Wild-type (Mavs + / +) e knockout (Mavs - / -) topi wild-type (Mavs + / +) e knockout (Mavs - / -) MEF sono stati gentilmente forniti dal Dr. Zhijian J. Chen (Università di Texas Southwestern Medical Center) 13. Questa pubblicazione si basa sul lavoro finanziato da sovvenzioni dal NIH (R01 CA134241 e R01 DE021445) e American Cancer Society (RSG-11-162-01-MPC).

Etica Dichiarazione: Tutti i lavori animale è stato eseguito in stretta conformità con le raccomandazioni contenute nella Guida per la cura e l&#39;uso di animali da laboratorio del National Institutes of Health. Il protocollo è stato approvato dalla cura degli animali ed uso Comitato Istituzionale (IACUC), della University of Southern California. 1. Citochine Gene Expression da Quantitative Real-time PCR e la secrezione da ELISA in topi infettati γHV68 <ol><li> Anestetizzare, 6-8 settimane di età C57BL / 6 (B6) fratellini genere abbinato (8-12 topi / gruppo) via intraperitoneale iniettando 1,5 mg di ketamine/0.12 mg di xylazina, e inoculare intranasale con 40 PFU di γHV68 in 40 microlitri (infezione dettagliato in Dong Feng e 11). In diversi momenti dopo l&#39;infezione, eutanasia i topi utilizzando CO 2 inalazione seguita da dislocazione cervicale. </li><li> Aprite la cassa, con un taglio laterale sinistra lungo la sternum e tagliare le costole con le forbici affilate. Raccogliere i tessuti polmonari. </li><li> Raccogliere la metà del tessuto polmonare (lobo sinistro) in provette da 1,5 ml con tappo a vite sterili contenenti 500 microlitri 1,0 millimetri perline Zirconia / silice. Aggiungere 1 ml di freddo DMEM privo di siero nella provetta e omogeneizzare il tessuto polmonare da branello-battitura per 30 sec. Chill-tubi sul ghiaccio per 2 minuti e ripetere questo processo una volta. </li><li> Centrifugare le provette (15.000 x g per 10 min) a 4 ° C, raccogliere il supernatante e misurare la produzione di citochine come descritto di seguito. </li><li> Misurare citochine utilizzando citochine kit ELISA disponibili in commercio secondo le istruzioni del produttore. </li><li> Raccogliere l&#39;altra metà del tessuto polmonare (lobo destro) in un altro tubo tallone contenente e aggiungere 1 ml TRIzol. Mescolare e raccogliere il surnatante come descritto al punto 1.3 ed estratto di RNA secondo le istruzioni del produttore. Determinare la concentrazione di RNA prendendo letture di assorbanza a 260 e 280 nm. </li&gt; <li> Preparare cDNA con 1 mg di RNA totale e la trascrittasi inversa secondo le istruzioni del produttore (il volume finale totale era 20 microlitri). Diluire cDNA 50 volte con-DNAse e acqua RNase-free ed effettuare quantitativa real-time PCR. </li><li> Eseguire il programma su un real-time machine PCR quantitativa. Ciascuna reazione contiene 0,5 ml di una coppia di primer gene-specifici e primer di controllo della GAPDH (la concentrazione di lavoro dei primer erano 10 pM, CE 500 nM per ogni primer), 5 microlitri della master mix SYBR e 4 microlitri della diluiti cDNA. Calcola ΔΔCt per determinare la quantità relativa di mRNA trascritti di citochine antivirali. </li></ol> 2. L&#39;infezione delle cellule MEF e citochine Quantificazione mediante ELISA e qRT-PCR <ol><li> Crescere Mavs + / + e Mavs - / - cellule MEF a sub-confluenti (circa 80%) di densità prima della placcatura cellule. </li><li> Dividere le celle MEF in 12 abbiamopiastre LL con 100.000 cellule e / (la densità cellulare sarà circa il 70% il secondo giorno). Effettuare infezione γHV68 in triplicato, con una molteplicità di infezione (MOI) di 5-10 per sincronizzare e massimizzare l&#39;induzione di citochine. </li><li> Preparare la sospensione γHV68 in mezzo completo DMEM contenente adeguata quantità di virus (1 ml per ogni bene). </li><li> Rimuovere medio e aggiungere γHV68 contenenti sospensione cellule MEF. </li><li> Porre la piastra in tessuto cultura incubatore, il rock ogni 30 minuti, e permettere un totale di 2 ore di incubazione. </li><li> Rimuovere medio-γHV68 contenente, lavare una volta con PBS, e sostituirlo con DMEM fresco completo. </li><li> A diverso tempo punti di post-infezione, medio raccolto in provette da 1,5 ml Eppendorf. Lavare le cellule con PBS freddo e raccogliere le cellule infette da tripsina digestione. </li><li> Misurare citochine antivirali in mezzo come descritto al punto 1.5. </li><li> Estrarre RNA, preparare cDNA ed eseguire qRT-PCR per determinare l&#39;espressione genica di citochine antiviralicome descritto ai punti 1.5-1.7. </li></ol> 3. Produzione lentivirus, infezione, e la generazione di linee cellulari stabili <ol><li> Split cellule 293T Un giorno prima trasfezione e permettono alle cellule di raggiungere ~ 40% di confluenza al momento della transfezione. </li><li> Transfettare 10 centimetri piatto di cellule 293T con i plasmidi di imballaggio (1,2 mg di pVSV-G e 6 mg di pDR8.9) e 7.2 mg di pCDH-FLAG-MAVS o controllo pCDH da fosfato di calcio precipitazione. </li><li> Sostituire medio a 6-8 ore post-trasfezione con DMEM fresco completo. </li><li> A 72 ore dopo la trasfezione, raccogliere terreno contenente lentivirus, centrifugare a 4000 xg per 15 min e filtro con 0,22 micron membrana. Per aumentare il titolo lentivirus, si centrifuga il mezzo contenente il virus a 110.000 xg per 2,5 ore a 4 ° C. Risospendere delicatamente il pellet virale in piccolo volume del mezzo di interesse. </li><li> Mavs Seed - / - cellule MEF o altre cellule knockout MEF uno giorno before infezione in piastre da 6 pozzetti a ~ 30-40% di confluenza. </li><li> Infettare le cellule MEF con 1 ml di lentivirus e 2 ml di DMEM fresco completo, integrato con polibrene ad una concentrazione finale di 10 mg / ml. </li><li> Centrifugare la piastra a 500 xg a 30 ° C per 30 minuti e trasferire la piastra ad un incubatore di coltura tissutale. </li><li> Sostituire mezzo alle 6 ore post-infezione con DMEM fresco completo. </li><li> Cellule Split MEF a 24 ore dopo l&#39;infezione e aggiungere puromicina ad una concentrazione finale di 1 mg / ml a 48 ore dopo l&#39;infezione per selezionare le cellule che esprimono stabilmente MAVS. </li><li> Mantenere le cellule MEF nel medio-puromicina contenimento e verificare l&#39;espressione della proteina mediante immunoblotting con anticorpi corrispondenti. </li><li> Le cellule possono essere usate per infezione virale, l&#39;espressione genica di citochine e esperimenti secrezione come descritto nel protocollo 2. </li></ol>

