Thermo Scientific&#160;</td>
			<td>8354-30-0009</td>
			<td></td>
		</tr>
		<tr>
			<td>Microbiology Media: LB Broth (Powder) - Lennox</td>
			<td>Fisher BioReagents</td>
			<td>BP1427-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge Tubes with Locking Snap Cap, 2ml</td>
			<td>Fisher</td>
			<td>14-666-315</td>
			<td></td>
		</tr>
		<tr>
			<td>Parafilm sealing film</td>
			<td>Bemis</td>
			<td>PM-996</td>
			<td></td>
		</tr>
		<tr>
			<td>Phage stocks</td>
			<td>Carolina Biological Supply&#160;</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>PicoLab&#174; Mouse Diet 20 EXT</td>
			<td>LabDiet</td>
			<td>5R58</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce&#8482; Chromogenic Endotoxin Quant Kit</td>
			<td>Thermo Scientific&#160;</td>
			<td>A39552S</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase A (17,500 U)</td>
			<td>Qiagen</td>
			<td>19101</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-free DNase Set</td>
			<td>Qiagen&#160;</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Bicarbonate (Fine White Powder)</td>
			<td>Fisher Chemical</td>
			<td>BP328-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Chloride (Crystalline/Certified ACS)</td>
			<td>Fisher Chemical</td>
			<td>S271</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator (probe model CL-18; power source model FB50)</td>
			<td>Fisher scentific&#160;</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile flexible film isolator&#160;</td>
			<td>Class Biologically Clean&#160;</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR&#8482; Safe DNA Gel Stain</td>
			<td>Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr>
			<td>T100 Thermal Cycler&#160;</td>
			<td>BioRad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 phage primer, forward (CCACACATAGCGCGAGTATAA)</td>
			<td>IDT</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 phage primer, forward (GAAACTCGGTCAGGCTATCAA)</td>
			<td>IDT</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>TissueLyser II&#160;</td>
			<td>Qiagen&#160;</td>
			<td>85300</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl, 1M Solution, pH 8.0, Molecular Biology Grade, Ultrapure</td>
			<td>Thermo Scientific&#160;</td>
			<td>AAJ22638AE</td>
			<td></td>
		</tr>
		<tr>
			<td>Water, (DNASE, RNASE free)</td>
			<td>Fisher BioReagents</td>
			<td>BP2484100</td>
			<td></td>
		</tr>
	</tbody>
</table>

t4 bacteriophage and e. coli interaction in the murine intestine: a prototypical model for studying host-bacteriophage dynamics in vivo

בקטריופאג'ים (פאג'ים) הם וירוסים שמדביקים חיידקים ברמת המינים והזנים, והם הישויות הביולוגיות הנפוצות ביותר בכל המערכות האקולוגיות הידועות. בתוך קהילות חיידקים, כמו אלה שנמצאות במיקרוביוטה של המעיים, פאגים מעורבים בוויסות הדינמיקה של אוכלוסיית המיקרוביוטה ובהנעת אבולוציה חיידקית. בעשור האחרון התעורר עניין מחודש במחקר פאגים, בין השאר הודות ליכולות ההרג הספציפיות לפונדקאי של פאגים ליטיים, המציעים כלי מבטיח נגד האיום הגובר של חיידקים עמידים מיקרוביאלית. יתר על כן, מחקרים אחרונים המוכיחים כי פאגים נצמדים לליחה במעי מצביעים על כך שייתכן שיש להם תפקיד מגן במניעת פלישת חיידקים לאפיתל הבסיסי. חשוב לציין, שבדומה למיקרוביום חיידקי, פגיאומים משובשים נקשרו להחמרה בתוצאות במחלות כמו מחלות מעי דלקתיות. מחקרים קודמים הראו כי פאגים יכולים לווסת את המיקרוביום של בעלי חיים ובני אדם באמצעות השתלות תסנין צואה, מה שיועיל לבריאות הפונדקאי. עם גל המחקר האחרון מגיע הצורך לבסס ולתקנן פרוטוקולים לחקר פאגים בהקשר של מיקרוביום המעי. פרוטוקול זה מספק סדרה של נהלים לחקר פאגים מבודדים מסוג T4 והפונדקאי החיידקי שלהם, Escherichia coli, בהקשר של מערכת העיכול של מורין. השיטות המתוארות כאן מתארות כיצד להתחיל מליזט פאגים, לתת אותו לעכברים ולהעריך את ההשפעות על רמות החיידקים המארח והפאגים. פרוטוקול זה יכול להשתנות ולהיות מיושם על זוגות פאג'ים-חיידקים אחרים, והוא מספק נקודת מוצא לחקר הדינמיקה של פונדקאי-פאג'ים in vivo.

