Il lavoro in Buchanan-Wollaston laboratorio sul profilo palco tipo cellulare e di sviluppo specifico è supportato dal AGRON-OMICS progetto (concessione # LSHG-CT-2006-037704) nel quadro Progamme 6 ° della Commissione europea. Il lavoro in laboratorio Gifford sul tipo cellulare specifico profilo è supportato da un nuovo BBSRC Investigator Grant (BB/H019502/1). Le KC274 KC464 e linee di Arabidopsis sono stati ottenuti da AAR Webb (Università di Cambridge).

1. Generazione di protoplasti <ol><li> Raccolta materiale fogliare e tagliarla a strisce di 1 mm di larghezza (Figura 1), con una lama di rasoio. Per campioni contenenti più di una singola foglia fino a 15 fogli possono essere facilmente impilati prima del taglio. </li><li> Trasferire immediatamente strisce foglia in un tondo piatto Petri 9 centimetri contenente 20 ml di soluzione A (400 mM mannitolo, 20 mM MES idrato, 20 mM KCl, 10 mM CaCl 2, 2 mM MgCl2, 0,1% BSA e 2,5 mM β-mercaptoetanolo, pH 5,7) compresi gli enzimi protoplasting (1,2% cellulosa R-10, 0,6% cellulosa RS e 0,4% macerozyme R-10) e RNasi e inibitori trascrizionali (1 × ProtectRNA e 10 ug / ml actinomicina D); separare delicatamente le strisce foglia e vuoto infiltrato per 2 × 5 min. </li><li> Luogo Petri su un agitatore orbitale impostato su 90 min a temperatura ambiente e protoplasti per ora 3-4. <ol><li> Durante l&#39;incubazione le strisce foglia devono essere separate l&#39;una dall&#39;altra, con l&#39;uso di unset di pinzette piatte, ad intervalli di trenta minuti. </li></ol></li><li> Posizionare una cella di filtro 70 micron (Fisher Scientific) in un tubo da 50 ml e delicatamente filtrare la soluzione attraverso protoplasting. Ciò rimuovere le strisce foglia, che saranno trattenuti dal vaglio consentendo i protoplasti di passare attraverso. </li><li> Lavare le strisce foglia con 4 ml di soluzione A e delicatamente filtrare attraverso il setaccio stesso. </li><li> Trasferire i protoplasti in provette a fondo tondo e centrifugare la soluzione protoplasti a 300 xg per 5 minuti a pellet i protoplasti. </li><li> Aspirare delicatamente fuori la maggior quantità di surnatante possibile senza disturbare i protoplasti. </li><li> Lavare i protoplasti con 5 ml di soluzione A e centrifugare a 300 xg per 5 min. Rimuovere il surnatante </li><li> Risospendere i protoplasti in un volume appropriato di soluzione A, con una pipetta Pasteur o un cut-off punta P1000. </li></ol> 2. FACS di protoplasti Leaf </p&gt; <ol><li> Immediatamente prima cernita, risospendere le protoplasti con un (non-taglio) P1000 punta per evitare protoplasti aggregazione insieme. </li><li> Trasferire protoplasti di un tubo di smistamento attraverso un micron 50 Filcon filtro (BD Biosciences) e diluite per evitare l&#39;intasamento dell&#39;ugello del cell sorter. I protoplasti vengono ordinati utilizzando un ugello 100 micron ad una pressione di 20 psi (guaina) e 21-21,5 psi (campione), una frequenza di 39,2 kHz e un tasso di evento di &lt;4000 (queste impostazioni sono ottimali su un cell sorter Influx BD (BD Biosciences). Ottimizzazione su altre macchine di smistamento delle cellule potrebbe essere necessario regolare queste impostazioni). </li><li> Protoplasti GFP positivi sono identificati utilizzando un laser argon 488 nm e riportando l&#39;uscita dal passabanda 580/30 del filtro (arancione) vs il filtro 530/40 passabanda (verde). GFP protoplasti positivi saranno in alta 530/low 580 popolazione, con i non-GFP protoplasti nel basso 530/580 a bassa popolazione e morti / protoplasti muoiono e detriti in alta 580 popolazionemento (Figura 2). <ol><li> Quando si ordina protoplasti da cui saranno estratti RNA, protoplasti dovrebbero essere ordinati direttamente in almeno 4 volumi di un tampone di lisi contenente un agente