Questo lavoro è stato sostenuto dal National Institutes of Health (NIH) concede CA127231 e The Damon Runyon Premio Fondazione Clinical Investigator (CI 1502) (SM). Vorremmo ringraziare il professor Zdenek Dvorak da Palacky Università di Olomouc, Repubblica Ceca per i suoi utili intuizioni che parlano di portabilità di questa tecnica per la loro istituzione e la standardizzazione del protocollo.

1. Costruzione di PXR e SRC-1 Fusioni in vettori di lievito <ol><li> Amplificazione PCR di Human PXR LBD (107-434 amminoacidi) e Human SRC-1 a figura intera (1-1401 amminoacidi). <ol><li> Utilizzare pSG5-hPXR plasmide 8 come modello PXR LBD, utilizzare plasmide pCMX-SRC1 come SRC-1 modelli. </li><li> Thaw PCR SuperMix, i modelli di DNA e primer (vedi Materiali), tenerli su ghiaccio. </li><li> Aggiungere 0,25 mg / template DNA microlitri 1 ml, 10 mM coppie di primer 2 microlitri ciascuno, PCR SuperMix 45 ml e aggiungere H 2 O per portare il volume totale di 50 microlitri. </li><li> Impostare PCR in un ciclo di 94 ° C per 2 min, 20 cicli di 94 ° C per 30 sec, 55 ° C per 30 sec e 72 ° C per 2 min, poi un ciclo di 72 ° C per 10 min per estensione. Controllare prodotti PCR eseguendo il 1% gel di agarosio. </li></ol></li><li> I prodotti di PCR clonazione in vettori Y2H. <ol><li> Purificare prodotti di PCR dal 1% gel di agarosio. Digest PXR, LBD, PCR, e Y2H vettore PSH2-1 conBamHI e Sali; digerire SRC-1 PCR e Y2H vettore pGADNOT con NotΙ e SalΙ. Per fare questo, aggiungere 1 mg di DNA, 3 ml 10x tampone di reazione, 1 ml enzimi di restrizione, e, infine, H 2 O per portare il volume totale di 30 microlitri. </li><li> Mettere i campioni digestione nel 37 ° C a bagnomaria per 1 ora. Controllare digestione eseguendo il 1% gel di agarosio. </li><li> Purificare i campioni di digestione da 1% gel di agarosio, legare digerito prodotti di PCR e vettori Y2H e trasformare le cellule competenti DH5a. </li><li> Scegli le colonie e isolare il DNA plasmide. </li></ol></li><li> Identificare PSH2-1-PXR plasmide DNA BamHI / SalI digestione, identificare pGADNOT-SRC-1 plasmide DNA Notl / SalI digestione. Verificare che tutto il DNA plasmide positivo mediante sequenziamento. </li></ol> 2. Lievito Two-hybrid Saggi <ol><li> Inoculare il ceppo di lievito in 5 ml YPAD e incubare per tutta la notte mediante agitazione costante (220 rpm a 30 ° C). Nota: Il ceppo Saccharomyces cerevisiae era CTY10-5d(Mat A ade2 trp 1-901 LEU2-3, 112 his3-200 ga l4 - gal80 - URA3 :: lexA-lacZ) che contiene un gene integrato GAL1-lacZ con lexA operatore 10. Per ottenere cellule di lievito vitali resistenti al ketoconazolo, ma quelli che non portano alterazioni trasportatore come causa della resistenza azolici 18-20, nuovi ceppi di lievito CTY10-5d sono stati ottenuti dalla prima ERG3 cancellazione (ERG3 Δ) e poi introducendo la cancellazione supplementare ERG11 (ERG3 Δ / erg11 Δ) geni di ricombinazione omologa. I dettagli costruttivi sono stati descritti in un manoscritto precedentemente pubblicato 6. </li><li> Il giorno successivo (al mattino), inoculare lievito (1,20) in 5 ml YAPD e incubare avere un OD 600 ~ 0,2 mediante agitazione costante (220 rpm a 30 ° C). </li><li> Agglomerare le cellule a 2.000 rpm in una microcentrifuga per 2 minuti e scartare il surnatante. Quindi lavare la pellet due volte con acqua autoclave e una volta con 0.1 M LIAC. </li><li> Dopo l&#39;ultimo lavaggio, scartare il surnatante e aggiungere i seguenti reagenti per il pellet cellulare: 240 ml PEG 3500 al 50% w / v, 36 microlitri 1 M LIAC, 50 pl 2 mg / ml bollito ssDNA sperma di salmone, H 2 O 34 microlitri. Vortex per mescolare, aggiungere 1 mg PSH-PXR e 1 mg pGADNOT-SRC-1 DNA e mescolare. </li><li> Trasferire la miscela di polistirene tubo a fondo rotondo, agitare la trasformazione, mescolare (220 rpm a 30 ° C) per 30 min. Spostare il tubo a 42 ° C bagnomaria e incubare per altri 30 min. </li><li> Centrifugare la provetta a 2.000 rpm per 2 minuti e rimuovere il surnatante. Lavare pellet una volta con acqua autoclave. </li><li> Aggiungere 100 ml di acqua sterile nel tubo, risospendere le cellule dalla barretta dolce toccando e pipettaggio, poi piastra su piastre di -His/-Leu Dropout Media (Formulazione per un litro -His/-Leu Dropout medio: 20 g destrosio, 1.7 g YNB, 0.67 g CSM-His/-Leu, 5 g di solfato di ammonio, 1,5% agar) e incUbate a 30 ° C per 3-4 giorni per isolare trasformanti. </li></ol> 3. X-gal Filter Assay <ol><li> Tagliare membrana di nitrocellulosa alla dimensione di una parte di una piastra di Petri. Etichettare la membrana di nitrocellulosa per segnare l&#39;orientamento. </li><li> Posizionare membrana di nitrocellulosa premarcata su colonie di lievito, assicurarsi che la membrana è in contatto con la superficie del terreno piastra. </li><li> Rimuovere la membrana, posizionarlo lato colonia su una carta da filtro a 3 mm, e collocare la membrana e la carta da filtro a -80 ° C per 15 min. </li><li> Preparare la soluzione di X-gal. Aggiungere 50 microlitri 20 mg / ml X-gal e 15 microlitri β-mercaptoetanolo al 5 ml di Z-buffer (tampone 1 L contiene 16,1 g di Na 2 HPO 4 7H 2 O, 5,5 g di NaH 2 PO 4 H 2 O, 0,75 g KCl, 0,25 g MgSO 4 • 7H 2 O). Se Z Buffer fu mantenuta a 4 ° C, portarlo a temperatura ambiente prima di aggiungere questi reagenti. </li><li> Mettere due cerchi di 3 millimetri carta da filtroin una piastra di Petri e ammollo con 5 ml di soluzione X-gal. Scolare il tampone in eccesso dalla piastra di Petri e posizionare la membrana di nitrocellulosa con la colonia verso l&#39;alto. </li><li> Chiudere il coperchio, assicurarsi che la membrana è in contatto completo con la carta da filtro ed è completamente bagnato. Avvolgere la piastra di Petri in strisce e incubare a 37 ° C per 30 min a overnight. </li></ol> 4. Liquid Assay β-gal <ol><li> Crescere lievito in -His/-Leu Dropout mezzo liquido di OD 600 0.7. </li><li> Trasferire 1 ml in mezzo una provetta da 1,5 ml microcentrifuga e centrifugare a 3000 rpm per 2 min. Scartare il surnatante. </li><li> Aggiungere 1 ml di Z Buffer per risospendere il pellet, centrifugare a 3000 rpm ancora per 2 min. Scartare il surnatante. </li><li> Aggiungere 150 ml di Z Buffer con 2ME per risospendere il pellet cellulare, mescolare poi aggiungere 50 ml di cloroformio e il 20 microlitri 0,1% SDS. Vigorosamente vortice il campione per 15 sec. </li><li> Aggiungere 700 ml di ONPG Soluzione (1 mg / ml in Z buffer). Impostare il timer, incubare a 30 ° C abbastanza a lungo per permettere al colore giallo di sviluppare e notare tempo di reazione totale. </li><li> Aggiungere 500 ml di 1 M di Na 2 CO 3 per bloccare la reazione e determinare l&#39;assorbanza a 420 nm. Il bianco è la soluzione ONPG 700 ml più 500 ml 1 M Na 2 CO 3. </li></ol> Calcola Unità Miller come segue: Miller Unità = (A420 * 1000) / (A600 * min * ml) A420: unità di assorbanza a 420 nanometri; A600: unità di assorbanza a 600 nanometri, min: il tempo di reazione in minuti; ml: il volume di reazione in ml

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

Nessun conflitto di interessi dichiarati.

Nel nostro test Y2H modificata, abbiamo identificato residui importanti per le interazioni ketoconazolo su PXR 6. Dal SRC-1 è un coactivator (ed è stato clonato nel vettore pGADNot), abbiamo provato anche se SRC-1 potrebbe attivare l&#39;espressione lacZ quando clonato nel sistema vettore PSH e se questo cambierebbe il profilo di attivazione e / o influenzare il leakiness di il lievito saggio del doppio ibrido. Utilizzando i nostri plasmidi ridisegnati abbiamo effettuato test di due ibride in ERG3 ...

Il lievito due ibridi (Y2H) saggio è ampiamente utilizzato per rilevare le interazioni proteina-proteina e più recentemente per la scoperta di nuove piccole molecole che interrompono proteina-proteina complessi di interazione 7, 8, 9, 10, 11. Tuttavia, gli approcci convenzionali di questo test, utilizzato per la scoperta di nuovi farmaci o di &quot;hits&quot;, non consentono per il rilevamento di residui di interazione allosterici di prodotti chimici composti all&#39;interno di superfici proteina-proteina, che, quando alterati ancora interagire e consentire l&#39;interrogatorio dei residui alterati 11 . Infatti, tale metodo (s), se possibile sviluppare, consentirebbe un sistema di lievito trattabili per la valutazione ad alta velocità di residui di interazione allosterici critiche per l&#39;interazione proteina-proteina perturbazione. Nel contesto di scoperta di farmaci, il modo più diretto per stabilire l&#39;interazione dei composti con proteine ​​comporterebbe determinazione strutturale (es cristallizzazione del complesso proteina-inibitore). Questi metodi sono cumbersome, utilizzare le risorse elaborate e non è tecnicamente possibile effettuare studi strutturali su tutte le proteine. Sistemi di screening di stupefacenti genetica trattabili sono state stabilite nei batteri 1, 2 e altri sistemi modello, come mammiferi two-hybrid. Tuttavia, questi sistemi devono ottimizzazione e sistemi alternativi come Y2H sono ancora i più testato nella scoperta di farmaci. Esistono limitazioni che includono scarsa sensibilità e affidabilità delle interazioni con metodi singolari 13, tuttavia, un singolo test Y2H può essere modificato per rispondere a domande specifiche relative ai residui di interazione. Nel campo della ricerca recettore nucleare, Y2H è stato usato per definire proteine ​​interagenti 14, tuttavia, queste interazioni proteina sono state raramente utilizzata per definire la natura in cui ligandi / antagonisti interagiscono con complessi recettore-proteine ​​nucleari. Così, il nostro laboratorio concentrato sforzi sulla definizione di un metodo, in particolare per le proteine ​​recettori che non sonofacilmente suscettibili di proteomica metodi basati, che sarebbe dissotterrare romanzo ligando / antagonista interagire residui utilizzando un Y2H basato piattaforma di scoperta inverso. Sulla base della nostra precedente scoperta che il ketoconazolo interrompe PXR e il suo attivatore SRC-1, abbiamo sviluppato un nuovo sistema Y2H che ci permettono di definire e interrogare ketoconazolo interagire residui sulla PXR 6 inversa. Il nostro metodo si basa sulle proprietà della proteina GAL4 lievito che consiste di domini separabili responsabili dell&#39;attivazione di legame al DNA e trascrizionale. La proteina PXR LBD è espressa come una fusione al dominio LexA DNA-binding (DNA-BD), mentre le lunghe co-attivatori SRC-1 (coactivator recettore steroide 1) proteine ​​sono espresse come fusioni al dominio di attivazione GAL4 (AD ). Interazione tra PXR e SRC-1 proteine ​​di fusione porta all&#39;attivazione trascrizionale di GAL4 siti di legame contenenti gene reporter β-Lac Z che viene integrato nel genom lievitoe. Ketoconazolo, un antagonista PXR, interrompe PXR e SRC-1 interazione 15, 16, 17 e si può rilevare l&#39;interazione di PXR e SRC-1 in presenza o assenza di ketoconazolo dopo colorazione colonie su filtri per l&#39;attività X-gal. Il principio di Y2H è illustrato in Figura 1 e la procedura sperimentale è riassunto in Figura 2.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

Come regolatore critico del metabolismo dei farmaci e infiammazione, Pregnane X Receptor (PXR), svolge un ruolo importante nella patofisiologia collegamento metabolismo e infiammazione (es. steatosi epatica) 1,2. C&#39;è stato molto progresso per l&#39;identificazione di ligandi agonisti a PXR, tuttavia, ci sono le descrizioni limitate di antagonisti drug-like e dei loro siti di legame su PXR 3,4,5. Una barriera critica è l&#39;incapacità di purificare efficientemente proteina intera per studi strutturali con antagonisti nonostante PXR è stato clonato e caratterizzato nel 1998. Il nostro laboratorio ha sviluppato un romanzo di lievito ad alta velocità basata saggio del doppio ibrido per definire un antagonista, ketoconazolo di residui vincolante per PXR 6. Il nostro metodo prevede la creazione di librerie mutazionali che salvare l&#39;effetto delle singole mutazioni sulla superficie AF-2 di PXR previsto per interagire con ketoconazolo. Rescue o seco &quot;guadagno di funzione&quot;nd mutazioni possono essere fatte in modo tale che le conclusioni riguardanti l&#39;interazione genetica di ketoconazolo e il residuo di superficie (s) on PXR sono fattibili. Così, abbiamo sviluppato un elevato throughput two-hybrid schermo lievito di mutanti PXR che interagiscono con il suo coactivator, SRC-1. Usando questo approccio, in cui il lievito è stato modificato per accogliere lo studio del farmaco antifungino, ketoconazolo, potremmo dimostrare mutazioni specifiche su PXR arricchiti in cloni incapaci di legarsi al ketoconazolo. Con logica inversa, possiamo concludere che i residui originali siano residui interazione diretta con ketoconazolo. Questo test rappresenta un romanzo, test genetico trattabili allo schermo per antagonista siti di legame sulle superfici del recettore nucleare. Questa analisi può essere applicata a qualsiasi farmaco indipendentemente dal suo potenziale citotossico di lievito e di proteina cellulare (s) che non può essere studiata utilizzando biologia strutturale standard o metodi basati proteomica. Potenziali insidie ​​comprendono l&#39;interpretazione dei dati (metodi complementari utile), relizione sul metodo unico Y2H, esperienza nella gestione di lievito o l&#39;esecuzione di lievito saggi di due ibridi, e l&#39;ottimizzazione del dosaggio.

Noi eseguito un test per vedere se potevamo rilevare una lettura colorimetrica dell&#39;associazione di PXR e del recettore steroide coactivator-1 (SRC-1). Dato che il lievito ha una significativa produzione di sterolo, è stato precedentemente dimostrato che l&#39;espressione lacZ nel lievito può essere indotta senza la necessità di ulteriori ligando esogeno. Abbiamo trovato che l&#39;espressione lacZ (colonie blu) è anche indotto nel ceppo di lievito trasformato con PXR e SRC-1, tuttavia, non vi è alcuna induzione...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Ketoconazolo lega e antagonizza Pregnane X Receptor (PXR) attivazione. Di lievito di alta schermi di throughput di mutanti PXR definiscono una regione unica per l&#39;associazione ketoconazolo. Questo metodo genetico a base di lievito scopre interazioni recettore nucleare nuovi con leganti che associano con siti di legame di superficie.

Reverse lievito sistema Two-ibrida per identificare mammiferi Nuclear Receptor residui che interagiscono con leganti e / o antagonisti

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

reverse-yeast-two-hybrid-system-to-identify-mammalian-nuclear

Research

JoVE Journal

Biology

12.7K Views.  Albert Einstein College of Medicine.  Ketoconazolo lega e antagonizza Pregnane X Receptor (PXR) attivazione. Di lievito di alta schermi di throughput di mutanti PXR definiscono una regione unica per l'associazione ketoconazolo. Questo metodo genetico a base di lievito scopre interazioni recettore nucleare nuovi con leganti che associano con siti di legame di superficie. 

Video: Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys loop, the glutamate-gated and the P2X receptor channels2. In each case binding of transmitter leads to the opening of a pore through which ions flow down their electrochemical gradients. Many ligand-gated channels are also permeable to calcium ions3, 4, which have downstream signaling roles5 (e.g. gene regulation) that may exceed the duration of channel opening. Thus ligand-gated channels can signal over broad time scales ranging from a few milliseconds to days. Given these important roles it is necessary to understand how ligand-gated ion channels themselves are regulated by proteins, and how these proteins may tune signaling. Recent studies suggest that many, if not all, channels may be part of protein signaling complexes6. In this article we explain how to identify the proteins that bind to the C-terminal aspects of the P2X2 receptor cytosolic domain.
P2X receptors are ATP-gated cation channels and consist of seven subunits (P2X1-P2X7). P2X receptors are widely expressed in the brain, where they mediate excitatory synaptic transmission and presynaptic facilitation of neurotransmitter release7. P2X receptors are found in excitable and non-excitable cells and mediate key roles in neuronal signaling, inflammation and cardiovascular function8. P2X2 receptors are abundant in the nervous system9 and are the focus of this study. Each P2X subunit is thought to possess two membrane spanning segments (TM1 &amp; TM2) separated by an extracellular region7 and intracellular N and C termini (Fig 1a)7. P2X subunits10 (P2X1-P2X7) show 30-50% sequence homology at the amino acid level11. P2X receptors contain only three subunits, which is the simplest stoichiometry among ionotropic receptors. The P2X2 C-terminus consists of 120 amino acids (Fig 1b) and contains several protein docking consensus sites, supporting the hypothesis that P2X2 receptor may be part of signaling complexes. However, although several functions have been attributed to the C-terminus of P2X2 receptors9 no study has described the molecular partners that couple to the intracellular side of this protein via the full length C-terminus. In this methods paper we describe a proteomic approach to identify the proteins which interact with the full length C-terminus of P2X2 receptors.

We describe a simple protocol to identify brain proteins that bind to the full length C terminus of ATP-gated P2X2 receptors. The extension and systematic application of this approach to all P2X receptors is expected to lead to a better understanding of P2X receptor signaling.

Proteomica per identificare proteine ​​che interagiscono con P2X2 Ligand-Gated canali di comunicazione

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Ricerca

Biologia

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput identification of protein-protein interactions (PPI) for full-length transmembrane proteins. To this end, our lab developed the split-ubiquitin based Membrane Yeast Two-Hybrid (MYTH) system. This technology allows for the sensitive detection of transient and stable protein interactions using Saccharomyces cerevisiae as a host organism. MYTH takes advantage of the observation that ubiquitin can be separated into two stable moieties: the C-terminal half of yeast ubiquitin (Cub) and the N-terminal half of the ubiquitin moiety (Nub). In MYTH, this principle is adapted for use as a 'sensor' of protein-protein interactions. Briefly, the integral membrane bait protein is fused to Cub which is linked to an artificial transcription factor. Prey proteins, either in individual or library format, are fused to the Nub moiety. Protein interaction between the bait and prey leads to reconstitution of the ubiquitin moieties, forming a full-length 'pseudo-ubiquitin' molecule. This molecule is in turn recognized by cytosolic deubiquitinating enzymes, resulting in cleavage of the transcription factor, and subsequent induction of reporter gene expression. The system is highly adaptable, and is particularly well-suited to high-throughput screening. It has been successfully employed to investigate interactions using integral membrane proteins from both yeast and other organisms.

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

MYTH allows the sensitive detection of transient and stable interactions between proteins that are expressed in the model organism Saccharomyces cerevisiae. It has been successfully applied to study exogenous and yeast integral membrane proteins in order to identify their interacting partners in a high throughput manner.

Split-Ubiquitina membrana a base di lievito Due-Hybrid (MITO) Sistema: un potente strumento per identificare interazioni proteina-proteina

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

Analisi della cinetica di esportazione mRNA nucleare in cellule di mammifero da Microiniezione

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated tools and resources for studies in this system are facilitating continued discovery of genes with more subtle phenotypes or roles. 
Here we present a generalized protocol we adapted for identifying C. elegans genes with postembryonic phenotypes of interest using RNAi2. This procedure is easily modified to assay the phenotype of choice, whether by light or fluorescence optics on a dissecting or compound microscope. This screening protocol capitalizes on the physical assets of the organism and molecular tools the C. elegans research community has produced. As an example, we demonstrate the use of an integrated transgene that expresses a fluorescent product in an RNAi screen to identify genes required for the normal localization of this product in late stage larvae and adults. First, we used a commercially available genomic RNAi library with full-length cDNA inserts. This library facilitates the rapid identification of multiple candidates by RNAi reduction of the candidate gene product. Second, we generated an integrated transgene that expresses our fluorecently tagged protein of interest in an RNAi-sensitive background. Third, by exposing hatched animals to RNAi, this screen permits identification of gene products that have a vital embryonic role that would otherwise mask a post-embryonic role in regulating the protein of interest. Lastly, this screen uses a compound microscope equipped for single cell resolution.

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

We describe a sensitized method to identify postembryonic regulators of protein expression and localization in C. elegans using an RNAi-based genomic screen and an integrated transgene that expresses a functional, fluorescently tagged protein.

RNAi di screening per identificare fenotipi postembrionale in C. elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role in a variety of physiologic and disease processes, including early embryogenesis, wound healing 1, inflammation 2, 3, and host defense 4. PGRN also functions as a neurotrophic factor 5, and mutations in the PGRN gene resulting in partial loss of the PGRN protein cause frontotemporal dementia 6, 7. Our recent studies have led to the isolation of PGRN as an important regulator of cartilage development and degradation 8-11. Although PGRN, discovered nearly two decades ago, plays crucial roles in multiple physiological and pathological conditions, efforts to exploit the actions of PGRN and understand the mechanisms involved have been significantly hampered by our inability to identify its binding receptor(s). To address this issue, we developed a modified yeast two-hybrid (MY2H) approach based on the most commonly used GAL4 based 2-hybrid system. Compared with the conventional yeast two-hybrid screen, MY2H dramatically shortens the screen process and reduces the number of false positive clones. In addition, this approach is reproducible and reliable, and we have successfully employed this system in isolating the binding proteins of various baits, including ion channel 12, extracellular matrix protein 10, 13, and growth factor14. In this paper, we describe this MY2H experimental procedure in detail using PGRN as an example that led to the identification of TNFR2 as the first known PGRN-associated receptor 14, 15.

We have modified the conventional yeast two-hybrid screening, an effective genetic tool in identifying protein interaction. This modification markedly shortens the process, reduces the workload, and most importantly, reduces the number of false positives. In addition, this approach is reproducible and reliable.

Modificato lievito-sistema del doppio ibrido per identificare proteine ​​che interagiscono con il fattore di crescita progranulina

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

siRNA screening per identificare ubiquitina e ubiquitina-come regolatori del sistema di percorsi biologici in cellule di mammifero coltivate

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade &#34;Environmental Estrogens&#34; (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-&#946;-D-galactopyranoside (ONPG) or chlorophenol red-&#946;-D-galactopyranoside (CPRG)) that are cleaved by &#946;-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting, organizing, and analyzing data; constructing and interpreting graphs; and using common laboratory equipment such as micropipettors and spectrophotometers. Thus, implementing this assay encourages students to engage in inquiry-based learning while exploring emerging issues in environmental science and health.

This article presents an optimized yeast estrogen screen for quantifying ligands in Personal Care Products (PCPs) that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates two colorimetric substrate options, a six-day refrigerated incubation for use in undergraduate courses, and statistical tools for data analysis.

Rilevamento di ligandi estrogenici nei prodotti di cura personale utilizzando un lievito estrogeno schermo ottimizzato per il laboratorio di insegnamento universitari

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling contributes to the progression of many diseases. The ligand/receptor pair CXC chemokine ligand 12 (CXCL12)/CXC chemokine receptor 4 (CXCR4) has raised significant clinical interest, for instance as a potential target for the treatment of cancer and inflammatory diseases. Small molecules as well as therapeutic antibodies that specifically target CXCR4 and inhibit the receptor&#39;s function are therefore considered to be valuable pharmacological tools. Here, a flow cytometry-based cellular assay that allows identification of compounds (e.g., small molecules) that abrogate CXCL12 binding to CXCR4, is described. Essentially, the assay relies on the competition for receptor binding between a fixed amount of fluorescently labeled CXCL12, the natural chemokine agonist for CXCR4, and unlabeled compounds. Hence, the undesirable use of radioactively labeled probes is avoided in this assay. In addition, living cells are used as the source of receptor (CXCR4) instead of cell membrane preparations. This allows easy adaptation of the assay to a plate format, which increases the throughput. This assay has been shown to be a valuable generic drug discovery assay to identify CXCR4-targeting compounds. The protocol can likely be adapted to other GPCRs, at least if fluorescently labeled ligands are available or can be generated. Prior knowledge concerning the intracellular signaling pathways that are induced upon activation of these GPCRs, is not required.

A flow cytometry-based cellular binding assay is described that is primarily used as a screening tool to identify compounds that inhibit the binding of a fluorescently labeled CXC chemokine ligand 12 (CXCL12) to the CXC chemokine receptor 4 (CXCR4).

Un'analisi di citometria-basata di flusso per identificare i composti che interrompono il grippaggio del Ligand di Chemokine CXC fluorescente etichettati 12 al recettore di chemochine CXC 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling ...

Examination of Mitotic and Meiotic Fission Yeast Nuclear Dynamics by Fluorescence Live-cell Microscopy

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does not interfere with cell physiology, and requires minimal experimental handling. The low levels of technical interference enable researchers to study cells across multiple cycles of mitosis and to observe meiosis from beginning to end. Using fluorescent tags such as Green Fluorescent Protein (GFP) and Red Fluorescent Protein (RFP), researchers can analyze different factors whose functions are important for processes like transcription, DNA replication, cohesion, and segregation. Coupled with data analysis using Fiji (a free, optimized ImageJ version), live-cell imaging offers various ways of assessing protein movement, localization, stability, and timing, as well as nuclear dynamics and chromosome segregation. However, as is the case with other microscopy methods, live-cell imaging is limited by the intrinsic properties of light, which put a limit to the resolution power at high magnifications, and is also sensitive to photobleaching or phototoxicity at high wavelength frequencies. However, with some care, investigators can bypass these physical limitations by carefully choosing the right conditions, strains, and fluorescent markers to allow for the appropriate visualization of mitotic and meiotic events.

Here, we present live-cell imaging which is a non-toxic microscopy method that allows researchers to study protein behavior and nuclear dynamics in living fission yeast cells during mitosis and meiosis.

Esame della dinamica nucleare del lievito di fissione mitotico e meiotico da fluorescenza microscopia a celle vive

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does ...

A Two-Step Strategy that Combines Epigenetic Modification and Biomechanical Cues to Generate Mammalian Pluripotent Cells

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe a new strategy that combines the use of chemical epigenetic erasing with mechanosensing-related cues, to generate mammalian pluripotent cells. Two main steps are required. In the first step, adult mature (terminally differentiated) cells are exposed to the epigenetic eraser 5-aza-cytidine to drive them into a pluripotent state. This part of the protocol was developed, based on the increasing understanding of the epigenetic mechanisms controlling cell fate and differentiation, and involves the use of the epigenetic modifier to erase cell differentiated state and then drive into a transient high plasticity window.
In the second step, erased cells are encapsulated in polytetrafluoroethylene (PTFE) micro-bioreactors, also known as Liquid Marbles, to promote 3D cell rearrangement to extend and stably maintain the acquired high plasticity. PTFE is a non-reactive hydrophobic synthetic compound and its use permits the creation of a cellular microenvironment, which cannot be achieved in traditional 2D culture systems. This system encourages and boosts the maintenance of pluripotency though bio-mechanosensing-related cues.
The technical procedures described here are simple strategies to allow for the induction and maintenance of a high plasticity state in adult somatic cells. The protocol allowed the derivation of high plasticity cells in all mammalian species tested. Since it does not involve the use of gene transfection and is free of viral vectors, it may represent a notable technological advance for translational medicine applications. Furthermore, the micro-bioreactor system provides a notable advancement in stem cell organoid technology by in vitro re-creating a specific micro-environment that allows for the long-term culture of high plasticity cells, namely as ESCs, iPSCs, epigenetically erased cells and MSCs.

We here present a method that combines the use of chemical epigenetic erasing with mechanosensing-related cues to efficiently generate mammalian pluripotent cells, without the need of gene transfection or retroviral vectors. This strategy is, therefore, promising for translational medicine and represents a notable advancement in stem cell organoid technology.

Una strategia in due fasi che combina modificazione epigenetica e segnali biomeccanici per generare cellule pluripotenti di mammifero

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe ...