Vorremmo riconoscere il sostegno finanziario del Programma Larkins Monash, nonché da un NHMRC CDF e una sovvenzione di progetto NHMRC. Inoltre, vorremmo ringraziare Sue Mei Lim per i suoi suggerimenti costruttivi, Edwina McGlinn per il suo sostegno e la squadra Monash Flowcore (in particolare Adam Dinsdale) per il loro aiuto nella produzione di video.

1 Impostazioni Strumento / Preparazione dei reagenti / Genotipizzazione <ol><li> Preparare media delle cellule iPS: Supplemento 500 mezzi ml Knockout DMEM con 75 ml di siero fetale bovino (FBS), 5 ml di L-glutammina, 5 ml di aminoacidi non essenziali, 500 microlitri β-mercaptoetanolo, 5 x 10 5 unità leucemia fattore inibitorio ( LIF). Si prega di fare riferimento alla Lista dei materiali per il prodotto e acquisti per i reagenti utilizzati nel contesto di questo manoscritto. </li><li> Preparare medio MEF: Supplemento 500 ml supporti DMEM con 50 ml di FBS, 5 ml di L-glutammina, 5 ml aminoacidi non essenziali, 5 ml di sodio piruvato, 500 microlitri β-mercaptoetanolo. </li><li> Preparare congelamento media: Per 10 ml, combinare 9 ml di FBS con 1 ml di DMSO. </li><li> Preparare la gelatina rivestito piatti Aggiungere 3-5 ml di 0,1% soluzione di gelatina suina ad un pallone T75, incubare a temperatura ambiente per almeno 10 minuti e aspirare a destra prima dell&#39;uso. </li><li> Preparare FACS media etichettatura: Per 10 ml, combinare 9,9 ml di PBS con 0,1 ml di FBS. </li><li> Eseguireuna genotipizzazione PCR per il locus Rosa26 m2rtTA: Eseguire reazioni con DNA polimerasi Taq secondo le istruzioni del produttore. Utilizzare una versione modificata MgCl 2 -concentration di 3,5 mm e 3 seguenti primer: oIMR8052: 5 &#39;GCG AAG AGT TTG TCC TCA ACC 3&#39;, oIMR8545: 5&#39;AAA GTC GCT CTG AGT TGT TAT 3 &#39;, oIMR8546: 5&#39; GGA GCG GGA GAA ATG ATG GAT 3 &#39;. Condizioni Ciclismo: 94 ° C per 3 min; 35 cicli di (94 ° C per 30 sec, 65 ° C per 1 min, 72 ° C per 1 min); 72 ° C per 2 min; tenere a 12 ° C. Formato del prodotto previsto: 650 bp per l&#39;allele wild type e 340 bp per l&#39;allele mutante. </li><li> Eseguire una genotipizzazione PCR per il locus collagene-StemCa / OKSM: Eseguire reazioni con DNA polimerasi Taq come da istruzioni. Utilizzare una versione modificata MgCl 2 -concentration di 2,5 mm e 3 seguenti primer: col / frt-B: 5 &#39;CCCTCCATGTGTGACCAAGG 3&#39;, col / frtA1: 5 &#39;GCACAGCATTGCGGACATGC 3&#39;, col / frtC1: 5 &#39;GCAGAAGCGCGGCCGTCTGG 3 &#39;. Condizioni Ciclismo: 95 ° C per 1 min: 2 cicli di (94 ° C per 30 sec, 70 ° C per 45 secondi), 6 cicli di (94 ° C per 30 sec, 68 ° C per 45 secondi) e 30 cicli di (94 ° C per 20 sec, 60 ° C per 1 min); 72 ° C per 5 min; tenere a 12 ° C. Formato del prodotto previsto: 331 bp per l&#39;allele wild type e 551 bp per l&#39;allele mutante. </li><li> Eseguire tutte le fasi di centrifugazione a 400 xg per 3 min a 4 ° C. </li></ol> 2 Generazione di fibroblasti embrionali di topo <ol><li> Eseguire un accoppiamento a tempo tra un animale del ceppo OKSM con un membro del sesso opposto del ceppo m2rtTA. Embrioni Harvest a giorno embrionale 13.5 di abbattimento la madre e la rimozione del corno uterino. Prima della rimozione del corno uterino, spruzzare la regione addominale con una soluzione di etanolo al 80%, per evitare la contaminazione microbica. </li><li> Trasferire il corno uterino in un piatto di coltura di tessuti 10 centimetri contenente 10 ml di sterile tampone fosfato (PBS). Usare le forbici sterilizzate grado chirurgico per tagliare il corno uterino in pezzi contenenti un embrione (vedere Figura 3A, B). </li><li> Utilizzare un microscopio dissezione (idealmente collocato all&#39;interno di una cappa di coltura tissutale) e pinze sterilizzate per rimuovere con attenzione la busta uterino e le membrane extra-embrionali circostanti ogni embrione. Trasferire ogni embrione di un piatto separato 10 centimetri con 10 ml di PBS. </li><li> Procedere rimuovendo la testa dell&#39;embrione, gli arti, la coda e gli organi interni (cuore, fegato, intestino, ecc) con la pinza (vedi Figura 3C). Trasferire testa dell&#39;embrione in una provetta da 1,5 ml e congelare giù in modo che possa essere utilizzato per la genotipizzazione se necessario. </li><li> Trasferire il torso dell&#39;embrione in un 10 centimetri piatto vuoto e usare due lame chirurgiche per tritare l&#39;embrione per 2 min. Aggiungere 200 ml di soluzione di tripsina / EDTA in cima dell&#39;embrione tritato e incubare per 3-5 minuti a temperatura ambiente. Continuare macinazione per un ulteriore 2 minuti, aggiungere 2 ml di media MEF al<html> attivare la tripsina, e poi trasferire in una provetta da 15 ml. </li><li> Utilizzare una pipetta 1.000 microlitri di dissociare ulteriormente meccanicamente il tessuto delicatamente pipettaggio. Trasferire in un piatto di 10 centimetri di gelatina rivestito e aggiungere un ulteriore 10 ml di supporti MEF. Nota: Sia incubatori normossiche e ipossia possono essere utilizzati per la cultura, fare riferimento alla discussione per maggiori informazioni. </li><li> Dopo 24-48 ore la piastra deve essere densamente coperto con MEF. </li><li> In alternativa, le cellule possono poi essere ulteriormente propagate o congelati verso il basso. Per il congelamento delle cellule, rimuovere il supporto di cultura, sciacquare il piatto con 10 ml di PBS per rimuovere le tracce di media e sovrapposizione con 3 ml di soluzione / EDTA tripsina. Incubare per 3-5 minuti a 37 ° C, inattivare la tripsina digestione con l&#39;aggiunta di 5 ml di media MEF e il trasferimento ad un tubo di centrifugazione 15 ml. Spin down e risospendere il pellet in 3 ml di congelamento dei media. Trasferimento a 3 cryovials e congelare giù in un contenitore di congelamento delle cellule. </li></ol> 3 Riprogrammazione del MEF ove_content &quot;&gt; NOTA: le cellule pellet per centrifugazione a 200 xg per 5 minuti a 4 ° C e utilizzare normossiche incubatori di coltura di tessuti per la riprogrammazione Può essere utile per derivare ed espandere MEF in condizioni di ipossia (5% di ossigeno, vedi la discussione per ulteriori informazioni. ). <ol><li> Scongelare rapidamente un esageratamente basso passaggio (P0-P1, 2-3 cellule Mio) in un bagno d&#39;acqua (37 ° C) e trasferire il contenuto in una provetta con 10 ml di supporti MEF pre-riscaldato. Cellule pellet, risospendere in 12 ml di mezzi freschi MEF, trasferire in una gelatina rivestita cultura T75 nave, e permettono alle cellule di recuperare per 24-48 ore prima di procedere. Nota: MEF possono essere utilizzati anche direttamente dopo derivazione. </li><li> Dopo la rimozione della coltura, lavare MEF con PBS e cellularize sovrapponendo con una soluzione di tripsina / EDTA (3 ml per 3-5 minuti a 37 ° C). Quench tripsina con l&#39;aggiunta di 5 ml di media MEF e l&#39;ulteriore dissociare le cellule delicatamente miscelazione con una pipetta 10 ml. Determinare il numero di cellule utilizzando un emocitometro. </li><li> Per reprograesperimenti llo, MEF seme su gelatina rivestite fiasche T75 a densità di 6.7 x 10 3 cellule / cm 2 (~ 0,5 milioni di cellule per pallone) in mezzi IPSC contenente 2 mg / ml di doxiciclina. Fare riferimento alla Tabella 1 per quanto riguarda le raccomandazioni di semina per ottenere circa 2 Mio intermedi di riprogrammazione per ogni punto di tempo. Nota: Riprogrammazione inizia con l&#39;aggiunta di doxiciclina (2 mg / ml) integrato multimediale </li><li> Per i primi 6 giorni sostituiscono i media ogni giorno con doxiciclina fresca completato iPSC supporti (12 ml di supporto per bombola T75). Al di là di questo punto rinnovare la media su base giornaliera, se ci sono un numero elevato di cellule. Raddoppia il volume cultura se cambia media possono essere eseguite solo a giorni alterni. </li><li> Intermedi Harvest riprogrammando in punti temporali richiesti (suggerimento: giorni 