riducente (ad esempio β-mercaptoetanolo). Inoltre, il tempo di ordinamento di un singolo campione dovrebbe essere limitato a 20-30 min, e un massimo di 2-3 campioni trattati in qualsiasi momento. </li><li> Per la visualizzazione di protoplasti filtrate, i protoplasti dovrebbero essere ordinati direttamente in almeno 8 volumi di soluzione A e successivamente raccolti per centrifugazione a concentrare i protoplasti. </li></ol></li></ol> 3. Risultati rappresentativi Questo protocollo descrive un metodo per ottenere protoplasti da foglie di Arabidopsis, che sono utilizzati per fluorescenza selezione cellulare attivata (Figura 1). Generazione protoplasti in presenza di RNasi e inibitori trascrizionali impedisce f cellulerom montare una risposta trascrizionale. Questo ha la conseguenza di dare luogo a molte protoplasti morti e morenti, che hanno un livello significativo di autofluorescenza. Quando si ordinano i protoplasti preparati con questo metodo è quindi molto comune vedere diverse popolazioni distinte nei grafici dei 580 nm contro 530 nm fluorescenza utilizzati per l&#39;ordinamento. Esempi di questo, insieme con le porte di ordinamento utilizzati in questo protocollo sono mostrati nella Figura 3. Protoplasti possono essere ordinati in 8 volumi di soluzione A e raccolti per la visualizzazione per verificare l&#39;arricchimento. Figura 2G mostra un esempio di questo utilizzando la linea TP382, che esprime GFP nelle cellule di guardia. Esempi di rese ottenute con questo metodo, prima e dopo l&#39;amplificazione, sono mostrati nella Tabella 1. Gli importi ottenuti sono sufficienti per l&#39;amplificazione con il Ovation Pico WTA di sistema (500 pg-50 ng) e quindi sanalisi ubsequent da una qPCR (Figura 4), ​​sequenziamento di nuova generazione o microarray. <img alt="Figura 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> Figura 1. Flusso di lavoro generale per l&#39;esperimento. 1) Raccolta foglie di interesse da una linea che esprime GFP Arabidopsis. 2) rapidamente tagliata a strisce ~ 1 mm di larghezza e di trasferire immediatamente questi in soluzione protoplasting e vuoto infiltrato. 3) Incubare per ora 3-4. 4) delicatamente filtrato soluzione protoplasti al setaccio 70 pm, il trasferimento per arrotondare tubi fondo e protoplasti pellet per centrifugazione. 5) Immediatamente prima cernita, protoplasti risospendere e il trasferimento ad un tubo ordinamento attraverso un filtro di 50 micron. 6) In ordine GFP positive e negative GFP protoplasti vitali. 7) I protoplasti possono essere analizzati visivamente oppure utilizzando tecniche come qPCR, sequenziamento di nuova generazione o microarray. Figura 2. Le linee KC464, KC274 e TP382 utilizzati in questo studio. A) Sezione trasversale di una foglia KC464 che mostra espressione GFP nell&#39;epidermide adaxial. B) protoplasti derivati ​​da KC464 foglie. C) la sezione trasversale di una foglia KC274 mostrando espressione GFP nel sistema vascolare. D) protoplasti derivati ​​da KC274 foglie. E) foglie TP382 mostrando espressione GFP nelle cellule di guardia. F) protoplasti derivati ​​da TP382 foglie. G) Esempio di arricchimento ottenuto mediante FACS di GFP che esprimono cellule di guardia sullo sfondo complesso di celle foglia, mostrando contenente GFP protoplasti dall&#39;alto 530/low 580 popolazione di protoplasti derivati ​​da TP382 foglie. AF: immagini microscopio confocale; G: immagine al microscopio a fluorescenza. Barre di scala all&#39;interno di immagini di 50 micron. <img alt="Figura 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> Figura 3. Tipici FACS trame di acquisizione punto dei prodotti ottenuti dai 580/30 nm (arancione) vs 530/40 nm (verde) filtri passa banda (sorter Afflusso BD cellulare). Le porte di ordinamento indicati