Bacteriophages, or phages, are viruses that infect and kill bacteria with species and strain-level specificity1. Phages play important roles within complex bacterial communities such as the gut microbiota, where they have been implicated in regulating population dynamics and driving bacterial fitness2. Throughout the last decade, there has been renewed interest in phage research owing to the rise of antimicrobial resistant pathogens3, and the potential for phage therapy as an alternative treatment strategy. In recent years, lytic phage cocktails have been used intravenously with some success in serious, antibiotic-resistant bacterial septic infections in humans3,4. Oral phage therapy has also been proposed as a potential alternative to antibiotics to treat intestinal infections and inflammation. Furthermore, phages have been implicated in the success of fecal filtrate transplants (FFT), which are fecal microbiota preparations that have been filtered to remove bacteria, in the treatment of recurrent Clostridioides difficile infection (rCDI)5,6, inflammatory bowel disorders (IBD)7,8&#160;and necrotizing enterocolitis in pre-term pigs9. Given these results, it is important to consider interactions both between phages and the gut microbiota, and phages and the mammalian host, as the addition of novel phages into a preexisting community may have indirect effects on the community as a whole, and not only its target bacteria2,10.
The study of phage interactions with their target bacteria in vitro has proven useful for understanding the mechanisms and impacts of phage and bacteria interactions in the gut. In this setting, it has been shown that Escherichia coli-specific T4 phages of the order Caudovirales require immunoglobulin (Ig)-like domains located within highly antigenic outer capsid (Hoc) proteins on the virion surface to adhere to intestinal mucus11. Additionally, transwell assays have shown that T4 phages are capable of interacting with epithelial cell cultures and translocating through cell layers by macropinocytosis12,13. These results support the hypothesis that phages can interact with their metazoan host, even though they are incapable of infecting eukaryotic cells. These models, while useful, lack the full range of complex interactions that occur in a gut ecosystem that are required for a comprehensive exploration of the tripartite interaction between phages, bacteria and the metazoan host.
Mouse models are an important tool for investigating phages within complex environments. A desirable application of phage administration is as an alternative strategy to treat antimicrobial resistant infections or pathobionts associated with chronic inflammatory diseases, including IBD. However, emerging literature suggests that phage behavior in vitro does not fully represent in vivo functions. Buttimer et al.14&#160;demonstrated that a phage cocktail was able to deplete the targeted bacteria in a simplified human microbiota consortium in vitro, but could not be replicated in vivo in gnotobiotic mice colonized with the same bacteria-phage consortium. Furthermore, in a conventional mouse microbiome, T7 phage led to selective depletion of its target gut bacteria, although gradual recovery was observed over time, indicative of evolved resistance15. Other studies have demonstrated co-existence of orally administered phages and their target bacterial strains in vivo2,16. Indeed, beyond phage/bacteria co-existence, phage administration led to widespread changes in overall microbiota community composition and function2,16. This is relevant in disease settings as several studies have found associations between increased relative abundance of Caudovirales and IBD7,8,17&#160;that were independent of changes in bacterial abundance7. It remains unknown whether this is a driver or consequence of disease pathogenesis.
The historic focus of phage investigation has been around the relationship between a phage and its target bacterium. However, it is also important to consider potential interactions between phage and the mucosa, epithelium, and immune system of the metazoan host. These interactions all play an important role in the overall response to intestinal phage infection. To demonstrate this, phages have been studied using germ-free (GF) mice to elucidate their impact on the immune system without interference by the microbiota8. In this system, phage nucleic acids were detected by Toll-like receptors (TLRs) located within endosomes of phagocytic immune cells (macrophages and dendritic cells). This activated downstream signaling and stimulated T cell dependent production of interferon (IFN)-&#947;8&#160;or type I IFNs18. Moreover, Fluckiger et al.19&#160;implicated memory CD8+ T cells in the recognition of phage-encoded (prophage) antigens, which resulted in T cell cross-reactivity with tumor antigens, resulting in reduced tumor burden. Finally, phage-specific antibody production has been documented in mouse studies where phages were delivered to animal models in a continual manner through drinking water8,20, or by repeated oral gavage over several months20, demonstrating the capacity for phage proteins to promote humoral immune responses. Although these modes of phage inoculation allow for optimal and continual priming of the immune system, they may not represent the naturally occurring interactions between phages and the intestinal environment, nor the kinetics of orally applied phage therapy. Thus far, a limited number of studies have examined the interactions of phage with a single bacterial species in monocolonized mouse models21. However, monocolonized mice proved critical in deciphering microbe-specific effects of individual species on gastrointestinal (GI) tract and immune development22,23,24, and they may yet prove useful in understanding tripartite interactions between phages, their target bacteria, and the metazoan host.
Excitingly, there is still much to learn about the interactions between intestinal phage and gut commensal bacteria, as well as the interactions that occur between the metazoan host and the phages that reside within it. This protocol provides a set of procedures to study isolated T4 phage and its&#160;bacterial counterpart, E. coli (K-12, BW25113), using a gnotobiotic mouse model. These standardized procedures also provide a foundation for optimizing other phage/bacteria dyads by adapting the growth parameters to the pairs of interest. The methods described here outline: (1) Preparation of T4 phage and vehicle lysates for oral gavage of mice; (2) Oral administration of T4 phage to E. coli monocolonized gnotobiotic mice; (3) Monitoring T4 phage levels in mouse feces and tissues over time.
For the representative results presented here, purified T4 phage lysates were propagated from phage bank stocks maintained by the Rohwer Lab. The Phage-on-Tap method for propagating T4 phage was adapted25, as referenced in this protocol. The method yields high titer, endotoxin-low phage stocks within three days. Utilizing this approach, 10 mL of &#8805; 1010&#160;plaque forming units (pfu)/mL of T4 phage with &#60; 0.5 endotoxin units (EU)/mL were&#160;routinely collected. The recommended endotoxin levels for oral or intravenous administration into mice are &#8804; 20 EU/mL and &#8804; 5 EU/kg/h (or 0.1 EU administered over 1 h for a 20 g mouse), respectively, making this a suitable method of phage preparation for in vivo inoculation. All phage stocks were stored at 4 &#176;C in saline magnesium (SM) phage buffer (recipe provided in step 1.1.5.1). E. coli was cultivated in LB media. For various phage-bacteria pairs, diverse culture media and growth conditions may be adapted from this protocol. Phages can also be sourced from the environment, such as wastewater, marine water, soil and intestinal contents and can be isolated and purified as per Sambrook and Russell26&#160;prior to preparation using the appropriate growth and propagation conditions for each phage-host pair of interest25. Alternatively, phages can be obtained from commercial sources (see Table of Materials) or from phage banks.

מחבר זרקור: חקירת תגובות חיסוניות המושרות על ידי בקטריופאג'ים בעכברים גנוטוביוטיים

אינטראקציה בין בקטריופאג' T4 ואי קולי במעי מורין: מודל אב-טיפוסי לחקר דינמיקה של בקטריופאג' מארח ב-Vivo

Our research aims to understand the tripartite interactions between bacteriophages bacteria and the mammalian immune system within the context of the gut, gnotobiotic mouse gut. We hope to gain insight into these interactions under health and disease conditions to better-understand the importance of the gut microbiome. Recent developments have found that bacteriophages can be detected by the mammalian immune system.It has been suggested that the human gut phageome may be dysregulated in disease conditions such as inflammatory bowel disorder, and immune stimulation by phages could exacerbate disease phenotypes. Our goal is to provide others with a standardized protocol for producing a T4 phage lysate for inoculation and enumeration in gnotobiotic mouse models. These protocols can be built upon and modified for use with other bacteriophage bacteria pairs.

כדי לחקור את יחסי הגומלין בין פאג T4/E. coli dyad במעי המורין, פאג T4 וליזטים של כלי רכב הוכנו, נוקו וטוהרו (איור 1A). ליזטים של פאגים T4 כוסו על ידי בדיקת פלאק ונמהלו ל-2 x 10,7 pfu/mL (2 x 10,6 pfu/mouse) במאגר SM. גם ליזטים של כלי רכב עברו טיטור כדי לוודא שאין נוכחות פאגים בת קיימא ונמ?...

Watch this Scientific Journal Video about Author Spotlight: Investigating Bacteriophage-Induced Immune Responses in Gnotobiotic Mice at JoVE.com

בקטריופאג'ים (פאגים), נגיפים שמדביקים חיידקים, הם מרכיב אינטגרלי של מיקרוביום המעי. אף על פי שהתושבים הסימביוטיים האלה מניעים את הכושר החיידקי ואת דינמיקת האוכלוסייה, מעט מאוד מובן על האופן שבו הם משפיעים על הומאוסטזיס מעיים ומחלות. פרוטוקול זה חוקר פאגים T4 מבודדים בתוך מודל עכברי, הניתן להתאמה לזוגות פאגים-חיידקים אחרים.

Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across ...

מטרת המחקר שלנו היא להבין את יחסי הגומלין המשולשים בין חיידקי בקטריופאג'ים לבין מערכת החיסון של יונקים בהקשר של מעי המעיים, מעי עכבר גנוטוביוטי. אנו מקווים לקבל תובנות לגבי אינטראקציות אלה בתנאי בריאות ומחלות כדי להבין טוב יותר את חשיבותו של מיקרוביום המעי. התפתחויות אחרונות מצאו כי בקטריופאג'ים יכולים להיות מזוהים על ידי מערכת החיסון של יונקים.הוצע כי פגאומת המעי האנושית עשויה להיות בלתי מווסתת במצבי מחלה כגון הפרעות מעי דלקתיות, וגירוי חיסוני על ידי פאגים עלול להחמיר פנוטיפים של מחלות. מטרתנו היא לספק לאחרים פרוטוקול סטנדרטי לייצור פאג ליזט T4 לצורך חיסון וספירה במודלים של עכברים גנוטוביוטיים. פרוטוקולים אלה יכולים להיבנות ולהשתנות לשימוש עם זוגות חיידקי בקטריופאג'ים אחרים.

t4-bacteriophage-e-coli-interaction-murine-intestine-prototypical

Research

JoVE Journal

Immunology and Infection

T4 Bacteriophage and E. coli Interaction in the Murine Intestine: A Prototypical Model for Studying Host-Bacteriophage Dynamics In Vivo

1.0K Views.  University of British Columbia. מטרת המחקר שלנו היא להבין את יחסי הגומלין המשולשים בין חיידקי בקטריופאג'ים לבין מערכת החיסון של יונקים בהקשר של מעי המעיים, מעי עכבר גנוטוביוטי. אנו מקווים לקבל תובנות לגבי אינטראקציות אלה בתנאי בריאות ומחלות כדי להבין טוב יותר את חשיבותו של מיקרוביום המעי. התפתחויות אחרו?...

Video: מחבר זרקור: חקירת תגובות חיסוניות המושרות על ידי בקטריופאג'ים בעכברים גנוטוביוטיים

Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across all known ecosystems. Within bacterial communities, such as those found in the gut microbiota, phages are implicated in regulating microbiota population dynamics and driving bacterial evolution. There has been renewed interest in phage research in the last decade, in part due to the host-specific killing capabilities of lytic phages, which offer a promising tool to counter the increasing threat of antimicrobial resistant bacteria. Furthermore, recent studies demonstrating that phages adhere to intestinal mucus suggest they may have a protective role in preventing bacterial invasion into the underlying epithelium. Importantly, like bacterial microbiomes, disrupted phageomes have been associated with worsened outcomes in diseases such as inflammatory bowel disease. Previous studies have demonstrated that phages can modulate the microbiome of animals and humans through fecal filtrate transplants, benefiting the host&#39;s health. With this recent wave of research comes the necessity to establish and standardize protocols for studying phages in the context of the gut microbiome. This protocol provides a set of procedures to study isolated T4 phages and their bacterial host, Escherichia coli,&#160;in the context of the murine gastrointestinal tract. The methods described here outline&#160;how to start from a phage lysate, administer it to mice and assess effects on bacterial host and phage levels.&#160;This protocol can be modified and applied to other phage-bacterial pairs and provides a starting point for studying host-phage dynamics in vivo.

Bacteriophages (phages), viruses that infect bacteria, are an integral component of the gut microbiome. Though these symbiotic inhabitants drive bacterial fitness and population dynamics, little is understood about how they impact gut homeostasis and disease. This protocol studies isolated T4 phages within a mouse model, adaptable to other phage-bacterial pairs.