Gli autori riconoscono il Robert W. Deutsch Fondazione, la Defense Threat Reduction Agency (DTRA), e la National Science Foundation Emerging frontiere della ricerca e innovazione (EFRI) per il sostegno finanziario. Gli autori ringraziano anche il Maryland Nanocenter e il suo Fablab per il supporto impianto di camera bianca.

1 Microfabbricazione del Microfluidic Chip <ol><li> Preparare elettrochimica Chip <ol><li> Modello Oro Elettrodi <ol><li> Risciacquare un vuoto 4 &#39;&#39; wafer di silicio (qualità di prima qualità) con acetone, metanolo e isopropanolo (&quot;AMI&quot; clean). Sciacquare il isopropanolo dal wafer con acqua deionizzata (DI), seguita da asciugatura con N 2 pistola. </li><li> Crescere uno spesso strato di SiO 2 1 micron con passivazione chimica da fase vapore deposizione al plasma (PECVD) strumento. Depositare uno strato spesso 200 di cromo seguito da uno strato spesso un 2000 d&#39;oro con uno strumento di sputtering DC. </li><li> Spin &quot;PR1&quot; photoresist positivo (parametri di filatura: 3.000 rpm, 1000 rpm / sec, 30 sec) per creare pellicola uniforme ~ 1.6 micron di spessore. Pre-cuocere il wafer per 1 min a 100 ° C su una piastra calda. </li><li> Esporre la cialda con 190 mJ / cm 2 a 405 nm di lunghezza d&#39;onda attraverso un fotomaschera. Sviluppare il wafer per 30 sec a 352 developer e sciacquare la cialda con DI e asciugare con N 2 pistola. </li><li> Etch l&#39;oro con oro mordenzante per 1,5 min. Etch cromo cromo mordenzante per ~ 30 sec. Sciacquare il wafer con DI e asciugare con N 2 pistola. </li><li> Striscia il photoresist con &quot;AMI&quot; procedura di pulizia. NOTA: OSSIDANTE FORTE E POTENZIALMENTE ESPLOSIVA. </li><li> Pulire la cialda con 4: 1 H 2 SO 4: H 2 O 2 miscela (&quot;Piranha&quot; clean) per 1 min. Sciacquare il wafer con DI e asciugare con N 2 pistola. </li></ol></li><li> Modello Platinum Elettrodi <ol><li> Spin &quot;Pr2&quot; photoresist positivo (parametri di filatura: 3.000 rpm, 1000 rpm / sec, 30 sec) per creare pellicola uniforme ~ 1.4 micron di spessore. Pre-cuocere il wafer per 1 min a 100 ° C su una piastra calda. </li><li> Esporre la cialda con il 30 mJ / cm 2 a 405 nm di lunghezza d&#39;onda attraverso un fotomaschera. Cuocere il wafer per 45 sec a 125 ° C su una piastra calda. Flood esporreil wafer con 1.000 mJ / cm 2 a 405 nm senza fotomaschera. Sviluppare il wafer per 2 min a 6: 1 sviluppatore AZ400K e sciacquare la cialda con DI e asciugare con N 2 pistola. </li><li> Depositare uno strato dello spessore di 400 Å di titanio seguito da uno strato di spessore 1,600 Å di platino mediante un sistema di evaporazione e-beam. </li><li> Sollevare fotoresist in un bagno di acetone ultrasonicated per 5 minuti seguita da risciacquo con acetone e isopropanolo. Sciacquare il wafer con DI e asciugare con N 2 pistola. </li></ol></li></ol></li><li> Preparare Canali Assay <ol><li> Preparare Stampo per canali Assay <ol><li> Risciacquare un vuoto 4 &#39;&#39; wafer di silicio (grade qualità test) con &quot;AMI&quot; procedura di pulizia. Sciacquare il isopropanolo dal wafer con DI seguita da asciugatura con N 2 pistola. </li><li> Spin &quot;PR3&quot; photoresist negativo (parametri di filatura 2-step:. Passo uno - 600 rpm, 120 rpm / sec, 10 sec Fase due - 1.150 rpm, 383 rpm / sec,27 sec) per creare pellicola uniforme ~ 100 micron di spessore. Pre-cuocere la cialda su una piastra calda (parametri di cottura 2-step:. Passo uno - rampa da temperatura ambiente a 65 ° C a 300 ° C / ora e mantenere la temperatura per 10 min Fase 2 - rampa fino a 95 ° C a 300 ° C / ora e la temperatura attesa per 30 min). </li><li> Esporre la cialda con 2.500 mJ / cm 2 a 405 nm di lunghezza d&#39;onda attraverso un fotomaschera. Post-cuocere il wafer da rampa fino a 95 ° C a 300 ° C / ora e mantenere la temperatura per 10 minuti su un piatto caldo. Sviluppare il wafer per 10 min in glicole propilenico MONOMETILETERE Acetato (PGMEA) sviluppatore. Sciacquare il wafer con isopropanolo e asciugare con N 2 pistola. </li></ol></li><li> Realizzare Canali Assay <ol><li> Preparare 10: 1 polidimetilsilossano (PDMS) miscela (20 g di elastomero, 2 g di induritore) e completamente degassamento in una camera a vuoto per 20 min. </li><li> Definire un recinto attorno alla cialda stampo con un foglio di alluminio e versare lentamente la polimerizzato PDMSsopra lo stampo. </li><li> Cuocere lo stampo con il PDMS in un forno scatola (parametri di cottura 2-step:. Passo uno - 5 min rampa da temperatura ambiente a 80 ° C Fase 2 - tenere a 80 ° C per 17 min). </li><li> Togliete la PDMS dallo stampo e posto su un foglio di alluminio. Tagliare i chip di analisi con un coltello chirurgo, definire fori con uno strumento di biopsia di punzonatura. </li></ol></li></ol></li></ol> 2 Montare il dispositivo <ol><li> Allineare manualmente i canali test PDMS con gli elettrodi di lavoro sul chip elettrochimica. PDMS aderire bene al chip elettrochimica, sigillando i canali e prevenire perdite. </li><li> Collegare un tubo flessibile (OD 0,087 &#39;&#39; e ID 0,015 &#39;&#39;) per un gomito di plastica o connettore diritto con un breve tubo flessibile come un adattatore (OD 0,1875 &#39;&#39; e ID 0,0625 &#39;&#39;). Collegare i connettori a ciascuna delle bocche-forati nel dispositivo. </li><li> Collegare una siringa all&#39;altra estremità delil tubo e posizionare la siringa in una pompa a siringa. In alternativa modificare il set di una siringa, un tubo, e un connettore in base alla fase di procedura necessaria nella sezione 3 e la sua soluzione corrispondente. </li></ol> 3 Analizzare Ibridazione DNA NOTA: Introdurre ciascuna soluzione lentamente nel canale ad una portata di 200 l / h fino a quando l&#39;intero canale è riempito. <ol><li> Funzionalizzare ogni microcanali verticale con una differente sequenza di sonda ssDNA (eseguire in parallelo ai 3 microcanali verticali separate): <ol><li> Riempire ogni microcanali con una diversa soluzione della sonda di incubazione ssDNA (tampone fosfato 10 mM, NaCl 100 mM, 10 mM tris (2-carbossietil) fosfina (TCEP), e 1 mM sonda ssDNA), e incubare per 1 ora, seguito da risciacquo del microcanali con PBS. </li><li> Riempire i microcanali con una soluzione contenente 1 mM di 6-mercapto-1-esanolo (MCH) in tampone di PBS 10 mM, NaCl 100 mM e 1.395 TCEP mM, e incubate per 1 ora seguita dal risciacquo del microcanali con PBS. </li></ol></li><li> Sollevare il PDMS, ruotare di 90 ° a un orientamento orizzontale, e mettere giù per esporre righe separate di camere di reazione con ciascuna riga contenente un contatore unico ed elettrodo di riferimento (Figura S1). </li><li> Compila i microcanali con una soluzione di misurazione di controllo di 4x concentrati citrato salina-sodio (SSC) del buffer e incubare per 20 min. </li><li> Misurazione del fondo: Compilare i microcanali con 5 mM ferricianuro / 5 mM ferrocianuro in soluzione PBS e registrare i valori di impedenza del sistema elettrochimico per diverse frequenze (spettroscopia di impedenza elettrochimica; EIS) con un potenziostato collegato al lavoro, bancone, e gli elettrodi di riferimento ( EIS parametri: gamma di frequenza da 1 MHz a 0.1 Hz, 10 punti dati di frequenza per ogni decennio, 25 mV di ampiezza, 5 mV polarizzazione contro l&#39;elettrodo di riferimento). Ripetere questa misura per ogni elettrodo lavoro nei microcanali. </li&gt; <li> Misurare ibridazione DNA (eseguire per ogni target ssDNA non-complementari e complementare). <ol><li> Riempire i microcanali con destinazione soluzione di misura ssDNA di 4x concentrato tampone SSC contenente 1 mM del target ssDNA, e incubare per 20 min. Misurare il DNA secondo al punto 3.4. </li></ol></li></ol>

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

Gli autori non hanno nulla da rivelare.

Le nostre procedure dimostrano la fabbricazione di un biochip elettrochimica basata microfluidica e il suo utilizzo per l&#39;analisi di eventi di ibridazione del DNA. Attraverso un processo di microfabbricazione alta resa controllata sviluppiamo un dispositivo costituito da canali microscala, integrato con un insieme di trasduttori elettrochimici. Abbiamo ideato parametri di elaborazione controllate per la procedura di fotolitografia del chip elettrochimica e lo stampo canale microfluidica attraverso un approccio itera...

Lab-on-a-chip microfluidica (LOC) dispositivi offrono numerosi vantaggi in diagnostica clinica, il monitoraggio ambientale e la ricerca biomedica. Questi dispositivi utilizzano canali microfluidici per controllare il flusso del fluido alle regioni del chip dove una varietà di procedure può avvenire compresa la miscelazione dei reagenti, affinità di base vincolante, trasduzione del segnale, e la cella coltura 1-4. Microfluidica offre molti vantaggi rispetto ai tradizionali strumenti diagnostici clinici, quali lettori di piastra Elisa o elettroforetica saggi di gel shift. Dispositivi microfluidici richiedono 2 o 3 ordini di grandezza (nanolitri al contrario di microlitri) minor numero di reagenti per eseguire test simili. Inoltre, questi dispositivi possono aumentare la velocità con cui alcuni eventi biologici si verificano a causa del confinamento più piccolo della specie all&#39;interno dei canali 5,6. In terzo luogo, i sensori possono essere integrati all&#39;interno di dispositivi microfluidici che utilizzano tecniche di litografia e incisione, che possono fornire detectio senza etichettan. Infine, questi dispositivi sono poco costosi da produrre e richiedono poco lavoro da parte del tecnico di operare 7-10. Rilevamento libero-Label in genere viene eseguita utilizzando un trasduttore ottico o elettrico. Dispositivi ottici possono presentare migliori prestazioni di rilevamento a causa della minore interferenza con analiti nel campione. Tuttavia, le loro prestazioni è compromessa nel caso in cui lo sfondo del campione ha la stessa lunghezza d&#39;onda di risonanza del sensore 11. Ci sono molti vantaggi di utilizzare segnali elettrici per eseguire il rilevamento biologico e chimico in sistemi microfluidici. La fabbricazione è intrinsecamente meno complicata dato che questi sensori in genere richiedono solo elettrodi fantasia per operare. Inoltre, i segnali elettrici possono essere interfacciati direttamente con la maggior parte delle apparecchiature di misura, mentre altre modalità di segnalazione possono richiedere un trasduttore per convertire il segnale 12-15. Sensori elettrici comunemente misurano variazioni di impedance 16,17, capacità 18, o redox di attività 19. Tuttavia, le nuove sfide che si presentano come tali sistemi sono miniaturizzati. Le sfide più importanti da superare comprendono: preparazione del campione e la miscelazione dei fluidi (a causa del basso volume del campione e il numero di Reynolds), effetti fisici e chimici (tra cui forze capillari, rugosità superficiale, le interazioni chimiche tra i materiali da costruzione e di analiti), basso rapporto segnale a-rumore (prodotto dalla zona ridotta superficie e di volume) 20-23, e il potenziale interferenza da analiti elettro-attivi in campioni biologici complessi (ad esempio, sangue e saliva). Ulteriori analisi di questi effetti si tradurrà in linee guida per una realizzazione accurata e il funzionamento di questi dispositivi in ​​modo riproducibile che potrebbero migliorare la loro performance complessiva. Rilevazione ibridazione DNA è ampiamente utilizzato per diagnosticare malattie genetiche 24,25 e varie forme di cancer 26. Ogni anno, più ceppi di influenza sono identificati nei pazienti che utilizzano i risultati di tecniche di ibridazione del DNA 27. Il virus dell&#39;influenza da solo incide per 36.000 morti ogni anno negli Stati Uniti 28. Tali esempi potrebbero beneficiare di un dispositivo da banco microfluidica in grado di eseguire le stesse tecniche di analisi come un lettore di piastre o gel shift assay con basso volume del campione e ad una frazione del costo senza sacrificare la sensibilità o la specificità. A causa dei numerosi vantaggi del libero-label rilevamento elettrochimico, è stato ampiamente utilizzato per il rilevamento di eventi di ibridazione DNA 29,30. Una configurazione in cui gli elettrodi macro-scala (nella gamma millimetro) sono immersi in bicchieri con la soluzione di interesse può essere utilizzato per fornire dati molto sensibili riguardanti la cinetica di legame delle singole sequenze di DNA non recuperabili alle loro sequenze complementari corrispondenti. Recentemente, ci sono stati alcuni progressi nella incorporando rilevamento elettrochimico in microfluidics per ibridazione DNA. Gli studi sono stati condotti per quanto riguarda la cinetica di ibridazione 31 e l&#39;integrazione di sensori per il rilevamento a 15 canali microfluidici. Tuttavia, esiste ancora la necessità di un rapido throughput elevato dispositivo di microfluidica in grado di analizzare gli eventi di ibridazione DNA in parallelo senza complicate fasi di preparazione del campione. Il dispositivo presentato in questo lavoro fornisce una piattaforma che permette molteplici interazioni siano proiettati in parallelo e senza complicate fasi di preparazione del campione. Il nostro protocollo presenta come microfluidica basata biochip elettrochimici sono microfabbricati con sistemi micro-elettromeccanici (MEMS), la tecnologia 32,33. Descriviamo il processo di fabbricazione sia del chip microfluidico, fatta di polidimetilsilossano (PDMS), e il chip elettrochimica, costituito da una matrice di elettrodi. La funzionalizzazione chimica del biochip con sonde ssDNA si rivolge anche. Infine, il Abillità del biosensore per rilevare in modo specifico e analizzare obiettivi ssDNA è dimostrata. Nel complesso, il biochip elettrochimica basata microfluidica-è una tecnica rapida e di analisi high-throughput. Può essere usato per studiare le interazioni tra le molecole biologiche e trasduttori di conduzione, e può essere utilizzata in una varietà di applicazioni lab-on-a-chip.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:155px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Material</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4&#39;&#39; Silicon wafer</td>
			<td style="width:155px;">Ultrasil</td>
			<td style="width:227px;">4-5664</td>
			<td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Shipley 1813 photoresist (&#34;PR1&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">AZ5214 photoresist (&#34;PR2&#34;)</td>
			<td style="width:155px;">Hoechst Celanse</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SU-8 50 photoresist (&#34;PR3&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">negative photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">TFA</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chromium etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">1020AC</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS elastomer</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097366 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS curing agent</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097358 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Biopsy punching tool</td>
			<td style="width:155px;">Healthlink</td>
			<td style="width:227px;">BP20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible tubing</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">R 3603</td>
			<td>.015&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible adapter</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">06417-41</td>
			<td>.0625&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">1 mL syringe</td>
			<td style="width:155px;">Beckton-Dickenson</td>
			<td align="right" style="width:227px;">301025</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monobasic potassium phosphate</td>
			<td style="width:155px;">Fluka</td>
			<td align="right" style="width:227px;">1551139</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium phosphate dibasic anhydrous</td>
			<td style="width:155px;">Sigma</td>
			<td style="width:227px;">RES20765-A7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium chloride</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:227px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">tris(2-carboxyethyl)phosphine</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">C4706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">6-mercapto-1-hexanol</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">451088</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">20x concentrated saline-sodium citrate buffer</td>
			<td style="width:155px;">Sigma</td>
			<td align="right" style="width:227px;">93017</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium hexacyanoferrate(III)</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">455946</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium ferrocyanide</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">CDS001589</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG 
			TGGACGTCCC-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-GGGACGTCCACGGAGCGCTA 
			TCGGAGCTTT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA 
			ATCGATGAGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-ACTCATCGATTCGTCAATGA 
			CCTGACCCGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA 
			CCCATGATGA-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-TCATCATGGGTCTAACTACT 
			GGATCTAGGT-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Instrument</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Plasma Enhanced Chemical Vapor Deposition (PECVD)</td>
			<td style="width:155px;">Oxford Instruments</td>
			<td style="width:227px;">PlasmaLab System 100</td>
			<td>Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DC sputtering unit</td>
			<td style="width:155px;">AJA International</td>
			<td style="width:227px;">ATC 1800-V</td>
			<td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">E-beam evaporation system</td>
			<td style="width:155px;">Denton</td>
			<td style="width:227px;">Custom-built</td>
			<td>For Titanium: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Potentiostat</td>
			<td style="width:155px;">CH Instruments</td>
			<td style="width:227px;">660D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Syringe pump</td>
			<td style="width:155px;">KD Scientific</td>
			<td style="width:227px;">KDS230</td>
			<td></td>
		</tr>
	</tbody>
</table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

La miniaturizzazione delle procedure analitiche da banco in micro-scala offre vantaggi significativi per quanto riguarda il tempo di reazione, costi, e l&#39;integrazione delle fasi di pre-elaborazione. Utilizzando questi dispositivi verso l&#39;analisi degli eventi di ibridazione del DNA è importante perché offre una tecnologia per la valutazione in tempo reale dei biomarcatori presso il punto di cura per varie malattie. Tuttavia, quando l&#39;impronta dispositivo diminuisce il dominio di vari aumenti di fenomeni fisici. Questi fenomeni influenzano la precisione di fabbricazione e l&#39;affidabilità di funzionamento del dispositivo. Pertanto, vi è una grande necessità di fabbricare accuratamente e farli funzionare in modo riproducibile al fine di migliorare le prestazioni complessive. Qui, descriviamo i protocolli ei metodi utilizzati per la fabbricazione e il funzionamento di un biochip elettrochimica microfluidica-based per l&#39;analisi accurata di eventi di ibridazione DNA. Il biochip è composto di due parti: un chip microfluidica contre micro-canali paralleli fatti di polidimetilsilossano (PDMS), e un Arrayed microchip elettrochimica 3 x 3. Gli eventi di ibridazione DNA vengono rilevati mediante spettroscopia di impedenza elettrochimica (EIS) analisi. L&#39;analisi EIS consente variazioni di monitoraggio delle proprietà del sistema elettrochimico che sono dominanti in queste scale di lunghezza. Con la possibilità di monitorare le variazioni sia di trasferimento di carica e la resistenza diffusionale con il biosensore, dimostriamo la selettività di obiettivi ssDNA complementari, un limite di rilevazione calcolato di 3,8 nM, ed una cross-reattività 13% con altri ssDNA non complementare dopo 20 min di incubazione. Questa metodologia può migliorare le prestazioni dei dispositivi miniaturizzati da chiarire sul comportamento di diffusione al regime micro-scala e consentendo lo studio di eventi di ibridazione DNA.

Un controllabile e accurato processo di fabbricazione per il dispositivo sperimentale è essenziale nella ricerca. Esso consente ai ricercatori di ottenere esperimenti riproducibili e di throughput elevati. Qui abbiamo dimostrato un rendimento elevato, processo microfabbricazione alta riproducibilità di un biochip elettrochimica microfluidica-based (Figura 1). Con un tasso di fallimento basso, pochi dispositivi hanno mostrato problemi di incollaggio che portano a perdite di soluzione. Al fine di valida...

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Vi presentiamo un biochip elettrochimico basato microfluidica-per la rilevazione ibridazione DNA. A seguito di ssDNA sonda funzionalizzazione, la specificità, sensibilità, e il limite di rilevazione sono studiati con obiettivi ssDNA complementari e non complementari. I risultati illustrano l&#39;influenza degli eventi di ibridazione DNA sul sistema elettrochimico, con un limite di rilevazione di 3,8 nM.

Un Biochip elettrochimica Microfluidic-based per la libera-Label Ibridazione DNA Analysis

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

a-microfluidic-based-electrochemical-biochip-for-label-free-dna

Research

JoVE Journal

Bioengineering

17.0K Views.  University of Maryland.  Vi presentiamo un biochip elettrochimico basato microfluidica-per la rilevazione ibridazione DNA. A seguito di ssDNA sonda funzionalizzazione, la specificità, sensibilità, e il limite di rilevazione sono studiati con obiettivi ssDNA complementari e non complementari. I risultati illustrano l'influenza degli eventi di ibridazione DNA sul sistema elettrochimico, con un limite di rilevazione di 3,8 nM. 

Video: A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

A Microfluidic-based Hydrodynamic Trap for Single Particles

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science. Methods for particle trapping based on optical, magnetic, electrokinetic, and acoustic techniques have led to major advancements in physics and biology ranging from the molecular to cellular level. In this article, we introduce a new microfluidic-based technique for particle trapping and manipulation based solely on hydrodynamic fluid flow. Using this method, we demonstrate trapping of micro- and nano-scale particles in aqueous solutions for long time scales. The hydrodynamic trap consists of an integrated microfluidic device with a cross-slot channel geometry where two opposing laminar streams converge, thereby generating a planar extensional flow with a fluid stagnation point (zero-velocity point). In this device, particles are confined at the trap center by active control of the flow field to maintain particle position at the fluid stagnation point. In this manner, particles are effectively trapped in free solution using a feedback control algorithm implemented with a custom-built LabVIEW code. The control algorithm consists of image acquisition for a particle in the microfluidic device, followed by particle tracking, determination of particle centroid position, and active adjustment of fluid flow by regulating the pressure applied to an on-chip pneumatic valve using a pressure regulator. In this way, the on-chip dynamic metering valve functions to regulate the relative flow rates in the outlet channels, thereby enabling fine-scale control of stagnation point position and particle trapping. The microfluidic-based hydrodynamic trap exhibits several advantages as a method for particle trapping. Hydrodynamic trapping is possible for any arbitrary particle without specific requirements on the physical or chemical properties of the trapped object. In addition, hydrodynamic trapping enables confinement of a "single" target object in concentrated or crowded particle suspensions, which is difficult using alternative force field-based trapping methods. The hydrodynamic trap is user-friendly, straightforward to implement and may be added to existing microfluidic devices to facilitate trapping and long-time analysis of particles. Overall, the hydrodynamic trap is a new platform for confinement, micromanipulation, and observation of particles without surface immobilization and eliminates the need for potentially perturbative optical, magnetic, and electric fields in the free-solution trapping of small particles.

In this article, we present a microfluidic-based method for particle confinement based on hydrodynamic flow. We demonstrate stable particle trapping at a fluid stagnation point using a feedback control mechanism, thereby enabling confinement and micromanipulation of arbitrary particles in an integrated microdevice.

Un Microfluidic basato Trappola idrodinamico per particelle singole

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Ricerca

Bioingegneria

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

Fabbricazione di elettrochimica-DNA biosensori per il rilevamento Reagentless di acidi nucleici, proteine ​​e piccole molecole

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Non-contact, Label-free Monitoring of Cells and Extracellular Matrix using Raman Spectroscopy

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, currently available routine methods require processing steps and alter sample integrity. Raman spectroscopy is a fast method that enables the measurement of biological samples without the need for further processing steps. This laser-based technology detects the inelastic scattering of monochromatic light.6 As every chemical vibration is assigned to a specific Raman band (wavenumber in cm-1), each biological sample features a typical spectral pattern due to their inherent biochemical composition.7-9 Within Raman spectra, the peak intensities correlate with the amount of the present molecular bonds.1 Similarities and differences of the spectral data sets can be detected by employing a multivariate analysis (e.g. principal component analysis (PCA)).10
Here, we perform Raman spectroscopy of living cells and native tissues. Cells are either seeded on glass bottom dishes or kept in suspension under normal cell culture conditions (37 &deg;C, 5% CO2) before measurement. Native tissues are dissected and stored in phosphate buffered saline (PBS) at 4 &deg;C prior measurements. Depending on our experimental set up, we then either focused on the cell nucleus or extracellular matrix (ECM) proteins such as elastin and collagen. For all studies, a minimum of 30 cells or 30 random points of interest within the ECM are measured. Data processing steps included background subtraction and normalization.

Raman spectroscopy is a suitable technique for the non-contact, label-free analysis of living cells, tissue-engineered constructs and native tissues. Source-specific spectral fingerprints can be generated and analyzed using multivariate analysis.

Senza contatto, Label-free monitoraggio delle cellule e matrice extracellulare mediante Spettroscopia Raman

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals suffering from chronic medical conditions facile assessment of their immediate physiological state. Furthermore, it could serve as a research tool for analysis of complex, multifactorial medical conditions. In order for such a multianalyte sensor to be realized, it must be minimally invasive, sampling of interstitial fluid must occur without pain or harm to the user, and analysis must be rapid as well as selective.
Initially developed for pain-free drug delivery, microneedles have been used to deliver vaccines and pharmacologic agents (e.g., insulin) through the skin.1-2 Since these devices access the interstitial space, microneedles that are integrated with microelectrodes can be used as transdermal electrochemical sensors. Selective detection of glucose, glutamate, lactate, hydrogen peroxide, and ascorbic acid has been demonstrated using integrated microneedle-electrode devices with carbon fibers, modified carbon pastes, and platinum-coated polymer microneedles serving as transducing elements.3-7,8
This microneedle sensor technology has enabled a novel and sophisticated analytical approach for in situ and simultaneous detection of multiple analytes. Multiplexing offers the possibility of monitoring complex microenvironments, which are otherwise difficult to characterize in a rapid and minimally invasive manner. For example, this technology could be utilized for simultaneous monitoring of extracellular levels of, glucose, lactate and pH,9 which are important metabolic indicators of disease states7,10-14 (e.g., cancer proliferation) and exercise-induced acidosis.15

This article details the construction of a multiplexed microneedle-based sensor. The device is being developed for in situ sampling and electrochemical analysis of multiple analytes in a rapid and selective manner. We envision clinical medicine and biomedical research uses for these microneedle-based sensors.

Hollow microago-based sensore per Multiplexed transdermico elettrochimica Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

Rilevamento e identificazione batterica Utilizzando Sensori elettrochimici

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Multi-analyte Biochip (MAB) Based on All-solid-state Ion-selective Electrodes (ASSISE) for Physiological Research

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) that can withstand prolonged storage in complex biological media 1-4. An all-solid-state ion-selective-electrode (ASSISE) is especially attractive for the aforementioned applications. The electrode should have the following favorable characteristics: easy construction, low maintenance, and (potential for) miniaturization, allowing for batch processing. A microfabricated ASSISE intended for quantifying H+, Ca2+, and CO32- ions was constructed. It consists of a noble-metal electrode layer (i.e. Pt), a transduction layer, and an ion-selective membrane (ISM) layer. The transduction layer functions to transduce the concentration-dependent chemical potential of the ion-selective membrane into a measurable electrical signal.
The lifetime of an ASSISE is found to depend on maintaining the potential at the conductive layer/membrane interface 5-7. To extend the ASSISE working lifetime and thereby maintain stable potentials at the interfacial layers, we utilized the conductive polymer (CP) poly(3,4-ethylenedioxythiophene) (PEDOT) 7-9 in place of silver/silver chloride (Ag/AgCl) as the transducer layer. We constructed the ASSISE in a lab-on-a-chip format, which we called the multi-analyte biochip (MAB) (Figure 1).
Calibrations in test solutions demonstrated that the MAB can monitor pH (operational range pH 4-9), CO32- (measured range 0.01 mM - 1 mM), and Ca2+ (log-linear range 0.01 mM to 1 mM). The MAB for pH provides a near-Nernstian slope response after almost one month storage in algal medium. The carbonate biochips show a potentiometric profile similar to that of a conventional ion-selective electrode. Physiological measurements were employed to monitor biological activity of the model system, the microalga Chlorella vulgaris.
The MAB conveys an advantage in size, versatility, and multiplexed analyte sensing capability, making it applicable to many confined monitoring situations, on Earth or in space.
Biochip Design and Experimental Methods
The biochip is 10 x 11 mm in dimension and has 9 ASSISEs designated as working electrodes (WEs) and 5 Ag/AgCl reference electrodes (REs). Each working electrode (WE) is 240 &mu;m in diameter and is equally spaced at 1.4 mm from the REs, which are 480 &mu;m in diameter. These electrodes are connected to electrical contact pads with a dimension of 0.5 mm x 0.5 mm. The schematic is shown in Figure 2.
Cyclic voltammetry (CV) and galvanostatic deposition methods are used to electropolymerize the PEDOT films using a Bioanalytical Systems Inc. (BASI) C3 cell stand (Figure 3). The counter-ion for the PEDOT film is tailored to suit the analyte ion of interest. A PEDOT with poly(styrenesulfonate) counter ion (PEDOT/PSS) is utilized for H+ and CO32-, while one with sulphate (added to the solution as CaSO4) is utilized for Ca2+. The electrochemical properties of the PEDOT-coated WE is analyzed using CVs in redox-active solution (i.e. 2 mM potassium ferricyanide (K3Fe(CN)6)). Based on the CV profile, Randles-Sevcik analysis was used to determine the effective surface area 10. Spin-coating at 1,500 rpm is used to cast ~2 &mu;m thick ion-selective membranes (ISMs) on the MAB working electrodes (WEs).
The MAB is contained in a microfluidic flow-cell chamber filled with a 150 &mu;l volume of algal medium; the contact pads are electrically connected to the BASI system (Figure 4). The photosynthetic activity of Chlorella vulgaris is monitored in ambient light and dark conditions.

Multi-analyte Biochip MAB Based on All-solid-state Ion-selective Electrodes ASSISE for Physiological Research

All-solid-state ion-selective electrodes (ASSISEs) constructed from a conductive polymer (CP) transducer provide several months of functional lifetime in liquid media. Here, we describe the fabrication and calibration process of ASSISEs in a lab-on-a-chip format. The ASSISE is demonstrated to have maintained a near-Nernstian slope profile after prolonged storage in complex biological media.

Multi-analita biochip (MAB) Sulla base di elettrodi ionoselettivi All-a stato solido (ASSISE) per la ricerca fisiologica

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) ...

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans' Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and pathways as well as its ease of cultivation. Several C. elegans disease models have been reported, including neurodegenerative disorders such as Parkinson's disease (PD), which involves the degeneration of dopaminergic (DA) neurons 1. Both transgenes and neurotoxic chemicals have been used to induce DA neurodegeneration and consequent movement defects in worms, allowing for investigations into the basis of neurodegeneration and screens for neuroprotective genes and compounds 2,3.
Screens in lower eukaryotes like C. elegans provide an efficient and economical means to identify compounds and genes affecting neuronal signaling. Conventional screens are typically performed manually and scored by visual inspection; consequently, they are time-consuming and prone to human errors. Additionally, most focus on cellular level analysis while ignoring locomotion, which is an especially important parameter for movement disorders.
We have developed a novel microfluidic screening system (Figure 1) that controls and quantifies C. elegans' locomotion using electric field stimuli inside microchannels. We have shown that a Direct Current (DC) field can robustly induce on-demand locomotion towards the cathode ("electrotaxis") 4. Reversing the field's polarity causes the worm to quickly reverse its direction as well. We have also shown that defects in dopaminergic and other sensory neurons alter the swimming response 5. Therefore, abnormalities in neuronal signaling can be determined using locomotion as a read-out. The movement response can be accurately quantified using a range of parameters such as swimming speed, body bending frequency and reversal time.
Our work has revealed that the electrotactic response varies with age. Specifically, young adults respond to a lower range of electric fields and move faster compared to larvae 4. These findings led us to design a new microfluidic device to passively sort worms by age and phenotype 6.
We have also tested the response of worms to pulsed DC and Alternating Current (AC) electric fields. Pulsed DC fields of various duty cycles effectively generated electrotaxis in both C. elegans and its cousin C. briggsae 7. In another experiment, symmetrical AC fields with frequencies ranging from 1 Hz to 3 KHz immobilized worms inside the channel 8.
Implementation of the electric field in a microfluidic environment enables rapid and automated execution of the electrotaxis assay. This approach promises to facilitate high-throughput genetic and chemical screens for factors affecting neuronal function and viability.

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans&#039; Locomotion

A semi-automated micro-electro-fluidic method to induce on-demand locomotion in Caenorhabditis elegans is described. This method is based on the neurophysiologic phenomenon of worms responding to mild electric fields (&#x201C;electrotaxis&#x201D;) inside microfluidic channels. Microfluidic electrotaxis serves as a rapid, sensitive, low-cost, and scalable technique to screen for factors affecting neuronal health.

Electrotaxis microfluidica-based per On-demand analisi quantitativa della<em&gt; Caenorhabditis elegans</em&gt; &#39;Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and ...

A Label-free Technique for the Spatio-temporal Imaging of Single Cell Secretions

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning of such signaling can lead to many disorders. To understand cell-to-cell signaling, it is essential to study the spatial and temporal nature of the secreted molecules from the cell without disturbing the local environment. Various assays have been developed to study protein secretion, however, these methods are typically based on fluorescent probes which disrupt the relevant signaling pathways. To overcome this limitation, a label-free technique is required.
In this paper, we describe the fabrication and application of a label-free localized surface plasmon resonance imaging (LSPRi) technology capable of detecting protein secretions from a single cell. The plasmonic nanostructures are lithographically patterned onto a standard glass coverslip and can be excited using visible light on commercially available light microscopes. Only a small fraction of the coverslip is covered by the nanostructures and hence this technique is well suited for combining common techniques such as fluorescence and bright-field imaging.
A multidisciplinary approach is used in this protocol which incorporates sensor nanofabrication and subsequent biofunctionalization, binding kinetics characterization of ligand and analyte, the integration of the chip and live cells, and the analysis of the measured signal. As a whole, this technology enables a general label-free approach towards mapping cellular secretions and correlating them with the responses of nearby cells.

Inter-cellular communication is critical for controlling various physiological activities within and outside the cell. This paper describes a protocol for measuring the spatio-temporal nature of single cell secretions. To achieve this, a multidisciplinary approach is used which integrates label-free nanoplasmonic sensing with live cell imaging.

Una tecnica senza etichetta per l&#39;Imaging spazio-temporale delle secrezioni monocellulari

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning ...

Label-free Single Molecule Detection Using Microtoroid Optical Resonators

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental studies on the behavior of molecules. Single molecule detection techniques commonly utilize labels such as fluorescent tags or quantum dots, however, labels are not always available, increase cost and complexity, and can perturb the events being studied. Optical resonators have emerged as a promising means to detect single molecules without the use of labels. Currently the smallest particle detected by a non-plasmonically-enhanced bare optical resonator system in solution is a 25 nm polystyrene sphere1. We have developed a technique known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that can surpass this limit and achieve label-free single molecule detection in aqueous solution2. As signal strength scales with particle volume, our work represents a &#62; 100x improvement in the signal to noise ratio (SNR) over the current state of the art. Here the procedures behind FLOWER are presented in an effort to increase its usage in the field.

We have developed a label-free biosensing system based on optical resonator technology known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that is capable of detecting single molecules in solution. Here the procedures behind this work are described and presented.

Singola molecola di rilevamento senza etichetta di testo usando Microtoroid ottici Risonatori

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental ...

PIP-on-a-chip: A Label-free Study of Protein-phosphoinositide Interactions

Numerous cellular proteins interact with membrane surfaces to affect essential cellular processes. These interactions can be directed towards a specific lipid component within a membrane, as in the case of phosphoinositides (PIPs), to ensure specific subcellular localization and/or activation. PIPs and cellular PIP-binding domains have been studied extensively to better understand their role in cellular physiology. We applied a pH modulation assay on supported lipid bilayers (SLBs) as a tool to study protein-PIP interactions. In these studies, pH sensitive ortho-Sulforhodamine B conjugated phosphatidylethanolamine is used to detect protein-PIP interactions. Upon binding of a protein to a PIP-containing membrane surface, the interfacial potential is modulated (i.e. change in local pH), shifting the protonation state of the probe. A case study of the successful usage of the pH modulation assay is presented by using phospholipase C delta1 Pleckstrin Homology (PLC-&#948;1 PH) domain and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) interaction as an example. The apparent dissociation constant (Kd,app) for this interaction was 0.39 &#177; 0.05 &#181;M, similar to Kd,app values obtained by others. As previously observed, the PLC-&#948;1 PH domain is PI(4,5)P2 specific, shows weaker binding towards phosphatidylinositol 4-phosphate, and no binding to pure phosphatidylcholine SLBs. The PIP-on-a-chip assay is advantageous over traditional PIP-binding assays, including but not limited to low sample volume and no ligand/receptor labeling requirements, the ability to test high- and low-affinity membrane interactions with both small and large molecules, and improved signal to noise ratio. Accordingly, the usage of the PIP-on-a-chip approach will facilitate the elucidation of mechanisms of a wide range of membrane interactions. Furthermore, this method could potentially be used in identifying therapeutics that modulate protein&#39;s capacity to interact with membranes.

Here we present a supported lipid bilayer in the context of a microfluidic platform to study protein-phosphoinositide interactions using a label-free method based on pH modulation.

PIP-on-a-chip: Uno studio privo di etichette delle interazioni proteine-fosfoinositide

Numerous cellular proteins interact with membrane surfaces to affect essential cellular processes. These interactions can be directed towards a specific ...

Methods Article

Un Biochip elettrochimica Microfluidic-based per la libera-Label Ibridazione DNA Analysis