3, 6, 9, 12) rimuovendo i media, risciacquo con il volume appropriato di PBS (10 ml per un pallone T75) e la sovrapposizione con una soluzione di tripsina-EDTA (3 ml per un pallone T75). Covareper 3-5 minuti a 37 ° C e dissetare con l&#39;aggiunta di 5 ml di iPSC supporti seguiti da dolce pipettaggio. </li><li> Conte sospensione cellulare con un emocitometro (vedi sopra), pellet per centrifugazione, aspirare il surnatante e risospendere le cellule in 10 ml di PBS per rimuovere eventuali tracce di tripsina. Agglomerare cellule ancora una volta, aspirare il surnatante e procedere con passo 4.1 per isolare gli intermedi di riprogrammazione. Nota: Le cellule in fase di riprogrammazione possono essere crioconservati e scongelati per l&#39;isolamento FACS in una fase successiva. </li><li> Per stabilire iPS culture completamente riprogrammati, crescere le cellule in libera-DOX iPSC supporti per altri 4-7 giorni. Nota: le culture riprogrammazione con successo conterrà un gran numero di colonie di giorno 12 (vedi Figura 4). Durante questo tempo, le cellule iPS aberranti che ancora richiedono espressione OKSM spariranno. </li><li> In alternativa, per propagare le restanti iPS culture completamente riprogrammati: inizialmente, sementi MEF irradiati ad una densità di 15 x 10 3 cellule / cm 2 </sfino&gt; in 12 ml di iPSC supporti su una gelatina rivestita T75 pallone di un giorno o 6 ore prima di esperimenti. </li><li> Avanti, colture cellulari cellularize iPS rimuovendo i media, sciacquare il pallone T75 con 10 ml di PBS, sovrapposizione con 3 ml di soluzione di tripsina-EDTA e incubare per 3-5 minuti a 37 ° C. Quench tripsina con l&#39;aggiunta di 5 ml di supporti IPSC seguita da miscelazione delicata, trasferire in un tubo da 15 ml, spin down e poi risospeso in 10 ml iPS media. </li><li> Trasferire 500 ml di questa sospensione cellulare sulle MEF irradiati (pallone T75) e consentire alle culture di crescere per 4-5 giorni. Nota: iPS Fondata culture possono essere crioconservati o utilizzati per gli esperimenti. Linee cellulari clonali possono essere derivati ​​con la scelta di singole colonie IPSC sotto un microscopio da dissezione 22. </li><li> Cryo preservare culture IPSC confluenti come descritto in 2.8 per MEF. </li></ol> 4 Antibody Etichettatura <ol><li> Pellet cellulari Risospendere di culture di riprogrammazione, come predisposto nella sezione 3, inFACS supporti etichettatura integrato con anticorpi (anti-Thy-1.2 Pacific Blue 1: 400, anti-SSEA-1 biotina 1: 400 e anti-EpCAM FITC 1: 400). Utilizzare 200 ml di miscela di etichettatura integrato per 5 milioni di cellule e incubare in ghiaccio. </li><li> Dopo 10 min picchiettare delicatamente il tubo per risospendere le cellule e incubare per altri 10 minuti in ghiaccio. Aggiungere 10 ml di PBS freddo per tubi e spin down. </li><li> Per ogni tubo deve essere macchiato preparare 200 ml di etichettatura supporto integrato con 1 ml streptavidina-PeCy7 (1: 200) per 5 milioni di cellule. Quando le cellule sono confettate, aspirare accuratamente il surnatante e risospendere in un volume adeguato di supporti di etichettatura integrati con streptavidina-PeCy7. </li><li> Mantenere le cellule in ghiaccio per 10 minuti, toccare per risospendere, incubare per altri 10 minuti in ghiaccio, aggiungere 10 ml di PBS freddo per provetta, spin down e aspirare il surnatante. </li><li> Pellet cellulari Risospendere in etichettatura dei media integrato con ioduro di propidio (PI) (2 mg / ml) a circa 1 x 10 7 cellule / ml. Rimuovere grumi di cellule facendo passare la sospensione attraverso un filtro 70 micron. Trasferire le cellule di un adeguato tubo FACS e tenerli su ghiaccio. </li><li> Preparare i campioni separati con i singoli anticorpi (anti-Thy-1.2, anti-SSEA-1 e anti-EpCAM). NOTA: Questi sono tenuti a effettuare la compensazione del colore nei tre canali utilizzati nell&#39;analisi. Inoltre, sono necessarie cellule senza etichetta per impostare le tensioni e le porte per l&#39;ordinamento. Idealmente le cellule iPS sono utilizzate per la compensazione: le scorte di 0,5-1 x 10 6 cellule iPS mantenute sul MEF irradiati vengono memorizzati in cryovials in azoto liquido. La presenza di MEF è essenziale per ottenere un segnale nel canale Thy-1.2. </li><li> Scongelare una esageratamente di cellule iPS come descritto per MEF (sezione 3). Dopo la centrifugazione, risospendere le cellule in 800 ml di buffer di etichettatura e 200 ml di questo campione viene messa da parte come controllo senza etichetta. </li><li> Utilizzare le cellule rimanenti come controlli di compensazione. Le cellule si dividono tra tre tubi 15 ml e anticorpi aggiungerecome segue: Pacific Blue controllo della compensazione: aggiungere 0,5 ml di anticorpo anti-Thy-1.2 Blue Pacific. FITC tubo di compensazione: aggiungere 0,5 ml di anticorpo anti-EpCAM-FITC. Pe-Cy7 controllo della compensazione: 0,5 ml di anticorpo anti SSEA-1-biotina. </li><li> Conservare i campioni di cellule-anticorpo in ghiaccio per 10 minuti, mescolare toccando e incubare per 10 minuti in ghiaccio. </li><li> Campioni Lavare con 10 ml di PBS freddo per rimuovere l&#39;anticorpo non legato, girare celle in basso e aspirare il surnatante. Pellet cellulari risospendere in 200 ml di FACS mezzi etichettatura. </li><li> Per anti-SSEA-1-biotina campioni etichettati, aggiungere un coniugato streptavidina-PeCy7 (1 ml ogni 200 cellule microlitri). Cellule Label come descritto per l&#39;anticorpo primario (SSEA-1-biotina). </li><li> Passare tutti i campioni, tra cui il controllo senza etichetta attraverso un filtro 70 micron e aggiungere PI (2 mg / ml). Trasferire le cellule di tubi FACS e tenere in ghiaccio fino al momento. </li></ol> 5. FACS isolamento di intermedi Nota:Le cellule vengono ordinati utilizzando una fluorescenza attivato cell sorter con 405 nm, 488 nm e 560 nm laser di eccitazione e un ugello di 100 micron. <ol><li> Impostare le tensioni per scatter in avanti e laterale in modo che la popolazione cellulare viene visualizzato correttamente. Disegnare un cancello intorno alle cellule, come indicato in Figura 5A per escludere detriti. Nota: Il set up corretto di tensioni sul cell sorter può essere complessa e richiede un operatore esperto FACS. </li><li> Utilizzare forward scatter (FSC) altezza rispetto zona FSC escludere aggregati (Figura 5B). </li><li> Visualizza il canale PI rispetto FSC per cancello sulle pi negativo cellule vive (Figura 5C). </li><li> Utilizzare le cellule senza etichetta per regolare le tensioni per i canali fluorescenti di PB, FITC / GFP, Pe-Cy7. Idealmente posizionare la popolazione di cellule in corrispondenza dell&#39;estremità inferiore del rispettivo canale. </li><li> Impostare cancelli con le cellule di controllo non marcati come mostrato in Figura 6A, B alla frazione sub culto riprogrammazioneUres in giorno 3, 6 e 9 popolazioni: SSEA-1-/ Thy-1.2 + cellule; SSEA-1-/ Thy-1.2- cellule; e la riprogrammazione di tramite SSEA-1 + / Thy-1.2- cellule. </li><li> Inoltre suddividere il giorno 9 SSEA-1 + / Thy-1.2- frazione utilizzando il Pe-Cy7 contro FITC macchia; disegnare cancelli tutto il Sse-A1 + / EpCAM + cellule e le SSEA-1 + / cellule Epcam-. Impostare cancelli con le cellule di controllo non marcati come illustrato in Figura 6C, D. </li><li> Prefill tubi di raccolta appropriati, con supporto di cellule iPS (1-2 ml) prima cernita delle sottopopolazioni desiderati (vedere la Figura 7 per i profili FACS rappresentativi MEF, Giorno 3/6 ° giorno / Giorno 9 / Giorno 12 culture e cellule iPS). </li><li> Eseguire FACS smistamento secondo produce protocollo. </li><li> Dopo l&#39;isolamento FACS presentare alle cellule di profiling molecolare (RNA / estrazione di proteine, immunoprecipitazione della cromatina, il DNA methylome analisi, ecc). In alternativa, le varie frazioni cellulari possono essere coltivate. </li></ol>

<ol>
	<li>Matsui, Y., Zsebo, K., Hogan, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+pluripotential+embryonic+stem+cells+from+murine+primordial+germ+cells+in+culture.">Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture.</a> Cell. 70, 841-847 (1992).</li><li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+mouse+embryonic+and+adult+fibroblast+cultures+by+defined+factors.">Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.</a> Cell. 126, 663-676 (2006).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2010).</li><li>Ebert, A. D., Svendsen, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+stem+cells+and+drug+screening:+opportunities+and+challenges.">Human stem cells and drug screening: opportunities and challenges.</a> Nature Reviews. Drug Discovery. 9, 367-372 (2010).</li><li>Zhang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+iPSC+model+of+Hutchinson+Gilford+Progeria+reveals+vascular+smooth+muscle+and+mesenchymal+stem+cell+defects.">A human iPSC model of Hutchinson Gilford Progeria reveals vascular smooth muscle and mesenchymal stem cell defects.</a> Cell Stem Cell. 8, 31-45 (2011).</li><li>Samavarchi-Tehrani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomics+reveals+a+BMP-driven+mesenchymal-to-epithelial+transition+in+the+initiation+of+somatic+cell+reprogramming.">Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming.</a> Cell Stem Cell. 7, 64-77 (2010).</li><li>Celi&#224;-Terrassa, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+can+suppress+major+attributes+of+human+epithelial+tumor-initiating+cells.">Epithelial-mesenchymal transition can suppress major attributes of human epithelial tumor-initiating cells.</a> The Journal of Clinical Investigation. 122, 1849 (2012).</li><li>Liao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+cluster+302&#8211;367+enhances+somatic+cell+reprogramming+by+accelerating+a+mesenchymal-to-epithelial+transition.">MicroRNA cluster 302&#8211;367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition.</a> Journal of Biological Chemistry. 286, 17359-17364 (2011).</li><li>Cie&#347;lik, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+coordination+of+signaling+pathways+during+the+epithelial-mesenchymal+transition.">Epigenetic coordination of signaling pathways during the epithelial-mesenchymal transition.</a> Epigenetic., &amp; Chromatin. 6, 1-22 (2013).</li><li>Golipour, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+late+transition+in+somatic+cell+reprogramming+requires+regulators+distinct+from+the+pluripotency+network.">A late transition in somatic cell reprogramming requires regulators distinct from the pluripotency network.</a> Cell Stem Cell. 11, 769-782 (2012).</li><li>Maherali, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directly+reprogrammed+fibroblasts+show+global+epigenetic+remodeling+and+widespread+tissue+contribution.">Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution.</a> Cell Stem Cell. 1, 55-70 (2007).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Brambrink, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+expression+of+pluripotency+markers+during+direct+reprogramming+of+mouse+somatic+cells.">Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells.</a> Cell Stem Cell. 2, 151-159 (2008).</li><li>Wernig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reprogramming+of+fibroblasts+into+a+pluripotent+ES-cell-like+state.">In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state.</a> Nature. 448, 318-324 (2007).</li><li>Polo, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+roadmap+of+reprogramming+somatic+cells+into+iPS+cells.">A molecular roadmap of reprogramming somatic cells into iPS cells.</a> Cell. 151, 1617-1632 (2012).</li><li>Wright, A. J., Andrews, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+marker+antigens+in+the+characterization+of+human+embryonic+stem+cells.">Surface marker antigens in the characterization of human embryonic stem cells.</a> Stem Cell Research. 3, 3-11 (2009).</li><li>O'Malley, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+with+novel+cell-surface+markers+identifies+routes+to+iPS+cells.">High-resolution analysis with novel cell-surface markers identifies routes to iPS cells.</a> Nature. , (2013).</li><li>Hansson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+coordinated+proteome+dynamics+during+reprogramming+of+somatic+cells+to+pluripotency.">Highly coordinated proteome dynamics during reprogramming of somatic cells to pluripotency.</a> Cell Reports. 2, 1579-1592 (2012).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2009).</li><li>Sommer, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+generation+using+a+single+lentiviral+stem+cell+cassette.">Induced pluripotent stem cell generation using a single lentiviral stem cell cassette.</a> Stem Cells. 27, 543-549 (2009).</li><li>Takahashi, K., Okita, K., Nakagawa, M., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+fibroblast+cultures.">Induction of pluripotent stem cells from fibroblast cultures.</a> Nature Protocols. 2, 3081-3089 (2007).</li><li>Utikal, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+eliminates+a+roadblock+during+cellular+reprogramming+into+iPS+cells.">Immortalization eliminates a roadblock during cellular reprogramming into iPS cells.</a> Nature. 460, 1145-1148 (2009).</li><li>Stadtfeld, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascorbic+acid+prevents+loss+of+Dlk1-Dio3+imprinting+and+facilitates+generation+of+all-iPS+cell+mice+from+terminally+differentiated+B+cells.">Ascorbic acid prevents loss of Dlk1-Dio3 imprinting and facilitates generation of all-iPS cell mice from terminally differentiated B cells.</a> Nature Genetics. 44, 398-405 (2012).</li><li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells.">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9, 588-598 (2011).</li></ol>

Gli autori non hanno nulla da rivelare.

Al fine di riprogrammare con successo MEF in cellule iPS e per purificare intermedi riprogrammazione ad alta quantità è essenziale essere consapevoli dei fattori che hanno un impatto sull&#39;efficienza complessiva. In particolare, il lotto di FBS utilizzato per integrare i media iPS possono avere un effetto negativo. In esperienze positive generali sono stati realizzati con staminali embrionali (ES) cellule FBS qualificati ma analisi per lotti di sieri da una varietà di fornitori potrebbe identificare un&#39;alternativa più economica. Un altro fattore che incide sull&#39;efficienza riprogrammazione è il genotipo del MEF 15,20. Sebbene MEF derivate da topi eterozigoti (het) sia per il OKSM e il locus m2rtTA non riprogrammare, homozygousity a uno o entrambi i risultati loci in efficienza di riprogrammazione superiori. Infatti, MEF derivati ​​dalla progenie di OKSM e m2rtTA croci mostrano un aumento di efficienza riprogrammazione nel seguente ordine (OKSM / m2rtTA): het / het &lt;omo / het &lt;het / homo &lt;homo /homo (si prega di notare che i numeri riportati nella tabella 1 sono per gli animali het / Het). Nelle rare occasioni in un maschio homo / homo animale è identificato, un harem accoppiamento con più femmine m2rtTA può essere impostato. Tutte prole da questi incroci verrà Het / homo per la OKSM / m2rtTA loci, rispettivamente. Inoltre, si raccomanda la rapida genotipizzazione di cucciolate come cucciolate più grandi si ottengono quando si usano i topi più giovani per l&#39;allevamento (6-15 settimane di età). Inoltre, l&#39;uso del MEF a basso passaggio per la riprogrammazione è sottolineato 23. Se MEF sono stati ottenuti e ampliati in un normossiche coltura tissutale incubatore si consiglia vivamente di utilizzare solo queste cellule fino a passaggio 2 Tuttavia, se lo sperimentatore ha accesso a un incubatore basso tenore di ossigeno (5% di ossigeno) per la derivazione e l&#39;espansione del MEF, numeri più in alto 3 sarà comunque produrre buoni risultati 23 di passaggio. Nel caso in cui lo sperimentatore incontra problemi connessi con la riprogrammazione,<html> come indicato, le più probabili spiegazioni sono numeri elevati di passaggio al momento della aggiunta DOX, errata genotipo dei topi o l&#39;uso di FB che non è favorevole per la generazione di cellule iPS. Tuttavia, in rari casi abbiamo osservato che il MEF non erano in grado di riprogrammare anche in condizioni ideali. In questi casi una spontanea de novo delezione entro open reading frame del m2rtTA è stata identificata come la ragione di fondo. Questa metodologia è stata adattata con successo per estrarre SSEA-1 + intermedi tramite isolamento delle cellule magnetiche (MACS). Vi è un chiaro vantaggio nel tempo usando MACS, tuttavia, purezza le popolazioni + SSEA-1 di cellule è ridotta al 80-90%, piuttosto che più del 95%, che a seconda del tipo di esperimento le cellule sono destinati potrebbe comportare un problema. Pertanto, l&#39;opzione è quella di utilizzare MACS per arricchire per SSEA-1 + cellule seguiti da FACS per aumentare la purezza e / o frazione in SSEA-1 + / EpCAM + e SSEA-1 + / cellule Epcam-. &quot;&gt; Mentre le cellule iPS prodotte dal protocollo descritto e modello di topo hanno dimostrato di essere pluripotenti ed efficacemente contribuire a tutti i tessuti degli animali chimerici 15,20, una ridotta capacità di produrre embrioni esclusivamente composte di queste cellule iPS tramite complementazione tetraploide è stato dimostrato 24. modelli di metilazione aberranti del gene cluster DLK-DIØ3 sono stati identificati come la causa di fondo 24. Tuttavia, aggiunta di acido ascorbico alla concentrazione di 50 mg / ml ai media durante la riprogrammazione produrrà cellule di complementazione tetraploide iPS competenti 24. Si prega di notare che un modello alternativo del mouse riprogrammabile progettato per esprimere i fattori di riprogrammazione in una stechiometria diversa può produrre tetraploide cellule iPS competenti anche in assenza di trattamento con acido ascorbico 25. Tuttavia, nelle nostre cellule mani da questa riprogrammare deformazione alla frequenza notevolmente inferiore rispetto alla modalità mouse qui usatol. La metodologia descritta in questo manoscritto permette la separazione di intermedi riprogrammazione dalla massa refrattaria della popolazione e deve essere visto come strumento prezioso per analizzare e comprendere il processo di riprogrammazione, rimuovendo le precedenti limitazioni di dover utilizzare una popolazione non frazionato per la profilazione (ad esempio, rumore del segnale alto da cellule refrattarie). La combinazione di anticorpi qui descritta permette l&#39;isolamento di intermedi da cellule di topo ad alta purezza, tuttavia è possibile che ulteriori marcatori di superficie delle cellule verranno scoperti in futuro, che permetterà di ottenere intermedi in ancora più elevato di purezza. Si prega di notare che SSEA-1 espressione non è un segno distintivo di cellule staminali umane pluripotenti indotte e come tale questo protocollo non può essere utilizzato su riprogrammazione delle cellule di origine umana. In conclusione, gli intermedi di riprogrammazione volta isolati con il metodo descritto può essere utilizzato per analisi molecolari compresi espressione profiling, immunoprecipitazione della cromatina, methylome analisi, e proteine ​​saggi.

Staminali embrionali (ES), le cellule sono derivate dalla massa cellulare interna dell&#39;embrione stadio di blastocisti 1. In appropriate condizioni di coltura si auto-rinnovano e rimangono pluripotenti. Nel 2006 Yamanaka e colleghi hanno dimostrato che le cellule mature possono essere riprogrammate in cosiddetto staminali pluripotenti indotte (iPS), cellule con espressione forzata di fattori di trascrizione Oct-4, Klf-4, Sox-2, c-Myc (OKSM) 2. cellule iPS, come le cellule staminali, possono dare origine a tutti i tipi di cellule del corpo, tuttavia, sono privi di vincoli etici che circondano la generazione di cellule ES 3. Inoltre, le cellule iPS portano la promessa della medicina rigenerativa personalizzata e detengono un enorme potenziale per applicazioni come la modellazione della malattia e in vitro di screening droga 4,5. Al fine di riprogrammare la tecnologia per realizzare questo potenziale, il meccanismo di base della riprogrammazione nucleare deve essere pienamente compreso. Tuttavia, gli sforzi per sezionare il pat riprogrammazioneHWAY sono stati ostacolati dal fatto che solo un numero molto piccolo di cellule riprogrammare (0,1-1%). Fibroblasti riprogrammazione con successo sono stati riportati a subire una serie distinta di eventi tra cui una di transizione epitelio mesenchimale 6-10 e, nelle fasi finali di riprogrammazione, l&#39;attivazione del nucleo endogeno pluripotenza rete 11-14. Noi e altri 12,13,15-17 recentemente identificato un set di marcatori di superficie cellulare che consente la separazione delle rare intermedi dalla popolazione massa refrattaria. Fibroblasti embrionali di topo (MEF) Riprogrammazione subiscono cambiamenti nell&#39;espressione di Thy-1.2, Ssea1 e EpCAM (tra gli altri) durante la 2-settimane-lungo processo di riprogrammazione 15. All&#39;inizio durante la riprogrammazione di un sottoinsieme di MEF down-regolare l&#39;espressione del marcatore di identità fibroblasti (Thy-1.2) e quindi avviare esprimere il marcatore pluripotenza-associata SSEA-1 12. Durante le fasi finali di cellule Ssea1-positivi riprogrammazione Reactivmangiato geni pluripotenza endogeni, quali Oct-4 10-13,15. Questo ultimo passaggio è segnato sulla superficie cellulare mediante espressione rilevabile di EpCAM (vedi Figura 1) o in una fase successiva PECAM 15. Recentemente, O&#39;Malley et al. Ha riferito l&#39;uso di CD44 e ICAM1 come alternative o complementari a Thy-1.2 e SSEA-1 per l&#39;identificazione di intermedi di riprogrammazione. Abbiamo già FACS estratto intermedi riprogrammazione dal giorno 0, Giorno 3, Giorno 6, culture Giorno 9 e 12 ° giorno di riprogrammazione, nonché da linee di cellule iPS stabiliti sulla base di questi marcatori di superficie cellulare 15,18. Per il sistema riprogrammazione di seguito descritto e condizioni abbiamo dimostrato a livello di singola cellula che sebbene le popolazioni sono tranquillo omogenea, vi è una certa eterogeneità nelle popolazioni intermedi indicati. Va notato che solo un sottoinsieme di celle all&#39;interno di queste popolazioni sono in grado di avanzare al rispettivo sta successivoge del processo di riprogrammazione e dare origine a colonie di cellule iPS a differenti efficienze, che sono state ampiamente caratterizzate precedenza 15,19. Inoltre, l&#39;efficienza di riprogrammazione di queste popolazioni dipenderà anche dalle condizioni ri-placcatura e cultura. Per aumentare la riproducibilità sperimentale usiamo un ceppo riprogrammabile topo che è stato progettato per esprimere un transattivatore trascrizionale (m2rtTA) sotto il controllo del locus Rosa26 e una cassetta OKSM policistronica sotto il controllo di un promotore doxiciclina reattivo 20,21. Usando questo modello di topo elude gli effetti collaterali indesiderati dei metodi tradizionali virali di generazione di cellule iPS, vale a dire, una popolazione eterogenea di partenza con la cella di variabilità delle cellule in numero e l&#39;ubicazione dei siti di integrazione di inserti virali. Due ceppi di topi transgenici (OKSM, m2rtTA), disponibili come animali fondatori omozigoti presso il Jackson Laboratory, devono essere incrociati per stabilire la reprogramodello murino mmable (vedi Figura 2). In questo manoscritto viene descritto in dettaglio come derivare MEF, generare cellule iPS, e isolare gli intermedi di riprogrammazione nelle varie fasi del processo di conversione da FACS.

<table border="0" cellpadding="0" cellspacing="0" width="638">
	<tbody>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-mouse CD90.2 (Thy1.2) Pacific Blue&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-0902-82&#160;</td>
			<td style="width:64px;"></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-Human/Mouse SSEA-1 Biotin&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">13-8813&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Streptavidin PE-Cy 7&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">25-4317-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti- Mouse CD326(Epcam) Fitc&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-5791-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Sodium pyruvate&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11360-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">MEM Non-Essential Amino Acids (NEAA)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11140-050&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:212px;">Embryonic Stem Cell qualified Foetal Bovine Serum (FBS)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10439024</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Trypsin-EDTA (0.25%)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">25200-056&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">GlutaMAX</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">35050-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">&#946;-Mercaptoethanol&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">21985-023&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMSO (Dimethyl Sulfoxide)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">D8418&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Penicillin/streptomycin&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">15140</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:212px;"></td>
			<td style="width:191px;"></td>
			<td style="width:171px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Propidium Iodide solution (PI)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">P4864-10ML&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Gelatine from porcine skin&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">G1890&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Doxycyclin hyclate&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">33429-100MG-R&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Leukemia Inhibitory Factor (LIF)&#160;</td>
			<td dir="LTR" style="width:191px;">Millipore&#160;</td>
			<td dir="LTR" style="width:171px;">ESG1107&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMEM High Glucose&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11960-044&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DPBS (Dulbecco s phosphate buffer saline)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">14190-144&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">KnockOut DMEM&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10829-018&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Irradiated MEFs&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">S1520-100&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">75-cm2 Tissue culture flasks&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430641</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">15-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430791</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">50-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430829</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:191px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:171px;">201</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Cryogenic vials&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430487</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">70 &#181;m Cell strainer&#160;</td>
			<td dir="LTR" style="width:191px;">BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Taq DNA Polymerase&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10342-020&#160;</td>
			<td></td>
		</tr>
	</tbody>
</table>

cell surface marker mediated purification of ips cell intermediates from a reprogrammable mouse model

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of the body and consequently have vast potential for regenerative medicine applications. Traditionally iPS cells are generated by viral introduction of transcription factors Oct-4, Klf-4, Sox-2, and c-Myc (OKSM) into fibroblasts. However, reprogramming is an inefficient process with only 0.1-1% of cells reverting towards a pluripotent state, making it difficult to study the reprogramming mechanism. A proven methodology that has allowed the study of the reprogramming process is to separate the rare intermediates of the reaction from the refractory bulk population. In the case of mouse embryonic fibroblasts (MEFs), we and others have previously shown that reprogramming cells undergo a distinct series of changes in the expression profile of cell surface markers which can be used for the separation of these cells. During the early stages of OKSM expression successfully reprogramming cells lose fibroblast identity marker Thy-1.2 and up-regulate pluripotency associated marker Ssea-1. The final transition of a subset of Ssea-1 positive cells towards the pluripotent state is marked by the expression of Epcam during the late stages of reprogramming. Here we provide a detailed description of the methodology used to isolate reprogramming intermediates from cultures of reprogramming MEFs. In order to increase experimental reproducibility we use a reprogrammable mouse strain that has been engineered to express a transcriptional transactivator (m2rtTA) under control of the Rosa26 locus and OKSM under control of a doxycycline responsive promoter. Cells isolated from these mice are isogenic and express OKSM homogenously upon addition of doxycycline. We describe in detail the establishment of the reprogrammable mice, the derivation of MEFs, and the subsequent isolation of intermediates during reprogramming into iPS cells via fluorescent activated cells sorting (FACS).

Dopo la dissezione, disaggregazione e placcatura di un embrione di topo E13.5, un piatto di 10 cm dovrebbe raggiungere confluenza in circa 1 o 2 giorni. In questa fase, è normale che la cultura di contenere alcuni pezzi di tessuto aderenti che non sono stati cellularized correttamente. Questi scompaiono dopo passaging. Dopo induzione doxiciclina, MEF riprogrammazione subiscono cambiamenti morfologici distinti. Intorno al giorno 6, patch colonia-come primi dovrebbero cominciare ad emergere (Figura 4C). Questi continueranno a crescere in dimensioni dopo ulteriori cultura (vedi Figura 4D, E). Un esperimento buon riprogrammazione dovrebbe tradursi in&gt; 500 colonie per T75 inizialmente seminato con 5 x 10 5 cellule (Figura 4E). Culture iPS Fondata possiedono caratteristiche colonie a forma di cupola e dovrebbero essere per lo più privi di cellule differenziate (Figura 4F). Di tanto in tanto, passaging supplementare di iPS cultures possono essere tenuti a rimuovere le cellule indifferenziate / parzialmente riprogrammate; un pallone confluenti di cellule può essere suddiviso in un rapporto di 1:10 su un feeder layer di MEF irradiati. Come accennato in precedenza, i cambiamenti morfologici e molecolari durante la riprogrammazione si riflettono i cambiamenti nei profili FACS per Thy-1.2, SSEA-1 e, in definitiva EpCAM (vedere Figura 7A-F). Come riportato in precedenza 12,15, mentre il MEF sono prevalentemente positivi per Thy-1.2 e negativo per gli altri marcatori, Day 3 culture già un aspetto notevolmente diverso. Una gran parte delle cellule hanno iniziato a down-regolare l&#39;espressione di Thy-1.2 e un piccolo sottoinsieme di queste cellule negative Thy-1.2 sono diventati positivi per SSEA-1, la riprogrammazione reale intermedio per questo punto di tempo. Il numero di intermedi di riprogrammazione che possono essere estratti dal Day 3 culture è molto imprevedibile come la percentuale di SSEA-1 + / Thy-1.2- di solito si trova in un range tra il 1-10% di viablcellule e. Su Giorni 6 e 9 un aumento della percentuale di cellule SSEA-1 +, di solito ben al di sopra del 10%, può essere rilevato. Intorno al giorno 12 un sottoinsieme di SSEA-1 le cellule positive può essere rilevato che etichetta positivo anche per EpCAM. Day 12 colture, come il giorno 3 culture, rappresenta un collo di bottiglia nella purificazione degli intermedi, come la percentuale di + / EpCAM + cellule SSEA-1.2 è variabile e di solito cade nel range di solo il 2-4% di tutte le cellule vive. Il numero atteso di intermedi di riprogrammazione presentati nella tabella 1 serve solo come una rozza approssimazione. In buona fede colture di cellule iPS Fondata saranno fortemente positivo per SSEA-1 e EpCAM. <img alt="Figura 1" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig1highres.jpg" width="500" /> Figura 1 marcatori di superficie cambia durante il percorso di riprogrammazione: down-regolazione del marcatore dell&#39;identità fibroblasti Thy-1.2 è seguito da up-regolazione diSSEA-1. La transizione di un sottoinsieme di-1 SSEA cellule positive verso uno stato pluripotente è indicato da acquisizione di EpCAM intorno al giorno 12. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig1large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 2" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig2highres.jpg" width="500" /> Figura 2 Rappresentazione schematica del modello riprogrammabili topo:. Espressione m2rtTA è sotto il controllo del Rosa26 locus ubiquitariamente attivo In presenza di doxiciclina (DOX) la proteina m2rtTA si lega a una tetraciclina promotore dipendente (tetOP) al collagene 1a1 (COL1A1) locus conseguente espressione della cassetta a quattro fattori. Due cassette bicistronici sono collegati da un sito interno ingresso ribosoma (IRES). Aprire fasi di lettura per ottobre-4 / Klf-4 e Sox-2 / c-Myc sono fu<html> sed da F2A e E2A sequenze auto-cleaving rispettivamente. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig2large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 3" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig3highres.jpg" width="500" /> Figura 3 Embrione dissezione: (A) Trasferimento uterino corno in un piatto di 10 centimetri riempito con 10 ml di PBS e (B) tagliato a pezzi contenenti un embrione. (C) Utilizzando una pinza liberare gli embrioni provenienti da tessuto embrionale in più e togliere la testa, gli arti, la coda e gli organi interni. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig3large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> les / ftp_upload / 51728 / 51728fig4highres.jpg &quot;width =&quot; 500 &quot;/&gt; Patch Figura 4. cambiamenti morfologici durante la riprogrammazione. Colony-come si manifestano nelle culture dal giorno 6 in poi. IPSCs bona fide sono caratterizzate da una morfologia a forma di cupola. (A) Giorno 0 / MEF, (B) 3 ° giorno, (C) Giorno 6, (D) Giorno 9, (E) Giorno 12, (F) Ips coltura cellulare. Scala bar:. 200 micron <a href="https://www.jove.com/files/ftp_upload/51728/51728fig4large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 5" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig5highres.jpg" width="500" /> Figura 5 Configurazione di base FACS. (A) escludere residui con Side Scatter contro Forward Scatter Area macchia. (B)Escludi aggregati da non detriti da gating sulla popolazione di singola cellula con Forward Scatter Area contro Forward Scatter alta macchia. (C) Escludere le cellule morte dalla popolazione di cellule singolo di gating su PI eventi bassi con canale PI rispetto Forward Scatter Area Blot. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig5large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 6" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig6highres.jpg" width="500" /> Figura 6 gating. (A, B) Utilizzo delle cellule di controllo non marcati istituiti cancelli per Thy-1.2 + / SSEA-1-cellule, Thy-1.2- / SSEA-1-cellule e Thy-1.2- / SSEA-1 + cellule. (C) Utilizzare le cellule di controllo senza etichetta per impostare porte per le cellule positive e negative EpCAM EpCAM. (D) SSEA-1 + / Thy-1.2- cellule possono essere separatiin un EpCAM positivo e in negativo una popolazione EpCAM. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig6large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 7" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig7highres.jpg" width="500" /> Figura 7 Thy-1.2-1 contro SSEA FACS macchie nelle varie fasi del processo di riprogrammazione. (A) Giorno 0 / MEF, (B) 3 ° giorno, (C) Giorno 6, (D) Giorno 9, (E) Day 12, coltura cellulare (F) IPS. Tabella 1 suggerite densità di semina, numero pallone e risultato previsto per P1 MEF di un embrione eterozigote per OKSM e m2rtTA. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig7large.jpg" target="_blank">Cliccare h</a>ere per visualizzare una versione più grande di questa figura. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Giorno </td><td> Numero di palloni T75 seminato il giorno 0 </td><td> Numero totale di cellule Ssea1 + dopo FACS </td><td> Numero totale di Ssea1 + / EpCAM + celle dopo FACS </td></tr><tr><td> 3 </td><td> 8 </td><td> 2 milioni </td><td></td></tr><tr><td> 6 </td><td> 4 </td><td> 2 milioni </td><td></td></tr><tr><td> 9 </td><td> 4 </td><td> 2 milioni </td><td></td></tr><tr><td> 12 </td><td> 10 </td><td> 10 milioni </td><td> 2 milioni </td></tr></tbody></table>

Watch this Scientific Journal Video about Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model at JoVE.com

Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam.

Marker cellulare superficiale Purificazione mediata di cellule iPS intermedi da un modello riprogrammabile mouse

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of ...

cell-surface-marker-mediated-purification-ips-cell-intermediates-from

Research

JoVE Journal

Biology

12.2K Views.  Monash University. Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam. 

Video: Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Chromatographic Purification of Highly Active Yeast Ribosomes

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes.

Contamination of preparations of eukaryotic ribosomes purified by traditional methods by co-purifying nucleases and proteases negatively impacts on downstream biochemical and structural analyses. A rapid and simple chromatographic purification method is used to solve this problem using yeast ribosomes as a model system.

Purificazione cromatografica dei ribosomi di lievito Highly Active

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers.  ...

Ricerca

Biologia

Isolation and Purification of Kinesin from Drosophila Embryos

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a variety of neurodegenerative diseases, understanding microtubule based motor transport and its regulation will likely ultimately lead to improved therapeutic approaches. Kinesin-1 is a eukaryotic motor protein which moves in an anterograde (plus-end) direction along microtubules (MTs), powered by ATP hydrolysis. Here we report a detailed purification protocol to isolate active full length kinesin from Drosophila embryos, thus allowing the combination of Drosophila genetics with single-molecule biophysical studies. Starting with approximately 50 laying cups, with approximately 1000 females per cup, we carried out overnight collections. This provided approximately 10 ml of packed embryos. The embryos were bleach dechorionated (yielding approximately 9 grams of embryos), and then homogenized. After disruption, the homogenate was clarified using a low speed spin followed by a high speed centrifugation. The clarified supernatant was treated with GTP and taxol to polymerize MTs. Kinesin was immobilized on polymerized MTs by adding the ATP analog, 5'-adenylyl imidodiphosphate at room temperature. After kinesin binding, microtubules were sedimented via high speed centrifugation through a sucrose cushion. The microtubule pellet was then re-suspended, and this process was repeated. Finally, ATP was added to release the kinesin from the MTs. High speed centrifugation then spun down the MTs, leaving the kinesin in the supernatant. This kinesin was subjected to a centrifugal filtration using a 100 KD cut off filter for further purification, aliquoted, snap frozen in liquid nitrogen, and stored at -80 &deg;C. SDS gel electrophoresis and western blotting was performed using the purified sample. The motor activity of purified samples before and after the final centrifugal filtration step was evaluated using an in vitro single molecule microtubule assay. The kinesin fractions before and after the centrifugal filtration showed processivity as previously reported in literature. Further experiments are underway to evaluate the interaction between kinesin and other transport related proteins.

Isolation and Purification of Kinesin from Drosophila Embryos

This is a protocol to isolate active full length Kinesin from Drosophila embryos for single-molecule biophysical studies. We show how to collect embryos, make the embryo lysate, and then polymerize microtubules (MTs). Kinesin is purified by immobilizing it on the MTs, spinning down the Kinesin-MT complexes, and then releasing the kinesin from the MTs via ATP addition.

Isolamento e purificazione di chinesina dal Drosophila Embrioni

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a ...

Avidity-based Extracellular Interaction Screening (AVEXIS) for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ensuring cohesion within multicellular organisms. Proteins predicted to form extracellular interactions are encoded by approximately a quarter of human genes1, but despite their importance and abundance, the majority of these proteins have no documented binding partner. Primarily, this is due to their biochemical intractability: membrane-embedded proteins are difficult to solubilise in their native conformation and contain structurally-important posttranslational modifications. Also, the interaction affinities between receptor proteins are often characterised by extremely low interaction strengths (half-lives &lt; 1 second) precluding their detection with many commonly-used high throughput methods2. 
Here, we describe an assay, AVEXIS (AVidity-based EXtracellular Interaction Screen) that overcomes these technical challenges enabling the detection of very weak protein interactions (t1/2 &le; 0.1 sec) with a low false positive rate3. The assay is usually implemented in a high throughput format to enable the systematic screening of many thousands of interactions in a convenient microtitre plate format (Fig. 1). It relies on the production of soluble recombinant protein libraries that contain the ectodomain fragments of cell surface receptors or secreted proteins within which to screen for interactions; therefore, this approach is suitable for type I, type II, GPI-linked cell surface receptors and secreted proteins but not for multipass membrane proteins such as ion channels or transporters.
The recombinant protein libraries are produced using a convenient and high-level mammalian expression system4, to ensure that important posttranslational modifications such as glycosylation and disulphide bonds are added. Expressed recombinant proteins are secreted into the medium and produced in two forms: a biotinylated bait which can be captured on a streptavidin-coated solid phase suitable for screening, and a pentamerised enzyme-tagged (&beta;-lactamase) prey. The bait and prey proteins are presented to each other in a binary fashion to detect direct interactions between them, similar to a conventional ELISA (Fig. 1). The pentamerisation of the proteins in the prey is achieved through a peptide sequence from the cartilage oligomeric matrix protein (COMP) and increases the local concentration of the ectodomains thereby providing significant avidity gains to enable even very transient interactions to be detected. By normalising the activities of both the bait and prey to predetermined levels prior to screening, we have shown that interactions having monomeric half-lives of 0.1 sec can be detected with low false positive rates3.

Avidity-based Extracellular Interaction Screening AVEXIS for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

AVEXIS is a high throughput protein interaction assay developed to systematically screen for novel extracellular receptor-ligand pairs involved in cellular recognition processes. It is specifically designed to detect transient protein interactions that are difficult to identify using other high throughput approaches.

Avidità-based Screening Interaction extracellulare (AVEXIS) per il rilevamento scalabile di bassa affinità extracellulare del recettore-ligando interazioni

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

Generazione di topi derivati ​​da cellule staminali pluripotenti indotte

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

MicroRNA Expression Profiles of Human iPS Cells, Retinal Pigment Epithelium Derived From iPS, and Fetal Retinal Pigment Epithelium

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human iPS cells (iPS-RPE), and fetal RPE. The protocols include collection of RNA for analysis by microarray, and the analysis of microarray data to identify miRNAs that are differentially expressed among three cell types. The methods for culture of iPS cells and fetal RPE are explained. The protocol used for differentiation of RPE from human iPS is also described. The RNA extraction technique we describe was selected to allow maximal recovery of very small RNA for use in a miRNA microarray. Finally, cellular pathway and network analysis of microarray data is explained. These techniques will facilitate the comparison of the miRNA profiles of three different cell types.

The microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human induced-pluripotent stem (iPS) cells (iPS-RPE), and fetal RPE, were compared.

MicroRNA Expression Profili di cellule iPS umane, dell&#39;epitelio pigmentato retinico derivate da iPS, e fetale dell&#39;epitelio pigmentato retinico

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

Generazione efficiente delle cellule iPS da Blood Utilizzando episomi e HDAC inibitori

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Trans-inner Cell Mass Injection of Embryonic Stem Cells Leads to Higher Chimerism Rates

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current blastocyst injection protocol. Here we report that a simple rotation of the embryo, and injection through Trans-Inner cell mass (TICM) increased the percentage of chimeric mice from 31% to 50%, with no additional equipment or further specialized training. 26 different inbred clones, and 35 total clones were injected over a period of 9 months. There was no significant difference in either pregnancy rate or recovery rate of embryos between traditional injection techniques and TICM. Therefore, without any major alteration in the injection process and a simple positioning of the blastocyst and injecting through the ICM, releasing the ES cells into the blastocoel cavity can potentially improve the quantity of chimeric production and subsequent germline transmission.

Here we present a protocol to increase chimera production without the use of new equipment. A simple orientation change of the embryo for injection can increase the number of embryos produced, and potentially reduce the timeline to germline transmission.

Trans-inner Cell Mass iniezione delle cellule staminali embrionali porta a tassi più elevati di chimerismo

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current ...

Primary Cell Cultures from the Mouse Retinal Pigment Epithelium

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the eye. It is a single sheet of pigmented cells that are hexagonally packed and connected by tight junctions. The main functions of the RPE include absorption of light, phagocytosis of the shed photoreceptor outer segments, spatial buffering of ions, transport of nutrients, ions and water as well as active involvement in the visual cycle. With such important and diverse functions, it is critically important to study the biology of RPE cells. A number of RPE cell lines have been established; however, passaged and immortalized cells are known to quickly lose some of the morphological and physiological characteristics of natural RPE cells. Thus, primary cells are more suitable for studying different aspects of RPE cell biology and function. Mouse primary RPE cell culture is very useful to researchers since mouse models are widely used in biological studies, however collecting RPE cells from mouse is also very challenging due to their small size. Here, we present a protocol for establishing primary mouse RPE cell cultures which includes enucleation and dissection of the eyes and isolation of the RPE sheets to yield the cells for culturing. This method enables efficient cell recovery. The RPE cells obtained from two mice&#160;can reach confluency on one 12 mm polyester membrane insert pre-loaded in culture plate after one week of culture and display some of the original properties of bona fide RPE cells such as hexagonal shape and pigmentation after two weeks of culture.

The retinal pigment epithelium (RPE) is a multi-functional epithelium of the eye. Here we present a protocol to establish primary cell cultures derived from the murine RPE.

Colture cellulari primarie dall'epitelio retinico del pigmento del Mouse

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the ...

Visualization and Quantification of Mesenchymal Cell Adipogenic Differentiation Potential with a Lineage Specific Marker

Several dyes are currently available for use in detecting differentiation of mesenchymal cells into adipocytes. Dyes, such as Oil Red O, are cheap, easy to use and widely utilized by laboratories analyzing the adipogenic potential of mesenchymal cells. However, they are not specific to changes in gene transcription. We have developed a gene-specific differentiation assay to analyze when a mesenchymal cell has switched its fate to an adipogenic lineage. Immuno-labelling against fatty acid binding protein-4 (FABP4), a lineage-specific marker of adipogenic differentiation, enabled visualization and quantification of differentiated cells. The ability to quantify adipogenic differentiation potential of mesenchymal cells in a 96 well microplate format has promising implications for a number of applications. Hundreds of clinical trials involve the use of adult mesenchymal stromal cells and it is currently difficult to correlate therapeutic outcomes within and especially between such clinical trials. This simple high-throughput FABP4 assay provides a quantitative assay for assessing the differentiation potential of patient-derived cells and is a robust tool for comparing different isolation and expansion methods. This is particularly important given the increasing recognition of the heterogeneity of the cells being administered to patients in mesenchymal cell products. The assay also has potential utility in high throughput drug screening, particularly in obesity and pre-diabetes research.

Traditional methods of assessing adipogenic differentiation are cheap and easy to use, but are not specific to changes in gene expression. We have developed an assay to quantify mesenchymal cell differentiation into mature adipocytes using a lineage specific marker. This assay has diverse applications across basic research and clinical medicine.

Visualizzazione e quantificazione del potenziale di differenziazione delle cellule mesenchimali adipogenico con un Marker specifico lignaggio

Several dyes are currently available for use in detecting differentiation of mesenchymal cells into adipocytes. Dyes, such as Oil Red O, are cheap, easy ...

A Mouse Model of Intestinal Partial Obstruction

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including tumorous growths. However, the cellular remodeling mechanisms involved in, and caused by, intestinal obstructions are poorly understood. Several animal models of intestinal obstructions have been developed, but the mouse model is the most cost/time effective. The mouse model uses the surgical implantation of an intestinal partial obstruction (PO) that has a high mortality rate if it is not performed correctly. In addition, mice receiving PO surgery fail to develop hypertrophy if an appropriate blockade is not used or not properly placed. Here, we describe a detailed protocol for PO surgery which produces reliable and reproducible intestinal obstructions with a very low mortality rate. This protocol utilizes a surgically placed silicone ring that surrounds the ileum which partially blocks digestive movement in the small intestine. The partial blockage makes the intestine become dilated due to the halt of digestive movement. The dilation of the intestine induces smooth muscle hypertrophy on the oral side of the ring that progressively develops over 2 weeks until it causes death. The surgical PO mouse model offers an in vivo model of hypertrophic intestinal tissue useful for studying pathological changes of intestinal cells including smooth muscle cells (SMC), interstitial cells of Cajal (ICC), PDGFR&#945;+, and neuronal cells during the development of intestinal obstruction.

Intestinal obstructions are a partial or complete blockage of the intestine that can cause severe abdominal pain, nausea, vomiting, and preventing the passage of stool. This procedure for creating intestinal partial obsructions in mice is reliable in studying the mechanisms underlying pathological cell growth and death in the intestine.

Un modello murino di ostruzione intestinale parziale

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including ...