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Gli autori dichiarano assenza di conflitti di interesse.

Viral evasione immune è una delle interazioni più dinamiche e affascinanti interfacciamento attacco virale e ospite difesa 9. I componenti immunitarie innate ospitanti sono strutturati in modo tale che la trasduzione del segnale sia effettivamente iniziata e fedelmente trasmessa. Delineare la gerarchia e la regolamentazione delle cascate di segnalazione è un tema preminente di immunità innata. Qui, vi presentiamo un protocollo per individuare i ruoli di regolamentazione di un componente immunitaria innata...

Recenti studi hanno delineato le cascate complessivi segnalazione in montaggio ospite risposte immunitarie innate. Risiedono all&#39;interno compartimenti distinti, i recettori pattern recognition (PRR) individuare pattern molecolari associati ai patogeni (PAMP) di diversa origine per innescare immunitaria innata di segnalazione 1. Il gene indotta da acido retinoico I (RIG-I) e differenziazione melanoma antigene (5) md5 se si usano proteine ​​citosoliche sono sensori che riconoscono specie di RNA con specifiche caratteristiche strutturali 2. Dopo l&#39;attivazione, RIG-I interagisce con i suoi MAVS a valle (noto anche come IPS-1, VISA, e CARDIF) adattatore che, a sua volta, attiva il IKK (IKKαβγ) e la chinasi IKK-correlati (TBK1 e IKKε, noto anche come Ikki ) Complessi 3-6. Attivato chinasi immunitarie innate fosforilano regolatori chiave di espressione genica, compresi i fattori di trascrizione e loro inibitori, e consentono l&#39;attivazione trascrizionale di geni antivirali ospitante (ad esempio IL6, TNF &amp; #945,, CCL5 e Interferone beta). Queste cascate di segnalazione costituiscono potenti risposte immunitarie innate intrinseche che stabiliscono uno stato anti-microbica per limitare la propagazione dell&#39;agente patogeno durante le prime fasi di infezione. Murino γHV68 è strettamente legato al oncogeno umano KSHV e EBV. Pertanto, l&#39;infezione di topi γHV68 fornisce un piccolo modello animale trattabili per esaminare la risposta immunitaria al virus herpes gamma in vivo 7. Usando γHV68, il nostro laboratorio ha scoperto una strategia complessa in cui γHV68 dirotta ospitare segnalazione immunitaria innata per attivare infezione virale. Da un lato, γHV68 attiva il percorso MAVS-IKKβ per promuovere l&#39;attivazione trascrizionale virale tramite dirigere attivato IKKβ di fosforilare transactivator replica (RTA), il fattore di trascrizione chiave per la replicazione virale γHV68 8. D&#39;altra parte, la fosforilazione mediata IKKβ innesca RelA per degradazione e termineinates attivazione NFΚB 9. Come tale, l&#39;infezione γHV68 evita efficacemente la produzione di citochine antivirale. È interessante notare che uno screening che utilizza una libreria di espressione di γHV68 identificato RTA come ligasi E3 per indurre degrado RelA e abolisce l&#39;attivazione NFΚB 10. Questi risultati scoprire una strategia di evasione immune intricato in cui gli eventi a monte di segnalazione immunitarie vengono sfruttate da γHV68 per negare la finale produzione di citochine antivirali. Qui si descrive un protocollo per misurare la produzione di citochina antivirale in topi infettati con γHV68 sia in vivo ed ex viv o. Nel protocollo esploriamo ulteriormente l&#39;espressione &quot;ricostituiti&quot; di componenti immunitarie innate nei knockout fibroblasti embrionali da trasduzione lentivirale, che individua la funzione delle specifiche molecole immunitarie innate nella regolazione della produzione di citochine antivirale. Questo protocollo può essere facilmente adattato ad altre viruses e vie di segnalazione.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

In risposta ad una infezione virale, la risposta immunitaria innata host è attivato per up-regolare l&#39;espressione genica e produzione di citochine antivirali. Al contrario, i virus si sono evoluti strategie complesse per eludere e sfruttare ospite segnalazione immune per la sopravvivenza e la propagazione. Viral evasione immune, che comporta la difesa ospite e l&#39;evasione virale, fornisce una delle interfacce più affascinanti e dinamiche di discernere l&#39;interazione ospite-virus. Questi studi ampliano la nostra conoscenza nella regolazione immunitaria innata e spianare la strada per sviluppare nuove terapie antivirali. Murino γHV68 è un patogeno naturale di roditori murini. γHV68 infezione di topi fornisce un piccolo modello animale trattabili per esaminare la risposta antivirale per KSHV umana e EBV di cui perturbazione vivo interazioni virus-ospite in non è applicabile. Qui si descrive un protocollo per determinare la produzione di citochine antivirale. Questo protocollo può essere adattato ad altre virusi e vie di segnalazione. Recentemente, abbiamo scoperto che γHV68 dirotta MAVS e IKKβ, componenti immunitarie innate chiave di segnalazione a valle del citosolica RIG-I e md5 se si usano, per abrogare l&#39;attivazione NFΚB e la produzione di citochine antivirali. In particolare, l&#39;infezione γHV68 attiva IKKβ e che IKKβ attivato fosforila RelA per accelerare la degradazione RelA. Come tale, γ HV68 separa in modo efficiente attivazione NFΚB dal suo monte attivato IKKβ, negando l&#39;espressione genica di citochine antivirali. Questo studio chiarisce una strategia complessa per cui l&#39;attivazione immune innata a monte è intercettato da un agente patogeno virale per annullare l&#39;attivazione trascrizionale immediatamente a valle ed evitare la produzione di citochine antivirali.

Tre figure rappresentative sono mostrati qui, compresa la produzione di citochine nel polmone di Mavs γHV68 infettati Mavs-/ + / + e - del mouse, la secrezione di citochine e l&#39;espressione genica livello di Mavs γHV68 infettati Mavs + / + e - / - MEF, e livelli di mRNA di citochine Mavs γHV68 infettati - / - MEF &quot;ricostituiti&quot; con MAVS. Questi esperimenti rappresentativi utilizzano gene topi knockout per ...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Descriviamo un protocollo per misurare la produzione di citochina antivirale in topi infettati con un modello herpesvirus, murina gamma herpesvirus 68 (γ HV68) che è strettamente correlata alla associato al sarcoma herpesvirus di Kaposi umano (KSHV) e virus di Epstein-Barr (EBV). Utilizzando ceppi di topi geneticamente modificati e fibroblasti embrionali di topo (MEF), abbiamo valutato la produzione di citochina antivirale sia in vivo e ex vivo. &quot;Ricostituzione&quot; l&#39;espressione di componenti dell&#39;immunità innata a eliminazione diretta fibroblasti embrionali di trasduzione lentivirale, abbiamo ulteriormente individuare specifiche molecole del sistema immunitario innato e sezionare gli eventi di segnalazione chiave che differenziale regolano la produzione di citochine antivirale.

Dissezione Innate Immune Signaling in Evasion virale di produzione di citochine

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

dissecting-innate-immune-signaling-viral-evasion-cytokine

Research

JoVE Journal

Immunology and Infection

10.4K Views.  Keck School of Medicine, University of Southern California.  Descriviamo un protocollo per misurare la produzione di citochina antivirale in topi infettati con un modello herpesvirus, murina gamma herpesvirus 68 (γ HV68) che è strettamente correlata alla associato al sarcoma herpesvirus di Kaposi umano (KSHV) e virus di Epstein-Barr (EBV). Utilizzando ceppi di topi geneticamente modificati e fibroblasti embrionali di topo (MEF), abbiamo valuta...

Video: Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

Produzione e titolazione di vettori virali ricombinanti adeno-associato

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Ricerca

Immunologia e infezioni

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to pathogen infection and involves the production of reactive oxygen species (ROS). ROS are toxic and function to kill phagocytized microorganisms. In vivo quantification of phagocyte-derived ROS provides information regarding an organism's ability to mount a robust innate immune response. Here we describe a protocol to quantify and compare ROS in whole zebrafish embryos upon chemical induction of the phagocyte respiratory burst. This method makes use of a non-fluorescent compound that becomes fluorescent upon oxidation by ROS. Individual zebrafish embryos are pipetted into the wells of a microplate and incubated in this fluorogenic substrate with or without a chemical inducer of the respiratory burst. Fluorescence in each well is quantified at desired time points using a microplate reader. Fluorescence readings are adjusted to eliminate background fluorescence and then compared using an unpaired t-test. This method allows for comparison of the respiratory burst potential of zebrafish embryos at different developmental stages and in response to experimental manipulations such as protein knockdown, overexpression, or treatment with pharmacological agents. This method can also be used to monitor the respiratory burst response in whole dissected kidneys or cell preparations from kidneys of adult zebrafish and some other fish species. We believe that the relative simplicity and adaptability of this protocol will complement existing protocols and will be of interest to researchers who seek to better understand the innate immune response.

The innate immune response protects organisms against pathogen infection. A critical component of the innate immune response, the phagocyte respiratory burst, generates reactive oxygen species that kill invading microorganisms. We describe a respiratory burst assay that quantifies reactive oxygen species produced when the innate immune response is chemically induced.

Quantificazione della risposta Burst respiratoria come un indicatore di Innate Immune Salute in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Usando RNA-interferenza per Indagare sulla risposta immunitaria innata in mouse macrofagi

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

Imaging non invasiva della risposta immunitaria innata in un modello di Zebrafish larvale<em&gt; Streptococcus iniae</em&gt; Infezione

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

Dissezione multiproteici segnalazione di purificazione di affinità di complementazione bimolecolare (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies in an attempt to understand the precise mechanisms that lead to the breakdown of self-tolerance and subsequent autoimmunity. Approaches thus far have been based on the study of one specific aspect of the immune system (a single or few cell types or cytokines), and do not offer a global assessment of complex autoimmune disease. While patient sera-based studies have afforded important insights into autoimmunity, they do not provide the specific cellular source of the dysregulated cytokines detected. A comprehensive single-cell approach to evaluate cytokine production in multiple immune cell subsets, within the context of &#34;intrinsic&#34; patient-specific plasma circulating factors, is described here. This approach enables monitoring of the patient-specific immune phenotype (surface markers) and function (cytokines), either in its native &#34;intrinsic pathogenic&#34; disease state, or in the presence of therapeutic agents (in vivo or ex vivo).