sono quelli tipicamente utilizzati durante l&#39;ordinamento. A) dot plot di Col-4 foglia protoplasti derivati, protoplasted in assenza di inibitori, che mostrano un basso singolo 530/low 580 popolazione. B) dot plot da Wt protoplasti Col-4 foglie derivate, protoplasted in presenza di inibitori, che mostrano un cambiamento nella fluorescenza 580 a causa di stress e di colorazione dagli inibitori. CE) Dot trame di foglie protoplasti derivati ​​dalle linee KC74, KC464 e TP382, rispettivamente, protoplasted in presenza di inibitori, mostrando anche la GFP contenente popolazioni del 530/low alta 580 popolazioni. Le percentuali degli eventi nelle 530/low (alta 580) popolazioni GFP sono dati. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">Clicca qui per ingrandire la figura</a> . e_content &quot;fo: keep-together.within-page =&quot; always &quot;&gt; <img alt="Figura 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> Figura 4. Espressione GFP nelle frazioni rappresentative popolazione gated come mostrato in Figura 3. Due replicati biologici sono stati ottenuti per ciascun tipo di frazione, amplificati utilizzando il sistema Ovation Pico WTA e qPCR GFP usando primer specifici (Tabella 2) è stata poi eseguita. I valori indicati sono i più elevati (rosso), i valori più bassi (verde) e media relativi. L&#39;alta 580 popolazione era in questo caso diviso in due, basso 530/low 580 e alta 530/low 580, per il quale un singolo replicato biologico è stato utilizzato in modo che solo il singolo valore viene visualizzato. ACT2 (At3g18780) è stato utilizzato come standard per tutti i campioni. Foglia: foglia intera. Unsorted: protoplasti Unsorted. GFP1: alta 530/low 580 e Rest1: basso 530/low 580, GFP2: 530/high alta 580 e Rest2: basso 530/high 580, come descritto nella Figura 3 e l&#39;inserto. I risultati sono una verifica of valutazioni ottiche del contenuto della cella GFP nelle frazioni ordinati (ad esempio 2G Figura). <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">Clicca qui per ingrandire la figura</a> . <table border="1"><tbody><tr><td> Campione </td><td> Numero di foglie </td><td> Numero di celle </td><td> RNA resa (Ng) </td><td> RNA resa (Amplificato; ng) </td></tr><tr><td> Una foglia intera Tutta la foglia B </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> Protoplasti Unsorted A Unsorted protoplasti B </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> GFP1 A Rest1 A </td><td> 15 </td><td> 6039 (0,39% *) 55389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B Rest1 B </td><td> 15 </td><td> 10.783 (0,63% *) 57.040 (7,49% *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 Rest2 </td><td> 15 </td><td> 18.337 (1,49% *) 62.405 (73,49% *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> I campioni Tabella 1. Raccolti con FACS e analizzate qPCR per determinare quale frazione contenuta dal vivo che esprimono GFP-protoplasti. Sono incluse in questa tabella è la resa totale in ng RNA prima e dopo amplificazione con il Pico Ovation WTA System (NuGen). GFP1 frazioni, GFP2, Rest1 e Rest2 sono come mostrato nella inserto in Figura 4. * La percentuale di cellule della corsa totale liste cella è indicato tra parentesi accanto al numero di cellule nella frazione. Queste percentuali non sono correlati adreciprocamente per ogni campione come il tipo FACS corre per frazioni &#39;Rest&#39; stato interrotto prima di GFP per frazioni a causa del numero molto maggiore di cellule raccolte riposo. ** 50 ng utilizzata come input per reazioni di amplificazione, secondo il protocollo del produttore. <table border="1"><tbody><tr><td> Primer </td><td> Sequenza </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> Tabella 2. QPCR primers.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

Nessun conflitto di interessi dichiarati.

Abbiamo descritto un metodo che permette l&#39;utilizzo di piante di Arabidopsis esprimenti GFP nelle foglie per la generazione di protoplasti e cell sorting successiva utilizzando FACS. Questo metodo produce una quantità sufficiente di RNA per essere utilizzati per l&#39;amplificazione e l&#39;analisi successiva pertanto sia qPCR o microarray. Le frazioni vengono filtrate altamente arricchito per GFP contenenti cellule, come dimostrato da qPCR (Figura 2). Per ottenere rese elevate di protoplasti vivi è fondamentale lavorare rapidamente durante le fasi iniziali della procedura, fino a quando le strisce sono state foglio vuoto infiltrato con l&#39;inibitore soluzione contenente protoplasti. Inoltre, quando si genera uno strisce anta mm è molto importante per affettare o tagliare le foglie anziché &#39;chop&#39; o schiacciare, in quanto questo porta ad un danno eccessivo e quindi un rendimento inferiore protoplasti. Una differenza fondamentale tra il metodo descritto qui e publishe altrimetodi d è l&#39;uso di inibitori di RNasi e inibitori trascrizionali. Molti metodi sono stati sviluppati per radici di Arabidopsis, da cui protoplasti possono essere generate più facilmente. Tuttavia, quando si lavora con foglie, ad eccezione mesofillo, è necessario aumentare il tempo di generazione protoplasti. Pertanto è importante che tali inibitori di protezione contro i cambiamenti nell&#39;espressione genica come risultato del trattamento stesso generazione protoplasti (dati non mostrati). Tuttavia, la presenza degli inibitori porta ad una incapacità di montare una risposta trascrizione, sia attivando geni ON o OFF, che può realizzare i protoplasti più vulnerabili come questo porta ad una perdita di plasticità con cui contrastare le sollecitazioni del protoplasting procedura. Abbiamo utilizzato il metodo descritto qui con successo con un numero di linee esprimenti GFP-Arabidopsis. È importante sottolineare che abbiamo usato questo metodo con le linee che esprime GFP GFP sia fortemente inil nucleo, o molto più debolmente in modo non-localized/diffuse citosolico, come è il caso con i KC464 KC274 e linee utilizzate qui. Entrambi i tipi di linee sono compatibili con il metodo e la resa frazioni altamente arricchito di GFP-esprimenti protoplasti (Figura 2 e 3). Il metodo può essere facilmente adattato per altri fluorofori, sebbene il fluoroforo deve essere selezionato per fluorescenza che è significativamente diversa dalla autofluorescenza di cellule morte / morenti per preservare la capacità di selezionare cellule vive.

<table border="1"><tbody><tr><td> Nome del reagente </td><td> Azienda </td><td> Numero di catalogo </td></tr><tr><td> Cellulasi R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Cellulase RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> Sigma-Aldrich </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> Sigma-Aldrich </td><td> R7397 </td></tr><tr><td> Actinomicina D </td><td> Sigma-Aldrich </td><td> A1410 </td></tr><tr><td> 70 micron filtro cella </td><td> Pescatore </td><td> FB35181 </td></tr><tr><td> 50 micron Filcon tazza di tipo filtri </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

Dopo l&#39;inizio del primordio fogliare, accumulo di biomassa è controllata principalmente da proliferazione cellulare ed espansione nelle foglie 1. Tuttavia, la foglia Arabidopsis è un organo complesso costituito da molti tipi cellulari diversi e strutture diverse. Allo stesso tempo, la foglia crescente contiene cellule a diversi stadi di sviluppo, con le cellule più lontane dal picciolo essere il primo a smettere espansione e sottoposti senescenza 1. Cellule diverse all&#39;interno della foglia sono quindi dividendo, allungando o differenziazione, attivo, stressati o morti, e / o rispondere agli stimoli in sotto-insiemi di loro tipo cellulare in qualsiasi momento. Questo rende lo studio genomico della sfida foglia: ad esempio, l&#39;analisi dei dati di espressione di foglie intere, i segnali provenienti dalle reti genetiche che operano in diverse zone di risposta cellulare o tipi cellulari saranno confusi, con un conseguente profilo impreciso viene generato. Per risolvere questo problema, several metodi sono stati descritti che consentono studi di espressione genica specifica cella. Questi includono la cattura microdissezione laser (LCM) 2 o piante che esprimono GFP utilizzato per la produzione di protoplasti e la successiva selezione di fluorescenza delle cellule attivate (FACS) 3,4, il sistema recentemente descritto intatto per precipitazione nucleare 5 e immunoprecipitazione di polisomi 6. FACS è stata utilizzata per un certo numero di studi, mostrando inoltre che l&#39;identità della cella e della distanza dalla punta della radice avuto un effetto significativo sui profili di espressione di un grande numero di geni 3,7. FACS di linee GFP sono stati utilizzati anche per dimostrare cellule-specifiche regolazione trascrizionale durante risposte azoto radici e lo sviluppo delle radici laterali 8, 9 sale sollecitazioni distribuzione auxina nella radice 10 e per creare una mappa genica della Arabidopsis meristema apicale 11. SebbeneFACS è stata precedentemente utilizzata per ordinare protoplasti derivati ​​foglia Arabidopsis basato su autofluorescenza 12,13, finora l&#39;uso di FACS su linee di Arabidopsis esprimenti GFP nelle foglie è stato molto limitato 4. Nella seguente protocollo si descrive un metodo per ottenere protoplasti di Arabidopsis foglia che sono compatibili con FACS minimizzando l&#39;impatto del regime generazione protoplasti. Dimostriamo il metodo utilizzando la linea KC464 Arabidopsis che esprimono GFP costrutto legato nell&#39;epidermide adaxial 14, il KC274 linea, che esprimono GFP nel tessuto vascolare 14 e la linea di Arabidopsis TP382, che esprimono un GFP doppia ad un segnale di localizzazione nucleare le cellule di guardia (dati non mostrati; Figura 2). Stiamo attualmente utilizzando questo metodo per studiare sia del tipo cellulare specifica espressione durante lo sviluppo e stress, nonché popolazioni cellulari eterogenee in diverse fasi di senescenza.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Un metodo per produrre<em&gt; Arabidopsis</em&gt; Protoplasti foglia che sono compatibili con selezione delle cellule attivate a fluorescenza (FACS), consentendo studi di specifiche popolazioni cellulari. Questo metodo è compatibile con qualsiasi<em&gt; Arabidopsis</em&gt; Riga che esprime GFP in un sottogruppo di cellule.

Cella di analisi specifica di<em&gt; Arabidopsis</em&gt; Foglie usando fluorescenza activated cell sorting

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

15.1K Views.  University of Warwick. Un metodo per produrre Arabidopsis Protoplasti foglia che sono compatibili con selezione delle cellule attivate a fluorescenza (FACS), consentendo studi di specifiche popolazioni cellulari. Questo metodo è compatibile con qualsiasi Arabidopsis Riga che esprime GFP in un sottogruppo di cellule.

Video: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Fluorescenza separazione delle cellule attivate delle protoplasti impianto

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Ricerca

Biologia

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

Indagare tessuti e risposte fitocromo organo-specifici utilizzando FACS-Cell-assistita di tipo profili specifici di espressione in Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

Vescicole lipidiche-mediata Cromatografia di affinità mediante Magnetic separazione delle cellule attivate (LIMACS): un nuovo metodo per l&#39;analisi delle interazioni proteina-lipide

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Bromodeossiuridina (BrdU) Etichettatura e successive ordinamento fluorescenza cellulare attivo per la cultura indipendente Identificazione di carbonio organico disciolto-degradanti batterioplancton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

Ottimizzato Metodi di modellazione e colorazione proliferazione per il monitoraggio divisione cellulare utilizzando coloranti Tracking Cellulari

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

Isolamento di fibroblasti normali e tumorali associata da tessuti freschi di fluorescenza activated cell sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

Micro-aspirazione a cella singola come strategia alternativa per lo smistamento cellulare attivato dalla fluorescenza per la separazione delle miscele di virus giganti

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the mechanisms are not well understood. To investigate coral response to stressors, we need tools for analyzing cellular responses. In particular, we need tools that facilitate the application of functional assays to better understand how cell populations are reacting to stress. In the current study, we use fluorescence-activated cell sorting (FACS) to isolate and separate different cell populations in stony corals. This protocol includes: (1) the separation of coral tissues from the skeleton, (2) creation of a single cell suspension, (3) labeling the coral cells using various markers for flow cytometry, and (4) gating and cell sorting strategies. This method will enable researchers to work on corals at the cellular level for analysis, functional assays, and gene expression studies of different cell populations.

Corals create biodiverse ecosystems important for both humans and marine organisms. However, we still do not understand the full potential and function of many coral cells. Here, we present a protocol developed for the isolation, labeling, and separation of stony coral cell populations.

Ordinamento cellulare attivato dalla fluorescenza per l'isolamento delle popolazioni cellulari Scleractiniane

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Isolare RNA specifici del tipo di cellula da campioni di tessuto eterogeneo congelati a scatto senza selezione cellulare

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

Fluorescence Lifetime Macro Imager for Biomedical Applications

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ranging from solid-state, O2-sensitive coatings to live animal tissue samples stained with soluble O2-sensitive probes. In particular, the nanoparticle-based near-infrared probe NanO2-IR, which is excitable with a 625 nm light-emitting diode (LED) and emits at 760 nm, was used. The imaging system is based on the Timepix3 camera (Tpx3Cam) and the opto-mechanical adaptor, which also houses an image intensifier. O2 phosphorescence lifetime imaging microscopy (PLIM) is commonly required for various studies, but current platforms have limitations in their accuracy, general flexibility, and usability.
The system presented here is a fast and highly sensitive imager, which is built on an integrated optical sensor and readout chip module, Tpx3Cam. It is shown to produce high-intensity phosphorescence signals and stable lifetime values from surface-stained intestinal tissue samples or intraluminally stained fragments of the large intestine and allows the detailed mapping of tissue O2 levels in about 20 s or less. Initial experiments on the imaging of hypoxia in grafted tumors in unconscious animals are also presented. We also describe how the imager can be re-configured for use with O2-sensitive materials based on Pt-porphyrin dyes using a 390 nm LED for the excitation and a bandpass 650 nm filter for emission. Overall, the PLIM imager was found to produce accurate quantitative measurements of lifetime values for the probes used and respective two-dimensional maps of the O2 concentration. It is also useful for the metabolic imaging of ex vivo tissue models and live animals.

This paper describes the use of a new, fast optical imager for the macroscopic photoluminescence lifetime imaging of long decay emitting samples. The integration, image acquisition, and analysis procedures are described, along with the preparation and characterization of the sensor materials for the imaging and the application of the imager in studying biological samples.

Imager macro a fluorescenza per applicazioni biomediche

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ...