This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: Isolamento di RNA di piccole dimensioni da P. falciparum Durante l&#39;IDC <ol><li> Ottenere i parassiti della malaria nella cultura asessuata 29. NOTA: La dimensione culturale necessaria varierà in base alla applicazione desiderata; tuttavia, una cultura 10 ml al 3-5% parassitemia e 5% ematocrito offre ampio RNA per PCR in tempo reale (RT-PCR). La tecnica è stata inizialmente ottimizzato per le culture asincrone, ma quando si desiderano punti temporali specifici durante il ciclo di infezione, parassiti anello-stage può essere sincronizzato da sincronizzazione sorbitolo entro e non oltre 10-12 ore dopo l&#39;invasione. La sincronizzazione deve essere ripetuta dopo un ciclo (circa 48 ore) 29. </li><li> Cellule infettate Pool insieme (~ 5 x 10 9 RBC al 3-5% parassitemia) e riempire PBS freddo alla parte superiore del tubo e centrifugare a 800 xg per 5 minuti senza freno per far sedimentare le cellule rosse. </li><li> Dopo la centrifugazione, rimuovere il surnatante con cura utilizzando una pipetta di aspirazione, in allegatoa vuoto, in quanto il pellet eritrocitaria è facile da rimuovere. Lavare il pellet ancora una volta con 1x PBS freddo. </li><li> Pellet Risospendere cellulare in freddo 0,15% saponina (in 1x PBS) e posto in ghiaccio per 30 min. </li><li> Cellule centrifugare a 1.500 xg per 12 min a 4 ° C, rimuovere il surnatante (che sarà di colore rosso scuro) e risospendere pellet in PBS freddo. Ripetere questo passaggio ancora una volta. NOTA: Al fine di garantire che i microRNA presenti erano riflettente dei microRNA all&#39;interno di parassiti, e non la contaminazione eritrocitaria, una serie di condizioni di isolamento di parassiti sono stati testati: 1) saponina lisi, 2) saponina lisi combinata con trattamento RNaseA dei miRNA cellula ospite e 3 ) metil-beta-ciclodestrina trattamento per rimuovere il parassita dal eritrociti host. Tutti i trattamenti hanno dato risultati simili. </li><li> Lyse il parassita pellet isolato utilizzando la raccomandata 600 ml di tampone di lisi. Questo volume di tampone di lisi è sufficiente per culture fino a ~ 30 ml a 2% e 5% ematocrito parassitemia. NOTA: Per le culture parassita più grandi, questo volume può essere aumentato. È importante garantire la completa lisi del pellet parassita nel vortex approfondita per almeno 1 min. Inoltre, per facilità di estrazione, i campioni lisati possono essere trasferiti in una provetta da 1,7 ml microcentrifuga. </li><li> Aggiungere 60 microlitri, o 1/10 volume del tampone di lisi utilizzato nel passaggio 6, di additivo omogenato (acetato di sodio 2 M, pH 4). </li><li> Lasciare i campioni in ghiaccio per 10 minuti. </li><li> Aggiungere 600 microlitri, o un volume uguale alla quantità di tampone di lisi aggiunto nel passaggio 6, di acido fenolo cloroformio a ciascun campione e vortex per 1 min. </li><li> Separate le fasi acquosa ed organica mediante centrifugazione dei campioni a 10.000 xg per 5 min. Questa rotazione è più lungo di quello proposto dal kit per assicurare che tutte emoglobina / emozoina è nella fase organica. </li><li> Raccogliere il (acquosa) strato superiore e trasferirlo in una nuova provetta. Ripetere i passaggi 9 e 10 se la fase acquosa è bianco o (più probabilmente) di colore marrone, che suggerisce proTEIN contaminazione. </li><li> Determinare il volume del supernatante risultante dalla pipetta e quindi aggiungere 1,25 volumi di etanolo 100% (~ 800 microlitri) e miscelare invertendo la provetta 1,7 ml 5 volte. </li><li> Passare ogni campione attraverso una cartuccia filtro RNA associazione fornito (diversi diversi dei quali sono disponibili in commercio) da una centrifugazione a 14.000 xg per 1 minuto o utilizzando un collettore sotto vuoto. </li><li> Lavare la cartuccia filtrante con 700 ml di miRNA Wash Buffer 1 utilizzando una microcentrifuga, spinning a 14000 g per 1 min. </li><li> Lavare la cartuccia filtrante con 500 microlitri di tampone di lavaggio 2/3 volte per centrifugazione a 14.000 xg per 1 minuto ciascuno. </li><li> Eluire RNA con 100 microlitri DEPC in acqua, che è stato preriscaldato a 95 ° C, in due lavaggi di 50 microlitri, centrifugazione a 14.000 xg per 1 minuto ciascuno. Misurare la concentrazione di RNA tramite assorbimento UV a 260 nm. NOTA: Un gel di RNA (o TBE-urea acrilamide o denaturazione gel di agarosio formaldeide) può be utilizzato per valutare la distribuzione delle dimensioni delle RNA isolati. NOTA: Questo RNA è adatto per l&#39;analisi mediante microarray, RNA-sequenziamento, macchia settentrionale e del test di protezione della ribonucleasi. </li></ol> 2: Quantificazione degli RNA di piccole dimensioni da P. falciparum Durante l&#39;IDC <ol><li> Determinare la concentrazione di singoli campioni isolati al punto 1 mediante spettrofotometria UV a 260 nm. </li><li> Generare primer PCR in tempo reale per le specie di RNA desiderati. Per miRNA da solo, abbiamo usato miRNA premade saggi qPCR, mentre per mRNA o fusione miRNA-mRNA abbiamo progettato primer per SYBR green. Per gli RNA di fusione, il primer forward era sequenza miRNA stesso (miR-451: AAACCGTTACCATTACTGAGTT), mentre il contrario era un gene-specifico Primer ~ 100 bp a valle del miRNA nella sequenza mRNA (PKA-R: ATCGAACATGCTGTGAACAT). </li><li> Effettuare cDNA dai campioni di RNA utilizzando sia un primer tornante per miRNA (utilizzare 20-40 ng di RNA) da solo o esameri casuali per mRNA e / o miRNASpecie -mRNA fusione (con 1 mg di RNA). Mescolare RNA e primers per 5 min a 65 ° C, poi raffreddare a temperatura ambiente. In seguito, aggiungere mix trascrittasi inversa (0,5 microlitri trascrittasi inversa, inibitori 0,5 microlitri RNasi, 1 dNTP microlitri (2,5 mm ciascuno), 4 pl 5x tampone, 2 microlitri 0.1M DTT, 1 ml H 2 O). <ol><li> Campioni eseguito su un termociclatore in grado di rilevare sia SYBR sonde verde o TaqMan. SYBR green quantitativa PCR 30 per geni specifici è stato eseguito come un 3-step PCR, 95 ° C per 15 sec, disponibilità temperatura di ricottura Primer meno 5 ° C per 30 sec e 68 ° C per 30 sec per 40 cicli, utilizzando un SYBR commerciale master mix verde. miRNA PCR in tempo reale è stato eseguito come due fasi PCR, 95 ° C per 15 sec e 60 ° C per 1 min per 40 cicli. </li><li> Quantificare test utilizzando il metodo ΔΔCt e normalizzare contro sia Rab GTPasi (PF08_0110) o 18S rRNA 31. </li></ol></li></ol> 3: Introduzionedi piccoli RNA in Malaria Parassiti <ol><li> Pellet 300 ml di globuli rossi per trasfezione (250 ml di globuli rossi, circa 1.5 x 10 9 cellule, in ultima analisi, da utilizzare) nei media malaria completo per centrifugazione a 800 xg per 5 minuti a freno 1. </li><li> Lavare gli eritrociti due volte con RPMI e risospendere in cytomix completa (120 mM KCl; 0,15 mm CaCl 2; 10 mm K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM MgCl 2; pH regolato con KOH) al 50% di ematocrito dopo centrifugazione a 800 xg per 5 min a freno 1. </li><li> Trasferire le cellule di un 0,2 cm elettroporazione cuvetta. </li><li> Aggiungere 10 mg, o adeguate quantità, di oligonucleotidi sintetici personalizzato alle cuvette e sospendere nuovamente le culture. </li><li> Regolare il elettroporatore a 310 V / 950 uF e fornire un impulso per ogni provetta. </li><li> Risospendere le 300 ml di globuli rossi all&#39;interno della cuvetta in pre-riscaldato mal completoAria supporti e piastra in piastre da 24 pozzetti e incubare a 37 ° C in un contenitore ermetico con miscela di gas del sangue malaria (3% O 2, 5% CO 2). </li><li> Dopo 4 ore, di infettare i globuli rossi trasfettate con trofozoiti fine sincronizzati ad una parassitemia finale di circa 1%. </li><li> Aggiungere globuli rossi appena trasfezionati ogni 4-6 giorni a culture infette e determinare la parassitemia% da FACS utilizzando YoYo-1 colorazione, come indicato al punto 4. </li></ol> 4: Determinazione della eritrociti microRNA effetto su Parasite infezione Tasso <ol><li> Prendete 100 ml di cultura risospeso di micropipettatore e posto in una provetta da 1,7 ml microcentrifuga. Lavare due volte con 1 ml di PBS 1x e centrifugare in una microcentrifuga da tavolo per centrifugazione a 800 xg per 5 min. </li><li> Risospendere pellet in 1 ml di 0,025% glutaraldeide. Incubare i campioni per 20 minuti a RT. NOTA: i campioni possono essere conservati qui per diverse settimane a 4 ° C. In seguito, il pellet infetto RJacket per centrifugazione a 800 xg per 5 min. Lavare due volte con 1 ml di PBS 1x. </li><li> Risospendere pellet in 1 ml di 0,015% saponina. Incubare a 4 ° C per 15 min. Pellet infettato globuli rossi mediante centrifugazione a 800 xg per 5 min. Lavare due volte con 1 ml di PBS 1x. Repeat.4.3. Risospendere le cellule in 1 ml di 1x PBS contenente 1 ml (1,000X) macchia del DNA. </li><li> Determinare i gradi di parassitemia su un citofluorimetro, a 488 nm di eccitazione e ~ 530 nm (FL-1) emissioni. </li><li> In primo luogo, porta il citofluorimetro basata sulla FSC e SSC di concentrarsi su globuli rossi. Quindi misurare i gradi di parassitemia (globuli rossi infetti) nel RBC gated per fluorescenza nel canale FL-1. NOTA: dopo i parassiti stadio sono 10 volte più fluorescente di precedenti parassiti palcoscenico, e ~ 100X sopra globuli rossi infetti. Inoltre, la raccolta a bassa velocità tende a ridurre il rumore. Infine, questo approccio è stato paragonato a 3 H-ipoxantina incorporazione e Giemsa, sia come riportato in precedenza 13, e tutte le tecniche gavdi e risultati simili. </li></ol> 5: biotina-tagging e eluizione di miRNA-mRNA Fusion Prodotti <ol><li> Direttamente ordinare oligonucleotidi sintetici personalizzato RNA con desthiobiotin (DB-) covalentemente legati alla fine del 5 &#39;. </li><li> Trasfettare globuli rossi infetti con Desthiobiotin-coniugata (DB-) miRNA e non modificato miRNA (controllo negativo), come indicato al punto 3. </li><li> Infettare globuli rossi transfettate con P. falciparum parassiti ad una parassitemia iniziale di 0,5% (punto 1.1). </li><li> Estrarre l&#39;RNA parassita 4 giorni (96 ore), più tardi, come descritto in precedenza al punto 1. </li><li> Incubare 10 mg di parassita di RNA con 50 ml confezionati perline streptavidina, ha aggiunto tramite micropipetta, e ruotare su un rotatore provetta per 1 ora a 4 ° C. </li><li> Pellet le perline a 800 xg per 30 secondi e lavare con 20 mM KCl e 1 / 1.000 RNase Inhibitor. </li><li> Eluire RNA dalle perline di concorrenza con biotina 2 mm e 200 microlitri di buffer RNA cattura di eluizione (20 mM KCl, 1/1, 000 RNase Inhibitor e 2 mm biotina) a 4 ° C durante la notte con rotazione. </li><li> Determinare il grado di arricchimento indicato P. trascrizioni falciparum con SYBR green qRT-PCR, e microRNA arricchimento (controllo positivo) per TaqMan qPCR come indicato al punto 2. </li></ol> 6: Separazione polysome determinare la ribosomiale Occupazione di P. falciparum <ol><li> Posizionare soluzione di saccarosio 5 ml di 15% (400 acetato mM di potassio, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM cicloeximide, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, e il 15% di saccarosio ) in un tubo ultracentrifuga SW41 (14 x 89 mm). </li><li> Usando una siringa da 5 ml, aggiungere la soluzione di saccarosio 5 ml di 50% (400 acetato mM di potassio, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM cicloeximide, 1 mM DTT, 1 mM PMSF, 40 U / ml RNasi Inhibitor, e il 50% di saccarosio) sotto il saccarosio del 15% con un lungo ago di acciaio, quindi rimuovere l&#39;ago. </li><li&gt; sigillare la parte superiore del tubo di gradiente con Parafilm, inclinare il tubo lentamente su un lato, in una posizione stabile per evitare di rotolamento, quindi è in posizione orizzontale sul tavolo. Mantenere il tubo su un lato per almeno 2 ore. Durante l&#39;attesa, iniziare dal passaggio 6.5. </li><li> Dopo 2 ore, lentamente inclinare il tubo schiena dritta e trasferire il tubo di ghiaccio, lasciato raffreddare per almeno 15 minuti prima di assaggiare carico (punto 14). </li><li> Raccogliere abbastanza Plasmodium sangue -infected cultura fase di generare 100-500 mg di RNA totale, ovvero circa un 100 ml cultura asincrono al 3-5% parassitemia. Aggiungere 1/10 quel volume di terreno di coltura contenente 10x (2 mM) cicloeximide (CHX) e incubare a 37 ° C per 10 min. <ol><li> Culture pellet per centrifugazione a 500 xg per 7 minuti con la centrifuga (freno 1), poi lavare due volte con temperatura ambiente PBS 1x contenente 200 mM CHX. Risospendere le culture parassita in 1x PBS contenente 200 mM CHX e memorizzare sul ghiaccio. </li></ol></li&gt; <li> Stima il volume del pellet RBC. Aggiungere tampone di lisi (400 potassio acetato mM, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, 1% (v / v) IGEPAL CA -630, e 0,5% (w / v) DOC) al pellet RBC ad un volume finale di 4,25 ml. Incubare il lisato a 4 ° C per 10 minuti durante la rotazione. </li><li> Trasferire il lisato di tubi microcentrifuga, e poi centrifugare i campioni in una microcentrifuga a 16.000 xg e 4 ° C per 10 min. </li><li> Preparare cuscini saccarosio pipettando 1,25 ml di soluzione di cuscino di saccarosio freddo 0,5 M (400 acetato mM di potassio, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM cicloeximide, 1 mM DTT, 1 mM PMSF, 40 U / ml RNasi Inhibitor, e 0,5 M saccarosio) in un tubo ultracentrifuga SW55 (13 x 51 mm). </li><li> Strato cautela 3,75 ml di lisato surnatante (dal punto 7) sulla parte superiore del cuscino di saccarosio con una siringa e piccolo (~ 27) gauge. Store il lisato rimanente (~ 500 mL) a -80 ° C per estrarre livelli di RNA totale, come indicato al punto 1. </li><li> Caricare i campioni in un rotore ultracentrifuga, pre-raffreddata a 4 ° C, che può contenere 13,2 ml tubi. Centrifugare i campioni a 366.000 xg e 4 ° C per 146 min. </li><li> Usando una pipetta, trasferire il surnatante in un tubo conico da 15 ml. Conservare il surnatante a -80 ° C per l&#39;RNA isolamento di libero (non legato dai ribosomi) RNA. </li><li> Risospendere il pellet ribosoma in 500 microlitri di tampone di risospensione ribosoma (400 acetato mM di potassio, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM cicloeximide, 1 mM DTT, 1 mM PMSF, e 40 U / ml RNase Inhibitor) pipettando per 5 min. </li><li> Centrifugare i campioni in una microcentrifuga a 16.000 xg e 4 &#160; ° C per 10 min. </li><li> Mantenendo il gradiente dal punto # 4 sul ghiaccio, rimuovere il Parafilm, poi strato accuratamente la sospensione ribosoma in cima alla usi gradienteng una siringa e piccolo (~ 27) gauge. </li><li> Caricare il tubo in un rotore ultracentrifuga pre-raffreddata e centrifugare i gradienti caricati 200.000 xg e 4 ° C per 180 min. Quando il giro è completato, negozio centrifugato gradienti a 4 ° C fino al momento di caricare sul frazionatore. </li><li> Caricare un tubo ultracentrifuga vuoto nel frazionatore pendenza (questo può essere un tubo utilizzato in una precedente esecuzione), poi lavare con acqua RNase-free per 5 min a 100 x 10 velocità. </li><li> Durante il lavaggio nel passaggio 6.16, impostare la sensibilità del rivelatore di assorbanza UV. Una buona sensibilità di partenza è di 0,2, ma questo può essere regolato in seguito corre in base al segnale A 254 (che varia in base al numero parassita, ecc). </li><li> Una volta che la sensibilità del rivelatore è impostata, impostare il segnale di riferimento a zero mentre l&#39;acqua scorre attraverso il rivelatore. </li><li> Dopo aver lavato il raccoglitore di frazioni, invertire il flusso di fluido fino a quando le linee sono vuote e quindi remil sobrio il tubo ultracentrifuga vuoto. </li><li> Eseguire soluzione di saccarosio al 60% attraverso la colonna di frazionamento fino a quando non esce l&#39;apparato ago. </li><li> Inserire il tubo contenente il primo gradiente nella parte superiore della camera di caricamento e stringere la guarnizione, facendo attenzione a non serrare eccessivamente. Poi, perforare il fondo del tubo con l&#39;ago. </li><li> Azzerare la velocità di flusso del fluido di 12,5 x 10 (controllato dal controllo della velocità del flusso sulla parte anteriore della pompa), quindi impostare il raccoglitore di frazioni automatizzato per raccogliere 18 sec frazioni (~ 330 microlitri / frazione) in provette da microcentrifuga. </li><li> Inizia in avanti il ​​flusso della soluzione di saccarosio al 60%. </li><li> Quando la prima goccia della soluzione di gradiente cade nella provetta, iniziare immediatamente sia la raccolta di frazioni e la registrazione dal vivo del segnale A 254. </li><li> Una volta che un forte calo si osserva nel segnale A 254, corrispondente alla interfaccia tra le soluzioni di saccarosio 50% e 60%, sia interrompere il flusso del fluido e A 254 </sub&gt; registrazione. </li><li> Conservare le frazioni gradiente a -80 &#160; ° C per un uso successivo. </li><li> Invertire il flusso del fluido a 100 x 10 velocità finché la soluzione di saccarosio al 60% svuota dal tubo ultracentrifuga. </li><li> Se ci sono pendenze aggiuntive per frazionare, rimuovere il tubo ultracentrifuga vuoto dalla camera di caricamento e ricominciare dal punto 6.21. Se sono stati completati tutti i campioni, lavare l&#39;apparecchiatura come è stata eseguita in fasi 6.16 e 6.19. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HBS è una delle varianti di emoglobina più comuni in aree endemiche malaria, principalmente perché fornisce protezione contro la malaria causata da P. grave falciparum. Le tecniche necessarie per caratterizzare il ruolo di microRNA umano nella regolazione genica di P. falciparum sono dettagliate nel corso di questo manoscritto. Estraendo RNA totale in modo tale da includere tutti i piccoli RNA, ed eseguendo una procedura parassita lisi relativamente semplice, questi RNA fusione potevano essere identificati attraverso una varietà di tecniche indipendenti. Questi passaggi sono relativamente semplici, ma sono sensibili ai problemi e la contaminazione, se non seguite correttamente. Durante l&#39;estrazione parassita, è fondamentale eseguire saponina lisi per rimuovere contaminanti eritrociti ospitante. Questo è particolarmente vero durante la fase saponina lisi dell&#39;isolamento dell&#39;RNA. Il componente miRNA dei globuli rossi ospite è di diversi ordini di grandezza greater quella del parassita, in parte a causa della maggior parte dei globuli rossi che sono non infetto, quindi è fondamentale per rimuovere il più possibile contaminazione eritrocitaria. E &#39;anche importante mantenere la cultura malaria in una fase sana e corretta (se è richiesto un punto specifico nel ciclo di infezione) per ottenere un profilo miRNA accurata. Allo stesso modo, durante l&#39;estrazione fenolo-cloroformio, è di vitale importanza per assicurarsi che le fasi acquose sono chiare e, in caso contrario, ripetere l&#39;estrazione con fenolo-cloroformio per evitare qualsiasi contaminazione residua. Inoltre, nell&#39;esperimento cattura desthiobiotin, è fondamentale per eluire con un eccesso di biotina e di utilizzare il minimo di perline streptavidina, in modo da garantire la corretta eluizione specifica. L&#39;eluizione di RNA si lega attraverso la concorrenza con biotina, piuttosto che completa denaturazione delle perle stesse, è servito a ridurre drasticamente l&#39;arricchimento sfondo RNA. Infine, l&#39;esperimento cattura desthiobiotin stata evidenziata unas un modo importante per dimostrare come sono stati catturati questi miRNA, ma diverse altre tecniche sono state utilizzate anche negli studi precedenti per dimostrare questi RNA di fusione, come macchie settentrionali e saggi di protezione ribonucleasi 29. Tali metodi di utilizzo dei microRNAs trasfettate per recuperare i trascritti modificati possono avere una più ampia applicazione, come la purificazione di complessi proteici associati che possono mediare il trasporto e lavorazione dei miRNA trasfettate. Mentre diversi approcci a livello di genoma sono stati utilizzati per lo studio del proteoma e del trascrittoma 22-25 malaria, ci sono alcuni metodi per esaminare globalmente regolazione traduzionale in P. falciparum 21,26. Questa limitazione metodologica preclude l&#39;analisi globale del regolamento traslazionale in P. falciparum. Uno degli approcci sperimentali più comuni per lo studio regolazione traduzionale è polysome profiling, che valuta traduzione globaleattività al basato sui ribosomi caricati su specifici mRNA di interesse. Dettagliata in questo manoscritto è un metodo di profiling polysome ottimizzato per l&#39;uso in parassiti della malaria che sia la lisi degli eritrociti infettati e il parassita all&#39;interno. Metodi precedenti non recuperare la maggior parte dei polisomi e faceva sembrare come se parassiti della malaria non hanno popolazioni considerevoli di polisomi. L&#39;uso di un tampone di lisi con un&#39;alta concentrazione di acetato di potassio e magnesio ha reso possibile per lisare entrambi globuli rossi e parassiti mentre solubilizzare ribosomi di membrana per consentire la cattura di polisomi intatti. Questo metodo conveniente di purificazione ribosomiale e profilatura contribuirà a colmare il divario di conoscenze esistenti tra il trascrittoma malaria e proteoma e consentire l&#39;analisi di tutto il genoma dello stato di traslazione del P. falciparum. Questo approccio è stato utilizzato per confrontare lo stato di traduzione della precoce e tardiva fase bfase lood parassiti 28, che sono strettamente coordinato l&#39;espressione genica. I dati relativi al carico ribosomiale di trascrizioni possono essere facilmente ottenuti e analizzati per determinare la densità dei ribosomi su specifici mRNA. Inoltre, quando combinato con sincronizzazione sorbitolo, variazioni della densità ribosomiale possono essere utilizzati per stabilire come la traduzione è regolata durante il ciclo di vita del parassita. Isolamento di ribosomi utilizzando questo approccio richiede una grande quantità di cultura, che limita purtroppo le fasi del ciclo di vita della malaria in cui può essere eseguita. La grande quantità di materiale in ingresso anche limitare il suo uso sia a ceppi di laboratorio in vitro di Plasmodium falciparum, e può limitare la sua applicabilità ad altri organismi infettivi. Chiunque utilizzi questa procedura sarà anche in grado di schermo per i geni che mostrano profili di traduzione insoliti, in particolare le trascrizioni che non sono associati con i ribosomi, che riflette i modi alternativi di regolazione genica. Finalmente,questo approccio ci consentirà di valutare come agenti antimalarici innovativi influiscono traduzione di proteine ​​e di individuare meccanismi di traduzione a base di resistenza ai farmaci. Questo gasdotto ha una grande utilità per individuare e determinare la regolazione post-trascrizionale in molti sistemi sperimentali.

La malaria, causata da parassiti Apicomplexa del genere Plasmodium, è la malattia parassitaria umana più comune, infettando il mondo circa 200 milioni di persone ogni anno e provocando circa 600.000 morti 1. Delle cinque specie di Plasmodium che infettano gli esseri umani, il più rilevante per le malattie umane sono P. falciparum e P. vivax, a causa delle loro distribuzioni diffuse e il potenziale di gravi complicazioni di malaria. Il ciclo di vita del parassita della malaria richiede infezione di zanzare e gli esseri umani sia. Quando una zanzara infetta morde un essere umano, i parassiti viaggiano attraverso il flusso sanguigno al fegato, dove si verifica un primo giro di replica. Dopo la rottura merozoiti dal epatociti ospite, infettano vicine globuli rossi, l&#39;avvio di replica sia asessuata o sessuale. La fase asessuata di replica, che dura 48 ore in P. falciparum, è al centro di questo studio in quanto è sia la fonte della maggior Malsintomi Aria e è facilmente ricapitolate in vitro. Mentre un certo numero di iniziative di salute pubblica, tra cui il miglioramento terapie anti-malarici, hanno in qualche modo ridotto l&#39;impatto della malaria a livello globale, l&#39;emergere continuo di parassiti resistenti ai farmaci rappresenta un problema per gli sforzi di controllo della malaria. Un settore che può suggerire nuovi approcci terapeutici è lo studio su come le varie varianti genetiche conferiscono resistenza alla malaria. Nelle regioni la malaria è endemica, una varietà di polimorfismi eritrocitari sono abbastanza comuni 2,3. Queste mutazioni, con falciforme è forse il più importante, sono spesso associati con notevole resistenza alla insorgenza di infezione malarica sintomatica 4. I meccanismi alla base con cui essi provocano eritrociti di resistere alle infezioni di malaria non sono completamente compresi. Eritrociti parassitato con mutazioni di emoglobina sono soggetti a una maggiore fagocitosi attraverso la rigidità cellulare aumentata e la disidratazione, cheè associato con una diminuzione invasione da parte di P. Plasmodium 5. L&#39;allele HbC colpisce anche l&#39;espressione della proteina sulla superficie degli eritrociti e con il rimodellamento del citoscheletro, inibendo l&#39;ulteriore sviluppo del parassita 6,7. Infine, P. falciparum cresce poco all&#39;interno falce omozigote (HbSS) eritrociti 8,9 in vitro, suggerendo intrinseci fattori eritrocitari di resistenza della malaria. Tuttavia, mentre tutti questi meccanismi sembrano svolgere un ruolo, non spiegano appieno i meccanismi alla base della resistenza falciforme alla malaria. Un potenziale serie di fattori eritrocitari che rimangono poco conosciuta è la grande piscina di miRNA presenti all&#39;interno eritrociti maturi. I microRNA sono piccoli RNA non codificanti, 19-25 nt in termini di dimensioni, che mediano la traduzione e / o la stabilità di mRNA bersaglio per appaiamento delle basi nel 3 &#39;UTR. Essi sono stati implicati nel controllo delle risposte immunitarie di mammiferi, compreso la soppressione oreplicazione del virus F 10, e hanno mostrato di conferire resistenza ai virus delle piante Essi hanno anche dimostrato di regolare i diversi processi eritrocitari, tra cui l&#39;eritropoiesi 11,12 e metabolismo del ferro 13. Precedenti studi identificato una popolazione abbondante e diversificata di miRNA eritrocitari, la cui espressione è stata drammaticamente alterata in HbSS eritrociti 14,15. Poiché eritrociti maturi manca la trascrizione attiva e la traduzione, il ruolo funzionale di questi miRNA eritrocitari rimane poco chiaro. Come si verifica un notevole scambio di materiale tra la cellula ospite e P. falciparum durante il ciclo di sviluppo intraerythrocytic (IDC) 16, è stato ipotizzato che il profilo di miRNA alterato secondo eritrociti HbS può contribuire direttamente alla resistenza della malaria cellule intrinseco. Questi studi infine portato allo sviluppo di una pipeline per isolare, identificare e funzionalmente studiare il ruolo di miRNA umano all&#39;interno malaria parassita, P. falciparum, che ha indicato che questi ospitano / miRNA umani in ultima analisi, in modo covalente fusibile e quindi translationally reprimono trascritti parassita mRNA 17. Questo ha fornito un esempio dei primi cross-specie trascritti chimerici formati da trans-splicing e implica che questa fusione miRNA-mRNA potrebbe essersi verificato in altre specie, tra cui altri parassiti. Tutti mRNA trypanosome sono trans-impiombato con una giunta-capo (SL) per regolare la separazione delle trascrizioni policistronici 18. Poiché P. falciparum manca ortologhi per Dicer / Ago 19,20, è possibile che i miRNA eritrocitari dirottare simile macchinario SL in P. falciparum per integrare nelle geni bersaglio. Recenti studi in P. falciparum hanno infatti indicato la presenza di sequenze 5 &#39;splice capo 21. Dettagli Questo studio i metodi che hanno portato alla scoperta di trascritti di fusione umani-parassita miRNA-mRNA, tra cui sia trascrittomica e TRADUCEzionali tecniche di regolazione. Gli obiettivi generali di questi metodi sono per studiare gli effetti di piccoli RNA nella regolazione genica, fenotipi e la traduzione potenziale di P. trascrizioni falciparum. L&#39;identificazione iniziale di trascritti chimerici umano-parassita invocata l&#39;utilizzo di tecniche di analisi di RNA, come la real-time PCR, il sequenziamento del trascrittoma e la cattura biblioteca EST, che includeva sia totali e piccoli RNA, piuttosto che con tecniche che isolati solo piccoli RNA. Isolando tutto RNA insieme in una grande piscina, piuttosto che separatamente, permesso di individuare i piccoli RNA umani traslocati nel parassita, nonché la presenza di queste piccole sequenze di RNA come parte di una sequenza più ampia. Questo poi ricorso ad analisi dello stato di questi mRNA traduzione fusione per determinare le conseguenze funzionali di tali fusioni. Mentre ampi sforzi sulla caratterizzazione del genoma del parassita und trascrittoma hanno aggiunto alla comprensione della biologia del parassita 22-25, molto meno si sa circa la regolamentazione di traslazione del trascrittoma mRNA attraverso il ciclo di vita di P. falciparum 26. Questa comprensione limitata del proteoma del parassita ha ostacolato sia la comprensione della biologia del parassita e la capacità di identificare nuovi obiettivi per la prossima generazione di terapie contro la malaria. Questo divario nella comprensione della biologia cellulare del parassita ha persistito in gran parte a causa della mancanza di tecniche adeguate per svolgere indagini regolazione traduzionale in P. falciparum. Un recente documento descritto l&#39;uso di footprinting ribosomiale di P. falciparum per determinare lo stato di traduzione globale 21. Una misura ben consolidata del potenziale traslazionale delle trascrizioni è il numero di ribosomi associati determinati da polysome profiling. Tuttavia, quando questa tecnica è applicata a P. falciparum &lt;/ em&gt;, è in grado di recuperare la maggior parte dei polisomi e cattura prevalentemente monosomes. Recentemente, diversi gruppi hanno ottimizzato 27,28 P. Tecniche polysome falciparum di lisi degli eritrociti e parassiti simultaneamente per preservare i polisomi e caratterizzare l&#39;occupazione ribosomiale e il potenziale traslazionale di questi parassiti della malaria durante il loro sviluppo asessuale in ospitanti globuli rossi 28. Collettivamente, questi metodi dimostrano che la fusione osservato di miRNA e parassiti mRNA umani modula traduzione proteine ​​parassita di quelle mRNA di fusione, che è stato dimostrato utilizzando metodi precedentemente riportati 27, ed è un fattore determinante della resistenza della malaria in HBA e HbSS eritrociti 17. Questi metodi potrebbero essere utili in qualsiasi sistema cerca di individuare e funzionalmente esplorare eventi RNA splicing, se tali RNA di fusione sono in P. falciparum o altri sistemi eucariotici.

<table border="0" cellpadding="0" cellspacing="0" width="651">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:651px;">REAGENTS-All reagents must be RNAse-free.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Diethyl pyrocarbonate (DEPC; Sigma, cat. no. D5758)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC-treated water (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Yoyo-1 DNA fluorescent dye (Thermo Fisher)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gene Pulser II (or comparible) electroporator (Bio-Rad)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.2 cm Electroporation cuvettes</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4 M potassium acetate (Mallinckrodt, cat. no. 6700)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 M potassium HEPES (pH 7.2; Sigma, cat. no. H0527)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M magnesium acetate (Sigma, cat. no. M-2545)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M dithiothreitol (DTT; Research Products International, cat. no. D11000)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM phenylmethylsulfonate fluoride (PMSF; dissolved in isopropanol; Sigma, cat. no. P7626)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (v/v) Igepal CA-630 (Sigma-Aldrich, cat. no. I3021)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (w/v) sodium deoxycholate (DOC; Sigma, cat. no. D-6750)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Cycloheximide (CHX; Sigma, cat. no. C-7698)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose (Mallinckrodt, cat. no. 8360-04)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNAseOUT (Invitrogen, cat. no. 100000840)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RPMI-1640 w/ L-glutamine (Cellgro, cat. no. 10-040-CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% AlbuMAX I (w/v in sterile water) (Invitrogen, cat. no. 11020-039)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gentamicin (Gibco, cat. no. 15750-060))</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HT supplement (100x) (Invitrogen, cat. no. 11067030)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">45% (w/v) sucrose (Sigma, cat no. G8769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M HEPES buffer (Gibco, cat. no. 15630-080)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass slides (VWR, cat. no. 48311-702)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Giemsa stain (50X) (VWR, cat no. m708-01)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#39; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotin powder (Sigma-Aldrich)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1M Potassium Chloride</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin Sepharose High Performance Beads (GE Healthcare)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose cushion (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose chase solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA capture Wash Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Elution Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">REAGENT SETUP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">500 ml RPMI-1640 w/ L-glutamine</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 ml gentamicin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml HT supplement</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2.5 ml 45% glucose</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 ml 10% AlbuMAX I</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">12.5 ml 1 M HEPES</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sterile filter with 0.2 mm vacuum filter flask.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media containing 10x CHX</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as Plasmodium cell culture media above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 mM cycloheximide</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x PBS containing cycloheximide</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">400 mM potassium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 mM potassium HEPES, pH 7.2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15 mM magnesium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">200 mM cycloheximide (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM DTT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM PMSF (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40 U/ml RNaseOUT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% (v/v) Igepal CA-630</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% (w/v) DOC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose to make 15% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose to make 50% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose to make 0.5 M sucrose cushion</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">The 60% sucrose chase solution requires only sucrose and water, no other components</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Wash Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20mM&#160; KCl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5unit/ml Rnase Out (Invitrogen)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Elution Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as RNA Capture Wash Buffer, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2mM Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">EQUIPMENT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Ultra-ClearTM &#189; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polyallomer 9/16 x 3 &#189; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">L8-80M ultracentrifuge (Beckman)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Steel blunt syringe needle, 4 inch, 16G (Aldrich, cat. no. Z261378)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 ml syringe with 27G&#189; needle (Becton Dickinson, cat no. 309623)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml syringe (Becton Dickinson, cat. no. 309646)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Parafilm</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tube rotator, end-over-end</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microcentrifuge, refrigerated</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TracerDAQ (Measurement Computing)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf 5810R centrifuge</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td>
		</tr>
	</tbody>
</table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

La variazione genetica responsabile per l&#39;allele falciforme (HbS) consente eritrociti di resistere alle infezioni da parte del parassita della malaria, P. falciparum. La base molecolare di tale resistenza, che è noto per essere multifattoriale, rimane completamente compresa. Recenti studi hanno trovato che l&#39;espressione differenziale dei microRNA eritrocitari, una volta traslocati in parassiti della malaria, influenza sia regolazione genica e la crescita del parassita. Questi miRNA sono stati successivamente dimostrato di inibire la traduzione dell&#39;mRNA formando un RNA trascritto chimerico con 5 &#39;RNA fusione con sottoinsiemi discreti mRNA parassita. Qui, le tecniche che sono state utilizzate per studiare il ruolo funzionale e putative meccanismo sottostante microRNA eritrocitari sulla regolazione genica e il potenziale di traslazione del P. falciparum, compresa la trasfezione dei microRNA sintetici modificati negli eritrociti di accoglienza, sarà dettagliato. Infine, un metodo polysome gradiente è utilizzato per determinare il grado di Translation di queste trascrizioni. Insieme, queste tecniche hanno permesso di dimostrare che i livelli di microRNA sregolati eritrocitari contribuiscono alla cella-intrinseca resistenza della malaria di eritrociti falciformi.

Profilazione globale di microRNA umana in P. falciparum Le tecniche qui presentate sono stati usati per estrarre microRNAs parassitari in una varietà di condizioni. Una cosa da notare è che le estrazioni di RNA per i globuli rossi infetti sono stati effettuati, come indicato nel 32, che spesso serviva come punto di riferimento per i dati microRNA presentati sia in questo articolo e lo studio originale 29. Tali studi precedenti hanno anche dimostrato che eritrociti HBSS possedevano molto maggiori livelli di alcuni miRNA, miR-451 in particolare. Le tecniche sopra indicati sono stati sufficienti per dimostrare i cambiamenti di miRNA abbondanza in HBS (HBA) o HbSS parassiti infettanti. Campioni di RNA sono stati estratti come sopra indicato e normalizzati contro 18S rRNA. Campioni parassita da HbSS globuli rossi, per esempio, mostrano un aumento significativo dei livelli di diversi microRNA, tra miR-451 (Figura 1). L&#39;assorbimento di miRNA dal erythr accoglienzaocyte è anche coerente con gli studi precedenti 34,35. Trasfezione di eritrociti HbAA con miR-451 è aumentato HbAA miR-451 a livelli simili a eritrociti HBSS (Figura 1). Citometria a flusso è stato poi utilizzato per misurare parassita infezione, per valutare l&#39;effetto di miRNA traslocazione sulla crescita parassita. Sulla base di questo, eritrociti HbAA trasfettate con miR-451, miR-223 e miR-181, insieme a un oligo ssDNA, sono stati esaminati gli effetti di microRNA sulla crescita del parassita. Trasfezione di ssDNA o miR-181 non ha avuto effetto su di parassitemia (Figura 2A - D) mentre trasfezione con miR-451 notevolmente ridotta parassitemia, che potrebbe essere mitigato solo da co-trasfettando un antisenso miR-451 oligo. Blocco dei microRNA mediante trasfezione di 2&#39;-O-Me microRNA antisenso ha dimostrato un effetto reciproco. Eritrociti HBSS, con naturalmente più elevati livelli di miR-451, sono state trasfettate<html> con antisenso miR-451 o oligonucleotidi 2&#39;-O-metil (Figura 3). L&#39;inibizione di miR-451 è aumentata la crescita del parassita sia eritrociti HBSS (Figura 3C - F). Parasite percentuali sono state calcolate da almeno 3 trasfezioni indipendenti, quindi la media e presentato come piega cambiamento rispetto alla crescita HbSS (Figura 3F). Cattura di RNA di fusione miRNA-mRNA da biotina test di cattura Dopo trasfezione di 5&#39;-desthiobiotin-miR-451 (5&#39;Db-miR-451) e 5&#39;Db-miR-181, come indicato nei metodi sezione 5, è stato stabilito che la sequenza miRNA osservato origine con microRNA umano. qRT-PCR ha indicato che la transfezione di 5&#39;Db-miR-451 ha portato un arricchimento di trascritti di fusione PKA-R (Figura 4). Separazione polysome per determinare la occupazione ribosomiale di P. falciparum tenda &quot;&gt; Un tipico A 254 traccia è mostrato in Figura 5A (con conferma settentrionale contenuti rRNA in Figura 5B), con la densità frazione crescente da sinistra a destra del grafico (ovvero frazioni più leggere a sinistra). Il primo A 254 è piuttosto elevato a causa di assorbanza per emoglobina nelle prime frazioni, ma rapidamente scende al basale. Il primo piccolo picco corrisponde alla subunità ribosomiale (40S), seguita rapidamente dal secondo picco, che è leggermente più grande e corrisponde alla grande ribosomiale subunità (60S). Il terzo picco, che è generalmente il più grande per P. falciparum, corrisponde al picco monosome (80S). A causa della sua altezza, il 80S deve essere utilizzato come guida per regolare la sensibilità del rivelatore UV per le esecuzioni successive (passo 6.17). Inoltre, a causa delle dimensioni del picco 80S, è comune per i 60S segnale di sfocatura come &quot;spalla&quot; in l&#39;inizio del picco monosome, se entrambi i 60S e 80Ssegnali sono grandi. Dopo il picco monosome sono picchi corrispondenti ai polisomi. Ogni picco successivo rappresenta una frazione polysome rappresentano numeri progressivamente più grandi di ribosomi (2, 3, 4, ecc). Ogni picco polysome è anche più piccolo rispetto al picco precedente, diminuendo in altezza di 2-3 volte con ogni numero polysome successiva. Piste tipici consentiranno la risoluzione di polisomi composti da 5-7 ribosomi, sebbene risoluzione fino a un polysome 9-mer è stata osservata in alcune piste con una grande quantità di materiale di partenza. Polisomi ordine superiore compongono il resto della traccia, e non possono essere risolti in queste condizioni di gradiente. <img alt="Figura 1" src="/files/ftp_upload/53214/53214fig1.jpg" /> Figura 1: miR-451 sono elevati negli eritrociti HBSS Intraparasitic miR-451 livelli, come determinato dal real-time PCR e normalizzata contro 18S rRNA, da parassiti isolati dal indicata.Tipi degli eritrociti. I valori sono media ± SE. <img alt="Figura 2" src="/files/ftp_upload/53214/53214fig2.jpg" /> Figura 2: sovraespressione di miR-451 negli eritrociti normale inibisce la crescita del parassita (A - C) trame FACS rappresentativi che indicano tassi di infezione, come percentuale del totale RBC, sono indicate dal m1, per i tipi di eritrociti indicati.. (D) i tassi di infezione compositi derivati ​​da FACS e normalizzati contro untransfected HbAA globuli rossi. Valori in AC pannello sono rappresentativi FACS trame mentre D è media ± SE. <img alt="Figura 3" src="/files/ftp_upload/53214/53214fig3.jpg" /> Figura 3:. L&#39;inibizione di miR-451 negli eritrociti falciforme eleva la crescita del parassita (A - E) FACS Rappresentante trame che indicano tassi di infezione, come percentuale del totale RBC, indicati con m1, per l&#39;er indicatoTipi ythrocyte. (F) i tassi di infezione compositi derivati ​​da FACS e tracciati come un valore normalizzato contro untransfected HbAA globuli rossi. I valori nel pannello AE sono rappresentativi FACS trame, F è media ± SE. <img alt="Figura 4" src="/files/ftp_upload/53214/53214fig4.jpg" /> Figura 4: Transfection di miR-451 si arricchisce di trascritti di fusione PKA-R e mostra che il miRNA fusa è eritrocitaria origine Arricchimento dei trascritti di fusione indicate desthiobiotin coniugato miRNA-mRNA che sono stati catturati da streptavidina.. I valori sono stati misurati utilizzando real-time PCR e tracciati come un valore relativo rispetto parassiti non transfettate. I valori sono media ± SE. <img alt="Figura 5" src="/files/ftp_upload/53214/53214fig5.jpg" /> Figura 5:. Ribosomi parassita può essere isolate tramite gradiente di saccarosio (A - B) example tracce di un profilo polysome estratto da Plasmodium falciparum. (A) Traccia di un profilo polysome estratto da Plasmodium falciparum, con gli anni &#39;40, &#39;60, &#39;80 e picchi polysome (con #s indicanti il numero dei ribosomi associati) visualizzato. (B) Northern blot di 18S e 28S rRNA attraverso le frazioni ribosomiale. I valori sono media ± SE.

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Metodi per studiare il ruolo di regolamentazione dei piccoli RNA ribosomiale e di occupazione<em&gt; Plasmodium falciparum</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K Views.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Video: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the disease, is characterised by an accumulation of Plasmodium falciparum infected red blood cells (iRBC) at pigmented trophozoite stage in the microvasculature of the brain2-4. This microvessel obstruction (sequestration) leads to acidosis, hypoxia and harmful inflammatory cytokines (reviewed in 5). Sequestration is also found in most microvascular tissues of the human body2, 3. The mechanism by which iRBC attach to the blood vessel walls is still poorly understood.
The immortalized Human Brain microvascular Endothelial Cell line (HBEC-5i) has been used as an in vitro model of the blood-brain barrier6. However, Plasmodium falciparum iRBC attach only poorly to HBEC-5i in vitro, unlike the dense sequestration that occurs in cerebral malaria cases. We therefore developed a panning assay to select (enrich) various P. falciparum strains for adhesion to HBEC-5i in order to obtain populations of high-binding parasites, more representative of what occurs in vivo.
A sample of a parasite culture (mixture of iRBC and uninfected RBC) at the pigmented trophozoite stage is washed and incubated on a layer of HBEC-5i grown on a Petri dish. After incubation, the dish is gently washed free from uRBC and unbound iRBC. Fresh uRBC are added to the few iRBC attached to HBEC-5i and incubated overnight. As schizont stage parasites burst, merozoites reinvade RBC and these ring stage parasites are harvested the following day. Parasites are cultured until enough material is obtained (typically 2 to 4 weeks) and a new round of selection can be performed. Depending on the P. falciparum strain, 4 to 7 rounds of selection are needed in order to get a population where most parasites bind to HBEC-5i. The binding phenotype is progressively lost after a few weeks, indicating a switch in variant surface antigen gene expression, thus regular selection on HBEC-5i is required to maintain the phenotype.
In summary, we developed a selection assay rendering P. falciparum parasites a more "cerebral malaria adhesive" phenotype. We were able to select 3 out of 4 P. falciparum strains on HBEC-5i. This assay has also successfully been used to select parasites for binding to human dermal and pulmonary endothelial cells. Importantly, this method can be used to select tissue-specific parasite populations in order to identify candidate parasite ligands for binding to brain endothelium. Moreover, this assay can be used to screen for putative anti-sequestration drugs7.

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

An in vitro model for cerebral malaria sequestration is described1. Plasmodium falciparum infected red blood cells are selected for binding to immortalized human brain microvascular endothelial cells. The selected parasites show a distinct phenotype. The selection process can be applied using various P. falciparum strains and endothelial cell lines.

Selezione di Plasmodium falciparum Parassiti per Cytoadhesion alle cellule cerebrali umane endoteliali

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the ...

Ricerca

Immunologia e infezioni

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

An Introduction to vespe parassite di<em&gt; Drosophila</em&gt; E la risposta immunitaria antiparassitari

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Two Methods of Heterokaryon Formation to Discover HCV Restriction Factors

Hepatitis C virus (HCV) is a hepatotropic virus with a host-range restricted to humans and chimpanzees. Although HCV RNA replication has been observed in human non-hepatic and murine cell lines, the efficiency was very low and required long-term selection procedures using HCV replicon constructs expressing dominant antibiotic-selectable markers1-5. HCV in vitro research is therefore limited to human hepatoma cell lines permissive for virus entry and completion of the viral life cycle. Due to HCVs narrow species tropism, there is no immunocompetent small animal model available that sustains the complete HCV replication cycle 6-8. Inefficient replication of HCV in non-human cells e.g. of mouse origin is likely due to lack of genetic incompatibility of essential host dependency factors and/or expression of restriction factors.
We investigated whether HCV propagation is suppressed by dominant restriction factors in either human cell lines derived from non-hepatic tissues or in mouse liver cell lines. To this end, we developed two independent conditional trans-complementation methods relying on somatic cell fusion. In both cases, completion of the viral replication cycle is only possible in the heterokaryons. Consequently, successful trans-complementation, which is determined by measuring de novo production of infectious viral progeny, indicates absence of dominant restrictions.
Specifically, subgenomic HCV replicons carrying a luciferase transgene were transfected into highly permissive human hepatoma cells (Huh-7.5 cells). Subsequently, these cells were co-cultured and fused to various human and murine cells expressing HCV structural proteins core, envelope 1 and 2 (E1, E2) and accessory proteins p7 and NS2. Provided that cell fusion was initiated by treatment with polyethylene-glycol (PEG), the culture released infectious viral particles which infected na&iuml;ve cells in a receptor-dependent fashion.
To assess the influence of dominant restrictions on the complete viral life cycle including cell entry, RNA translation, replication and virus assembly, we took advantage of a human liver cell line (Huh-7 Lunet N cells 9) which lacks endogenous expression of CD81, an essential entry factor of HCV. In the absence of ectopically expressed CD81, these cells are essentially refractory to HCV infection 10 . Importantly, when co-cultured and fused with cells that express human CD81 but lack at least another crucial cell entry factor (i.e. SR-BI, CLDN1, OCLN), only the resulting heterokaryons display the complete set of HCV entry factors requisite for infection. Therefore, to analyze if dominant restriction factors suppress completion of the HCV replication cycle, we fused Lunet N cells with various cells from human and mouse origin which fulfill the above mentioned criteria. When co-cultured cells were transfected with a highly fusogenic viral envelope protein mutant of the prototype foamy virus (PFV11) and subsequently challenged with infectious HCV particles (HCVcc), de novo production of infectious virus was observed. This indicates that HCV successfully completed its replication cycle in heterokaryons thus ruling out expression of dominant restriction factors in these cell lines. These novel conditional trans-complementation methods will be useful to screen a large panel of cell lines and primary cells for expression of HCV-specific dominant restriction factors.

We describe two methods for conditional trans-complementation of hepatitis C virus (HCV) assembly and the completion of the full viral life cycle, which rely on heterokaryon formation. These techniques are suitable to screen for cell lines that express dominant restriction factors, which preclude production of infectious HCV progeny.

Due metodi di Formazione Heterokaryon per scoprire fattori di restrizione HCV

Hepatitis C virus (HCV) is a hepatotropic virus with a host-range restricted to humans and chimpanzees. Although HCV RNA replication has been observed in ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Un<em&gt; In vitro</em&gt; Co-infezione da modello per lo studio<em&gt; Plasmodium falciparum</em&gt;-HIV-1 in Interazioni umane Le cellule immunitarie primarie derivate da monociti

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully understood and several hypotheses have been put forward, including mechanical obstruction of microvessels by P. falciparum-parasitized red blood cells (pRBC). Indeed, during the intra-erythrocytic stage of its life cycle, P. falciparum has the unique ability to modify the surface of the infected erythrocyte by exporting surface antigens with varying adhesive properties onto the RBC membrane. This allows the sequestration of pRBC in multiple tissues and organs by adhesion to endothelial cells lining the microvasculature of post-capillary venules 1. By doing so, the mature forms of the parasite avoid splenic clearance of the deformed infected erythrocytes 2 and restrict their environment to a more favorable low oxygen pressure 3. As a consequence of this sequestration, it is only immature asexual parasites and gametocytes that can be detected in peripheral blood.
Cytoadherence and sequestration of mature pRBC to the numerous host receptors expressed on microvascular beds occurs in severe and uncomplicated disease. However, several lines of evidence suggest that only specific adhesive phenotypes are likely to be associated with severe pathological outcomes of malaria. One example of such specific host-parasite interactions has been demonstrated in vitro, where the ability of intercellular adhesion molecule-1 to support binding of pRBC with particular adhesive properties has been linked to development of cerebral malaria 4,5. The placenta has also been recognized as a site of preferential pRBC accumulation in malaria-infected pregnant women, with chondrotin sulphate A expressed on syncytiotrophoblasts that line the placental intervillous space as the main receptor 6. Rosetting of pRBC to uninfected erythrocytes via the complement receptor 1 (CD35)7,8 has also been associated with severe disease 9.
One of the most recently described P. falciparum cytoadherence phenotypes is the ability of the pRBC to form platelet-mediated clumps in vitro. The formation of such pRBC clumps requires CD36, a glycoprotein expressed on the surface of platelets. Another human receptor, gC1qR/HABP1/p32, expressed on diverse cell types including endothelial cells and platelets, has also been shown to facilitate pRBC adhesion on platelets to form clumps 10. Whether clumping occurs in vivo remains unclear, but it may account for the significant accumulation of platelets described in brain microvasculature of Malawian children who died from CM 11. In addition, the ability of clinical isolate cultures to clump in vitro was directly linked to the severity of disease in Malawian 12 and Mozambican patients 13, (although not in Malian 14).
With several aspects of the pRBC clumping phenotype poorly characterized, current studies on this subject have not followed a standardized procedure. This is an important issue because of the known high variability inherent in the assay 15. Here, we present a method for in vitro platelet-mediated clumping of P. falciparum with hopes that it will provide a platform for a consistent method for other groups and raise awareness of the limitations in investigating this phenotype in future studies. Being based in Malawi, we provide a protocol specifically designed for a limited resource setting, with the advantage that freshly collected clinical isolates can be examined for phenotype without need for cryopreservation.

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

This method investigates the platelet-mediated clumping phenotype of Plasmodium falciparum-infected erythrocytes (pRBC) in clinical isolates. This is performed by isolating and co-incubating platelet-rich plasma and a suspension of pRBC.

Un semplice protocollo per Clumping piastrinica mediata da<em&gt; Plasmodium falciparum</emEritrociti&gt; infette in una risorsa Povero Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully ...

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

We describe a method for isolation and characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. Infection of susceptible mouse-strains with this parasite strain results in the induction of experimental cerebral malaria, a neurologic syndrome that recapitulates certain important aspects of Plasmodium falciparum-mediated severe malaria in humans 1,2 . Mature forms of blood-stage malaria express parasitic proteins on the surface of the infected erythrocyte, which allows them to bind to vascular endothelial cells. This process induces obstructions in blood flow, resulting in hypoxia and haemorrhages 3 and also stimulates the recruitment of inflammatory leukocytes to the site of parasite sequestration.
Unlike other infections, i.e neutrotopic viruses4-6, both malaria-parasitized red blood cells (pRBC) as well as associated inflammatory leukocytes remain sequestered within blood vessels rather than infiltrating the brain parenchyma. Thus to avoid contamination of sequestered leukocytes with non-inflammatory circulating cells, extensive intracardial perfusion of infected-mice prior to organ extraction and tissue processing is required in this procedure to remove the blood compartment. After perfusion, brains are harvested and dissected in small pieces. The tissue structure is further disrupted by enzymatic treatment with Collagenase D and DNAse I. The resulting brain homogenate is then centrifuged on a Percoll gradient that allows separation of brain-sequestered leukocytes (BSL) from myelin and other tissue debris. Isolated cells are then washed, counted using a hemocytometer and stained with fluorescent antibodies for subsequent analysis by flow cytometry.
This procedure allows comprehensive phenotypic characterization of inflammatory leukocytes migrating to the brain in response to various stimuli, including stroke as well as viral or parasitic infections. The method also provides a useful tool for assessment of novel anti-inflammatory treatments in pre-clinical animal models.

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

A method for isolation of adherent inflammatory leukocytes from brain blood vessels of Plasmodium berghei ANKA-infected mice is described. The method allows quantification as well as phenotypic characterization of isolated leukocytes after staining with fluorescent antibodies and subsequent analysis by flow cytometry.

Isolamento e analisi di Brain-sequestrati da leucociti<em&gt; Plasmodium berghei</em&gt; ANKA topi infettati

We describe a method for isolation and  characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. ...

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the &asymp;40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. 
When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte.
Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite.
Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing.

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

The paramagnetic properties of hemozoin are used to isolate late stages of Plasmodium falciparum-infected red blood cells growing in culture. The method is simple and fast and does not affect the subsequent invasive capabilities of the parasites.

Separazione dei<em&gt; Plasmodium falciparum</em&gt; Fine Stage-eritrociti infettati da mezzi magnetici

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ...

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of free merozoites from the blood by phagocytic cells. However assessing the functional efficacy of merozoite specific opsonizing antibodies is challenging due to the short half-life of merozoites and the variability of primary phagocytic cells. Described in detail herein is a method for generating viable merozoites using the E64 protease inhibitor, and an assay of merozoite opsonin-dependent phagocytosis using the pro-monocytic cell line THP-1. E64 prevents schizont rupture while allowing the development of merozoites which are released by filtration of treated schizonts. &#160;Ethidium bromide labelled merozoites are opsonized with human plasma samples and added to THP-1 cells. Phagocytosis is assessed by a standardized high throughput protocol. Viable merozoites are a valuable resource for assessing numerous aspects of P. falciparum biology, including assessment of immune function. Antibody levels measured by this assay are associated with clinical immunity to malaria in naturally exposed individuals. The assay may also be of use for assessing vaccine induced antibodies. &#160;

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Measuring antibody function is key to understanding immunity to Plasmodium falciparum malaria. This method describes the purification of viable merozoites, and measurement of opsonization-dependent phagocytosis by flow cytometry.

High Yield Purificazione di<em&gt; Plasmodium falciparum</em&gt; Merozoiti Per l&#39;uso in opsonizzante anticorpo saggi

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

Lo sviluppo di cellule staminali derivate antigene-specifiche cellule T regolatorie contro autoimmunità

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

Using Phylogenetic Analysis to Investigate Eukaryotic Gene Origin

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct a tree to show the evolutionary relationship among different taxa (classification units) at the molecular level. Phylogenetic analysis can also be used to investigate domain relationships within an individual taxon, particularly for organisms that have undergone substantial change in morphology and physiology, but for which researchers lack fossil evidence due to the organisms&#39; long evolutionary history or scarcity of fossilization.
In this text, a detailed protocol is described for using the phylogenetic method, including amino acid sequence alignment using Clustal Omega, and subsequent phylogenetic tree construction using both Maximum Likelihood (ML) of Molecular Evolutionary Genetics Analysis (MEGA) and Bayesian Inference via MrBayes. To investigate the origin of eukaryotic Sugars Will Eventually be Exported Transporters (SWEET) genes, 228 SWEETs including 35 SWEET proteins from unicellular eukaryotes and 57 SemiSWEET proteins from prokaryotes were analyzed. Interestingly, SemiSWEETs were found in prokaryotes, but SWEETs were found in eukaryotes. Two phylogenetic trees constructed using theoretically distinct methods have consistently&#160;suggested that the first eukaryotic SWEET gene might stem from the fusion of a bacterial SemiSWEET gene and an archaeal SemiSWEET gene.&#160;It is worth noting that one should be cautious to draw a conclusion based only on phylogenetic analysis, although it is useful to explain the underlying relationship between different taxa, which is difficult or even impossible to discern through experimental means.

A method of constructing a phylogenetic tree based on sequence homology of SWEETs from eukaryotes and SemiSWEETs from prokaryotes is described. Phylogenetic analysis is a useful tool for explaining the evolutionary relatedness between homologous proteins or genes from different organism groups.

Utilizzando l'analisi filogenetica di indagare l'origine genica negli eucarioti

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct ...

Metodi per studiare il ruolo di regolamentazione dei piccoli RNA ribosomiale e di occupazione

Riepilogo

Esplora Altri Video

Capitoli in questo video

Selezione di Plasmodium falciparum Parassiti per Cytoadhesion alle cellule cerebrali umane endoteliali

An Introduction to vespe parassite di

Due metodi di Formazione Heterokaryon per scoprire fattori di restrizione HCV

Un

Un semplice protocollo per Clumping piastrinica mediata da

Isolamento e analisi di Brain-sequestrati da leucociti

Separazione dei

High Yield Purificazione di

Lo sviluppo di cellule staminali derivate antigene-specifiche cellule T regolatorie contro autoimmunità

Utilizzando l'analisi filogenetica di indagare l'origine genica negli eucarioti