Here we describe a single-cell proteomic approach to evaluate immune phenotypic and functional (intracellular cytokine induction) alterations in peripheral whole blood samples, analyzed via mass cytometry.

Cella singola analisi di Immunophenotype e produzione di citochine nel sangue periferico intero tramite citometria a massa

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Un modello di topo per valutare risposta immunitaria innata per infezione da Staphylococcus aureus

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

Un modello di amministrazione orale Galleria mellonella a risposte immunitarie Innate Study Commensal-Induced

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal immunity, because they can model host-pathogen interactions in the tissue. While isolated cells derived from tissues were the first cell culture model, their use has been neglected because tissue can be hard to obtain. In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells (TMCs) from healthy human tonsils to study innate immune responses upon activation, mimicking viral infection in mucosal tissues. Isolation of TMCs from the tonsils is quick, because the tonsils barely have any epithelium and yield up to billions of all major immune cell types. This method allows detection of cytokine production using several techniques, including immunoassays, qPCR, microscopy, flow cytometry, etc., similar to the use of peripheral mononuclear cells (PBMCs) from blood. Furthermore, TMCs show a higher sensitivity to drug testing than PBMCs, which needs to be considered for future toxicity assays. Thus, ex vivo TMCs cultures are an easy and accessible mucosal model.

In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells from healthy humans undergoing partial surgical tonsillectomy to study innate immune responses upon activation, mimicking viral infection in mucosal tissues.

Isolamento delle cellule mononucleari del Tonsillar per studiare le risposte immunitarie innate Ex Vivo in un tessuto linfoide mucosale umano

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...

Microfluidic Co-Culture Models for Dissecting the Immune Response in in vitro Tumor Microenvironments

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise invisible processes. Advanced cell assays closely mimicking in vivo scenery are establishing themselves as novel ways to visualize and measure the bidirectional tumor-host interplay influencing the progression of cancer. Here we describe two versatile protocols to recreate highly controllable 2D and 3D co-cultures in microdevices, mimicking the complexity of the tumor microenvironment (TME), under natural and therapy-induced immunosurveillance. In section 1, an experimental setting is provided to monitor crosstalk between adherent tumor cells and floating immune populations, by bright field time-lapse microscopy. As an applicative scenario, we analyze the effects of anti-cancer treatments, such as the so-called immunogenic cancer cell death inducers on the recruitment and activation of immune cells. In section 2, 3D tumor-immune microenvironments are assembled in a competitive layout. Differential immune infiltration is monitored by fluorescence snapshots up to 72 h, to evaluate combination therapeutic strategies. In both settings, image processing steps are illustrated to extract a plethora of immune cell parameters (e.g., immune cell migration and interaction, response to therapeutic agents). These simple and powerful methods can be further tailored to simulate the complexity of the TME encompassing the heterogeneity and plasticity of cancer, stromal and immune cells subtypes, as well as their reciprocal interactions as drivers of cancer evolution. The compliance of these rapidly evolving technologies with live-cell high-content imaging can lead to the generation of large informative datasets, bringing forth new challenges. Indeed, the triangle &#39;&#39;co-cultures/microscopy/advanced data analysis&#34; sets the path towards a precise problem parametrization that may assist tailor-made therapeutic protocols. We expect that future integration of cancer-immune on-a-chip with artificial intelligence for high-throughput processing will synergize a large step forward in leveraging the capabilities as predictive and preclinical tools for precision and personalized oncology.

In the age of immunotherapy and single-cell genomic profiling, cancer biology requires novel in vitro and computational tools for investigating the tumor-immune interface in a proper spatiotemporal context. We describe protocols to exploit tumor-immune microfluidic co-cultures in 2D and 3D settings, compatible with dynamic, multiparametric monitoring of cellular functions.

Modelli di co-coltura microfluidica per la dissezione della risposta immunitaria in microambienti tumorali in vitro

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise ...