이 작품은 독일의 국립 과학 재단 (DFG)와 위험 평가 연방 연구소 (BfR, 독일)에 의해 지원되었다.

네 개의 주요 단계를 포함하는 프로토콜의 설계 이상의 그림 1에 그려져 있습니다. 모든 단계는 전체 상세하게 설명되어 있습니다. 약 24 시간 공촛점 이미징 다음 세포 분리, 전달 및 문화, 나중에 연속과 의무 timescale입니다. 바이러스 공사는 앞으로 세포 고립 완료해야 다음 유전자 전달에 사용됩니다. 1. 쥐의 심장에서 성인 심장 myocytes의 분리 <ol><li> 성인 남성 위스타 쥐 무게가 약 250g이 (오래된 6-12 주) 100g의 bodyweight 당 170 μl 마취 솔루션의 intraperitoneal 주사로 anesthetised 아르 </li><li> 또한, 구연 산염 솔루션 (2 μl / g 체중)는 수술 중 혈액 응고를 방지하기 위해 주입니다. </li><li> Langendorff 재관류 설정이 준비되어야합니다. 모든 솔루션은 산소 포화해야합니다. </li><li> 쥐가 anesthetised 때, 동물은 수술 보드에 고정하고 신체의 상단 부분은 70 % 에탄올로 소독합니다. </li><li> 동물은 경동맥을 통해 절단에 의해 살해됩니다. </li><li> 흉부는 가위를 사용하여 열립니다. 심장과 대동맥 지금은 액세스할 수 있어야합니다. pericard가 제거됩니다. </li><li> 얼음처럼 차가운 솔루션 A +는 (5 ML) 마음을 체포하고 혈액을 씻어 26 게이지 바늘을 사용하여 두 심실에 주입합니다. </li><li> 대동맥은 클램프로 잡고 대동맥 아치에서 잘립니다 단지 첫 번째 분기가 발생되었습니다. </li><li> 심장은 가슴에서 제거되고 대동맥을 역행 Langendorff - 재관류를 허용하도록 포셉하여 재관류 설정 및 클램프의 정맥에 첨부되어 있습니다. 대동맥 밸브를 foraminate하지 않을 수도 있습니다. </li><li> 심장은 대동맥 / 정맥 주위를 끈으로 고정해야합니다. 오픈 선박도 출혈도 잡았해야합니다. </li><li> 마음은 retrogradely 산소 포화 용액 약 70 mbar의 압력 10​​ 분 실온에서 A + (23 ° C)와 perfused 있습니다. 기포가이 대동맥을 입력하지 있는지 확인하십시오. </li><li> 재관류 솔루션 37 온도에서 Liberase 솔루션으로 전환됩니다 ° C 연동 펌프에 의해 4 ML / 분 속도로 약 25 분. 재관류의 끝에 마음은 대리석으로 흰색을 보일 것입니다. 소화 시간은 상황 / 조직 상태에 적응해야 할 수도 있습니다. </li><li> 마음은 재관류 설정에서 가져온 37 ° C.의 온도에서 배양 접시가 포함된 솔루션에 배치됩니다 남은 혈관과 심방은 차단됩니다. 혈관이 폐기되고 심방 - 필요한 경우는 (- 아니이 프로토콜의 일부) 다르게 처리됩니다. 심실은 약 6 조각으로 나누어집니다. </li><li> 조각은 37 ° C와 약간 5 분 37 ° C의 물을 욕조에 흥분.의 온도에서 20 ML 솔루션을 포함하는 100 ML Erlenmeyer 플라스크에 전송됩니다 마지막으로 뜨는가 삭제됩니다. </li><li> 위에서 설명한 절차는 한두 번 반복됩니다. 뜨는 약간 불투명 나타납니다. </li><li> 세포외 칼슘 농도의 증가는 37 용액 B 1 / 2 20 ML 추가 ° C를 세포 및 조직 솔루션의 잔류를 나머지에 의해 시작되는 Erlenmeyer 플라스크에. 이것은 약간 추가 5 분 37 ° C의 물을 욕조에 흥분 상태입니다. 이후에 뜨는이 삭제됩니다. </li><li> 20 ML 솔루션에게 추가 B 1 / 2를 추가합니다. (솔루션 / 뜨는 지금은 가능한 세포를 포함해야합니다.) 세포의 방울이 거꾸로 세포 배양 현미경에 페트리 접시로 전송됩니다. 세포가 높은 자발적인 활동 (수축) 세포가 휴식 올 때까지 기다려야 하나의 요구 사항을 표시하십시오. </li><li> 한 번 더 뜨는가 삭제됩니다 및 솔루션 B 1 / 2 20 ML이 추가됩니다. </li><li> 플라스틱 파스퇴르 피펫의 팁을은 오프닝을 통해 흥분하면 조직 조각을 쉽게 전달할 수있는 방법으로 잘라입니다. 화염 처리와 함께 날카로운 가장자리는 (녹아) 부드럽게됩니다. </li><li> 이제 조직 조각이 약간 있고 부드럽게 triturated. 조직 조각 세포에 &quot;다투지&quot;해야합니다. </li><li> 뜨는을 포함하고있는 세포는 decanted과 실험의 종류에 따라 차이가 있으며, 경험적으로 결정되어야하는 원하는 세포 밀도를 도달하는 솔루션을 B로 희석합니다. </li></ol> 2. 융합 단백질 전달에 대한 아데노 바이러스의 건설 adenoviruses 생산 MP의 Biomedicals에서 TRANSPOSE - 광고 Adenoviral 벡터 시스템은 1 사용됩니다. 이 프로토콜은 형광 융합 단백질 또는 GEB의 2에 사용할 수있는 항목 및 테스트 벡터 (pCR259)로 시작합니다. <ol><li> 관심있는 유전자를 포함하는 상기 초기 pCR259 벡터 10 NG의 금액을 100 μl HighQ - 1 TRANSPOSE - AD 294 ™ 유능한 세포로 변환됩니다. </li><li> 이 혼합물은 42 45 s에 대한 열 충격 ° C 다음과 추가 2 분 얼음에 저장된 얼음 20 분 incubated입니다. </li><li> 900 &amp; 뮤 추가, 4 시간 동안 교반과 함께 부드러운 unselective LB - 미디어 37에서 성장 ° C의 리터. </li><li> 플레이트 50 μl, Chloramphenicol (CM, 20 μg / ML), 암피실린 (100 μg / ML), 테트라 사이클린 (15 μg / ML), X - 걸 (280 μg / ML와 LB - 미디어를 포함하는 접시에 100 μl 200 μl )와 IPTG (40 μg / ML). (더 강렬하고 빠른 파란 얼룩이 300μg/ml로 더 비싼 염료 Bluo - 걀를 사용하여 가능합니다. 이것은 특히 사용해야합니다 당신이 백인 / 블루 식민지를 인식하고 구별에서 너무 익숙하지 않은 경우) </li><li> 37 24 시간 동안 성장 ° C. 블루 식민지 잘 식별이 가능 ° C까지 4 둡니다. 식민지는 식민지의 일부를 선택하고 복제 세 개의 항생제를 포함하는 다른 판, X - 걸과 IPTG와 그들이 37 박 이상 성장하게 ° 정말 하얀한지 결정하는 문제가있을 경우 C. 비고) HighQ - 1 TRANSPOSE - AD ™ 294 세포는 두 가지 중요한 plasmids 포함 위치한 아데노 바이러스 백본 (TRANSPOSE - 광고 ™ 294)과 타겟 사이트에 관심있는 유전자의 삽입을 mediates transposase을 표현하는 플라스미드 도우미를 플라스미드 전치 - AD 294의 LacZ 유전자 인치 </li><li> 바이러스 백본에 대한 관심의 유전자가 같은 2.7-2.9에서 설명한 식민지 - PCR을 수행 포함하는 긍정적인 식민지를 확인합니다. 여러 복제 사이트를 (앞으로 5 역방향 5 &#39;가 3 GCGGATAACAATTTCACACAGG&#39;, &#39;3 CCCAGTCACGACGTTGTAAAACG&#39;) 측면 벡터 primers를 사용하여 삽입된 유전자없이 백퍼센트 하얀 식민지와 식민지 PCR을 만들고 바꾸어 - AD 294 plasmids를 제어하는 등 파란 식민지를 사용하여 관심. 블루 식민지 당신에게 짧은 PCR의 조각 (~ 200bp), 관심의 유전자를 포함하는 식민지가 큰 PCR 제품 전시회 (관심의 유전자의 길이에 따라) 두 조각이 여러 세포 식민지 아르와 식민지를 포기하고 분리해야합니다 더 사용하면. </li><li> 마스터 믹스 아래 표에 따라 준비해야합니다. </li><li> autoclaved 이쑤시개와 함께 하나의 백퍼센트 하얀 식민지를 선택하고 첫번째 CM과 LB - 접시에이 식민지의 복제합니다. </li><li> PCR - 믹스에 식민지를 전송합니다. PCR - 믹스에이 PCR - 믹스를 많이 흡수도 전에 이쑤시개를 제거보다 3-4 회 그것을 보라고. PCR 프로토콜은 삽입하고 사용하는 효소의 킬로바이트에 따라 달라집니다. primers의 어닐링 온도가 57 ° C는 35 사이클의 사용을 권장합니다. </li><li> 긍정적인 클론의 밤 문화를 (CM과 LB - 중간)을 통해 성장과 원심력이 큰 바이러스 벡터를 방해하기 때문에, 스핀 컬럼없이 상업적인 사용 가능한 키트와 plasmids를 분리. </li><li> 100 μl DH5α 유능한 세포의 격리 plasmids 0.5 μg을 변환. 30 분 얼음 세포와 DNA를 품어. 42 열충격 45 S ° C 2 분 얼음 설정합니다. </li><li> 900 μl unselective LB - 미디어를 추가 ° C 부드러운 교반과 함께 1 시간 37 성장. </li><li> 플레이트 CM, X - 걸과 IPTG와 LB - 미디어를 포함하는 접시에 50 μl. 24 시간 동안 37 ° C에서 알을 품다. </li><li> 선택 별도의 암피실린, 테트라 싸이클린과 IPTG와 X - 걸이 포함된 Chloramphenicol 접시 20 백퍼센트 흰색 식민지까지 복제합니다. 그들이 37 박 이상의 성장하자 ° C. 백퍼센트 흰색, chloramphenicol 저항, 암피실린 및 tetracyclin 구분 식민지를 선택합니다. </li><li> 콜로니 - PCR (선택 사항) : 긍정적인 클론들은 삽입을 포함되었는지 확인하기 위해 식민지 - PCR로 다시 테스트할 수 있습니다. </li><li> 긍정적인 재조합의 단일 식민지를 선택하고 CM과 600 ML - LB 배지에서 성장. </li><li> 플라스미드 맥시 키트를 사용하여 플라스미드를 분리. </li><li> 37 두 시간 동안 팩 I와 플라스미드의 다이제스트 5 μg ° C 65에서 반응을 중지 ° C 20 분. </li><li> 10 μl의 최종 볼륨을 30 분 실온에서 Speed​​Vac에서 전체 텍스트를 집중 또는 페놀 - 클로로포름 추출 방법을 사용합니다. </li><li> 37 ° C의 물을 욕조에 부드러운 교반과 함께 냉동 QBI - HEK 293 세포의 병을 해동. 70 % 에탄올로 유리병의 바깥쪽을 씻어 살균 모자 무균 진행합니다. </li><li> , 멸균 15 ML 튜브에 세포를 전송하는 동안 부드러운 agitating dropwise 10 ML DMEM을 (10% FCS) 추가 및 250xg에서 펠릿 세포로 10 분 원심 분리기. </li><li> 뜨는 폐기하십시오. 부드럽게 위아래로 pipetting과 10 ML DMEM (10% FCS)의 펠렛을 Resuspend. </li><li> 75cm 두 플라스크에서 씨앗과 세포 10 % FCS 10 ML DMEM를 추가합니다. 37 박 이상 품어 ° 5 % CO 2 배양기에서 C. </li><li> 다음날 세포 밀도를 확인하십시오. QBI - HEK 293 세포는 1시 10분부터 1시 20분까지 비율로 분할해야합니다. </li><li> 세포에서 매체를 제거하고 1-3 분 2 ML의 트립신과 trypsinize. 10 분 250xg에서 세포 원심 분리기 10 ML DMEM주세요. </li><li> 신중하게 매체를 제거하고 세포 10 ML 새로운 매체를주고, resuspend 및 세포를 계산합니다. </li><li> 2x10 5 잘 여섯 잘 하나 3x10 5 플레이트 </s최대&gt; 4x10 5, 5x10 5 6x10 5 세포. 37 접시를 품어 ° C를 CO 2 배양기 인치 </li><li> 다음날에 집중 팩 I 소화와 transfect 50 %의 합류로 잘 사용합니다. 우리는 Lipofectamine 2000 transfection과 함께 좋은 경험을 가지고 있지만, 또한 다른 방법 (예 : 칼슘 인산염 transfection 등) 적합해야합니다. </li><li> 절차를 수행하는 동안 기하 급수적인 성장으로 세포를 얻을 transfection 전에 잘 3-4 H의 매체를 변경합니다. </li><li> 5 분 실온에서 250 μl DMEM과 부화 5 μl Lipofectamine를 섞습니다. </li><li> DNA에 Lipofectamine - 중간 혼합주세요 (팩 I 다이제스트)과 반응 관에 대한 도청으로 혼합, pipetting으로 혼합하지 않습니다. 상온에서 혼합 20 분 알을 품다. </li><li> 세포에 transfection 혼합물 내려 섞어 접시를 바위. 37 ° C 5 % CO 2를 품어. 4-5시간 후 매체를 변경합니다. </li><li> transfection 후 이틀은 세포의 매체를 가지고 새로운 문화 플라스크 (75cm 2)로 그것을 제공합니다. </li><li> 최대 5 분을 500 μl 트립신으로 세포를 Trypsinize. 세포 1 ML DMEM하고, 문화 플라스크에 17 ML 신선한 매체 (FCS와 DMEM)과 함께 전체 혼합물을 가지고 그것을 넣어. 37 세포를 배양하면 ° C 5 % CO 2 cytopathic 효과 (CPE)이 볼 때까지. CPE처럼 보일 것입니다 방법에 대한 자세한 내용은 그림 2를 참조하십시오. </li><li> 50 ML 튜브의 매체와 세포를 수집하여 -80에서 세포를 동결 ° C. 세 동결 / 해동주기 (-80 ° C/37 ° C 물 목욕)와 세포를 휴식. </li><li> 8000xg 4에서 20 분 원심 분리기 ° C. 100mm - 직경 요리에 뜨는를 가만히 따르다하여 펠렛을 삭제. 여과액 뜨는로 0.45μm 기공 크기와 살균 필터를 사용합니다. 이것은 최초의 바이러스 주식 (통로 1)입니다. </li><li> 70 % 합류와 함께 QBI - HEK 293 세포와 75cm이 휴대용 술병을 transduce이 주식의 1 / 3을 사용합니다. 37 품어 ° C와 5% CO 2 CPE S 볼 때까지. </li><li> 세포가 CPE S들을 수집하고 한 번도 같은 바이러스를 추출 표시하십시오. 이것은 바이러스의 통로 2. </li><li> 단계 2.37 및 바이러스 통로와 2.38를 반복 2 이렇게까지에있는 바이러스의 증폭은 충분한 바이러스 주식에 도달합니다. 바이러스는 특정 원심 분리 튜브 (Millipore에서 ultracel - 100 멤브레인와 Amicon 울트라 - 15 원심 필터 단위)를 집중하고 -80 ° C.에서 몇 달 동안 저장할 수 있습니다 계산하려면 전염성 입자는 플라크 분석을 사용합니다. </li><li> 세포를 transduce과 바이러스의 더 증폭시키기위한 바이러스 통로 2 이상을 사용하십시오. </li></ol> 3. 기본 세포 배양 및 형질 도입 adenoviral <ol><li> 20mm 직경의 무균 원형 커버 전표는 표준 12 - 잘 접시에 배치됩니다. </li><li> 20 μl ECM 솔루션은 동일하게 각각의 표지 슬립에 배포됩니다. 유적은 삭제됩니다. 건조 37 1 H 최소에게 허용 ° C. 또는 코팅 방법으로 상온에서 (12 H) 밤 동안 건조하실 수 있습니다. </li><li> 각 잘은 항생제와 ITS로 구성된 보충 1 ML 매체 M199으로 가득합니다. </li><li> 200-400 μl의 세포 현탁액은 (1.21 단계에서) 각 잘에 추가됩니다. 세포의 Culturing 37에서 발생 ° 5 % CO 2 배양기에서 C. </li><li> 세포 침전 수 있으며 1 일 이후 H 매체가 변경됩니다. </li><li> 즉시 매체를 변경한 후 바이러스가 포함된 용액 (통로 2 이상에서)의 적절한 금액은 부드럽게 접시 로킹하여 혼합합니다. </li><li> 장기 문화 매체의 경우 2 일마다 변경됩니다. </li><li> transfection의 GEB 식을 후 24 시간이 감지할 수 있습니다. </li></ol> 4. 공촛점 3D subcellular 구조의 이미징 및 CA 2 + 신호 공촛점 이미징은 어떤 공촛점 현미경을 수행할 수 있습니다. 그러나, 칼슘 영상 실험은 적어도 비디오 속도 (25-30 Hz에서)의 수집 속도를 필요로합니다. 이것은 다중 빔 스캐너 (예 : Nipkow 디스크, 필드 또는 킬로 - 빔 배열 스캐너를 휩쓸) 또는 매우 빠른 단일 빔 스캐너 (예 : 공명 스캐너 또는 음향 광학 디플 렉터 (AOD) - 스캐너)로 사용 가능한 기술을 제한합니다. 개요를 보려면 참조를 참조하십시오. 3. 3D - subcellular 이미지는 Z - 드라이브가 필요합니다. 여기 킬로 - 빔 배열 스캐너 (VTinfinity, VisiTech INT., 선더랜드, 영국)가 사용됩니다. <ol><li> 현미경 및 주변 기기가 작동 모드로 설정해야합니다. 안정적인 출력에 도달할 때까지 특히 레이저에 대한이 기간까지 온난 화를 요구할 수 있습니다. </li><li> 세포 실험 챔버 (커버 - 미끄럼 전송)로 전송해야합니다. 전지 coverslips는 실험 챔버로 전송됩니다. 1mL Tyrode 솔루션은 (1.8 MM 세포외 칼슘을 포함)가 추가됩니다. </li><li> 실험 챔버는 현미경 스테이지에 배치해야합니다. 자극 전극, 재관류의 설정 및 periphe 추가ral 장치, 예를 들어 온도 제어가 적절하게 정렬해야합니다. </li><li> 세포에 초점과 흰색 빛을 및 / 또는 epifluorescent 조명을 사용하여 선택됩니다. </li><li> 이러한 레이저의 파워, 노출 시간 등 또는 전체 실험 프로토콜로 수집 파라미터 셋업이 필요합니다. </li><li> 시계열 및 / 또는 Z - 섹션 이미지가 취득하실 수 있습니다. </li><li> 설정 추가 고급 다중 측정에 전기 생리학 (패치 - 클램프) 또는 / 및 형광 photobleach 후 재배포 (FRAP) 또는 두 개의 광자의 광분해를 포함한 물질의 uncaging 같은 광학 조작을 사용하여 수행할 수 있습니다. </li><li> 이미지 분석, 특히 3D - 재건 그러한 Imaris (Bitplane AG, 취리히, 스위스), 속도 (순발력, 코번 트리, 영국) 또는 Arivis 브라우저 (arivis GmbH를, 로스 토크, 독일)와 같은 전용 분석 소프트웨어에서 수행됩니다. </li></ol> 5. 대표 결과 : 프로토콜의 최종 결과는 더 이상 데이터를 추출하는 데 사용할 수있는 이미지 시퀀스입니다. 예를 들어 subcellular organelles의 구조와 조사입니다. 그림 3은 잠돌군 Zz 장치의 3 차원 배열의 예제를 묘사. 전자 현미경과는 달리 모든 조사는 살아있는 세포에서 수행할 수 있습니다. <img src="/files/ftp_upload/1433/JoVEFig1.jpg" alt="그림 1" /> 그림 1 : 주요 실험 단계의 일반적인 흐름. <img src="/files/ftp_upload/1433/JoVEFig2.jpg" alt="그림 2" /> 그림 2 : 왼쪽 이미지가 transduced 없습니다 90~95%의 confluency과 문화의 Q - HEK 세포를 묘사. 바이러스 형질 도입 이후 Cytopatic 효과는 오른쪽 부분에 표시됩니다. 세포가 원형 접시의 바닥에서 분리합니다. 이러한 세포에는 핵이 활성화 바이러스 생산의 결과로 세포의 주요 부분을 차지하고 있습니다. <img src="/files/ftp_upload/1433/JoVEFig3.jpg" alt="그림 3" /> 그림 3 : 잠돌군 Zz 장치를 대상으로 YFP - 융합 단백질로 transfected 성인 쥐 심장 myocyte. adenoviral 유전자 전송 (문화 한 일) 이후에 심장 myocytes는 형광 융합 단백질을 표현. 패널 A는 Z - 스택에서 가져온 하나의 공촛점 조각을 묘사. 패널 B에서 같은 세포는 이론적 점 확산 함수 (PSF)를 사용 deconvolution 후 그려져 있습니다. 이 드 흐린 이미지 스택은 이후에 세포를 렌더링하고 패널 C 또는 3D 표면 재구성 (D)와 같이 3 차원 볼륨 재구성을하는 데 사용됩니다. 막대는 10 μm의를 나타냅니다.

<ol>
	<li>Kaestner, L., Ruppenthal, S., S, ., Licha, K., Lin, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Imaging II. Vol. 7370, 737008-737008 (2009).</li><li>Viero, C., Kraushaar, U., Ruppenthal, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+imaging+of+Drosophila+melanogaster+pupae+with+mesoscopic+fluorescence+tomography.">In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography.</a> Cell Calcium. 43 (1), 59-59 (2008).</li><li>Kaestner, L., Lipp, P., Shorte, S. L., Frischknecht, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Imaging Cellular and Molecular Biological Functions. , 289-289 (2007).</li><li>Kaestner, L., Lipp, P., Popp, J., von Bally, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Optics in Life Science. Vol. 6633, 66330K-66330K (2007).</li><li>Rinne, A., Littwitz, C., Bender, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus-mediated+delivery+of+short+hairpin+RNA+(shRNA)+mediates+efficient+gene+silencing+in+terminally+differentiated+cardiac+myocytes.">Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes.</a> Methods Mol Biol. 515, 107-107 (2009).</li></ol>

쥐 cardiomyocytes의 격리에 대한 설명하는 절차는 필요한 경우 다른 종, 예를 들어, 마우스 4 적용할 수 있습니다. 적응을 필요로 매개 변수는 소화 효소 혼합 (아래 참조) 또한 소화의 기간입니다. 종 (种) (예 : 마우스)의 세포가 다른 사람 (예 : 쥐)보다 약해있을 것을 알고 있습니다. collagenase의 선택은 아마도 격리 절차에서 가장 중요한 단계입니다. 그것이 거의없이 배?...

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>Anesthesia solution</td>
<td>&nbsp;</td>
<td>Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun)</td>
<td>&nbsp;</td>
<td>Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 &mu;l Rompun (2% Xylazinhydrochlorid)</td>
</tr>
<tr>
<td>Citrate solution</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>117,64 mg sodium citrate in 10 ml 0.9% NaCl solution</td>
</tr>
<tr>
<td>Solution A</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered</td>
</tr>
<tr>
<td>Solution A+</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered</td>
</tr>
<tr>
<td>Liberase solution</td>
<td>&nbsp;</td>
<td>F. Hoffmann&#x2010; La Roche Ltd.</td>
<td>11988476 001</td>
<td>500 &mu;l stock solution in 15 ml solution A (stock solution:
10 mg/ml Liberase Blendzyme 4 in aqua dest.)</td>
</tr>
<tr>
<td>Solution B</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>Content of solution A plus 200 &mu;M CaCl2 and 0.1% DNase solution</td>
</tr>
<tr>
<td>Solution B1/2</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>1:1 mixture of solution A and solution B</td>
</tr>
<tr>
<td>DNase solution</td>
<td>&nbsp;</td>
<td>Sigma&#x2010; Aldrich Co.</td>
<td>D4527</td>
<td>Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris&#x2010;HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithioerythritol; this solution is mixed with 5 ml glycerol</td>
</tr>
<tr>
<td>Extracellular matrix protein (ECM) solution</td>
<td>&nbsp;</td>
<td>Extracellular matrix protein (ECM) solution</td>
<td>E1270</td>
<td>1 ml stock solution as purchased is diluted with 6 mL
medium M199</td>
</tr>
<tr>
<td>Culture medium M199</td>
<td>&nbsp;</td>
<td>PAA</td>
<td>E15&#x2010;834</td>
<td>Medium M199 supplemented with 1 &mu;l/ml ITS solution and 20 &mu;l/ml penicillin&#x2010;streptomycin solution (5000 units/ml)</td>
</tr>
<tr>
<td>ITS solution</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>25 mg Insulin, 25 mg Transferrin and 50 &#x03BC;l Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clear
solution. Aliquots can be frozen.</td>
</tr>
<tr>
<td>Tyrode</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered</td>
</tr>
<tr>
<td>Master mix</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>5 &mu;l 10&#215;PCR&#x2010;Buffer, 5 &mu;l MgCl2 (25 mM), 2 &mu;l forward primer, 2 &mu;l reverse primer, 1 &mu;l dNTP&#180;s (10 mM each), 33 &mu;l H2O, 1 &mu;l DMSO, 1 &mu;l Taq&#x2010;DNA polymerase for each sample</td>
</tr>
<tr>
<td>LB&#x2010;Medium</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0</td>
</tr>
<tr>
<td>Pac I</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>R0547L</td>
<td>preparation: 50 &mu;g DNA, 5 &mu;l 10&#215;buffer, 0.5 &mu;l 100&#215;BSA,
0.75 &mu;l Pac I, fill with H2O up to final volume of 50&mu;l</td>
</tr>		</tbody>
		</table>
		</div>

isolation and genetic manipulation of adult cardiac myocytes for confocal imaging

어른 마음으로부터 격리 심장 myocytes 널리 어딘가 모델 한쪽에 배아 및 신생아 근육 세포, 다른 작업을 마음 사이의 중간 계산으로만 쓰여집니다. 따라서, cardiomyocytes 심장 세포 생리학과 pathophysiology 좋은 모델 역할, 제약 수사뿐만 아니라 유전자 변형 동물 모델의 탐험하십시오. 여기서 우리는 마음에서 세포를 분리하는 방법을 설명합니다. 또한 우리는 심장 myocytes에 대한 유전자 조작은 유전자 변형 동물을 사육하지 않고 수행할 수있는 방법을 보여주 : 이것은 장기적인 문화의 결합 (1 주) 및 adenoviral 유전자 전달됩니다. 후자의 하나는 바이러스의 건설에서 세포의 형질 도입에 설명되어 있습니다. 그것은 유전자 인코딩 bi​​osensors (GEBs), 형광 융합 단백질의 표현을 위해 사용뿐만 아니라 표현 이상의 단백질과 규정, 예를 들어 RNAi를 사용하여 아래하실 수 있습니다. 여기 subcellular 구조 (잠돌군 Zz)를 얼룩 융합 단백질의 표현에 대한 예제를 제공합니다. 이러한 단백질 표현 subcellular 구조의 3 차원 재건에 대한 Z - 스택의 공촛점 이미징에 의해 시각하실 수 있습니다. 프로토콜은 세포 배양, 분자 생물학 및 생물 물리학의 최첨단을 구성하며 따라서 세포 심장에 새로운 지평을 개척​​을위한 방법을 제공합니다.

Watch this Scientific Journal Video about Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging at JoVE.com

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

성인 심장 myocytes 동물 마음으로부터 격리하고 며칠 동안 교양 수있는 기본 세포입니다. 이 문화가 기간 내에 adenoviral 유전자 전송은 유전자 인코딩 bi​​osensors (GEBs) 또는 형광 융합 단백질을 표현하는 데 사용할 수 있습니다. 두 접근 방법 공촛점 현미경에 의해 세포 조사를 허용합니다.

공촛점 이미징에 대한 분리 및 성인 심장 Myocytes의 유전자 조작

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and ...

isolation-genetic-manipulation-adult-cardiac-myocytes-for-confocal

Research

JoVE Journal

Biology

14.5K 조회수.  Universty of Saarland. 성인 심장 myocytes 동물 마음으로부터 격리하고 며칠 동안 교양 수있는 기본 세포입니다. 이 문화가 기간 내에 adenoviral 유전자 전송은 유전자 인코딩 bi​​osensors (GEBs) 또는 형광 융합 단백질을 표현하는 데 사용할 수 있습니다. 두 접근 방법 공촛점 현미경에 의해 세포 조사를 허용합니다.

비디오: Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Primary Culture of Adult Rat Heart Myocytes

Cultured primary adult rodent heart cells are an important model system for cardiovascular research. Nevertheless, establishment of robust, viable cultured adult myocytes can be a technically challenging, rate-limiting step for many researchers. Here we described a protocol to obtain a high yield of adult rat heart myocytes that remain viable in culture for several days. The heart is isolated and perfused with collagenase and protease under low Ca2+ conditions to recover single myocytes. Ca2+-tolerant cells are obtained by stepwise increases in extracellular Ca2+ concentration in three subsequent wash steps. Cells are filtered, resuspended in culture medium, and plated on laminin coated slips. Cultured myocytes obtained using this protocol are viable for up to four days and are suitable for most experiments including electrophysiology, biochemistry, imaging and molecular biology.

In this paper, we described a typical way to isolate and culture adult rat heart myocytes. Collagenase and protease are used to digest and isolate single myocytes. Myocytes cultured follow this protocol meet most experiment requirements.

성인 쥐 심장 Myocytes의 차 문화

Cultured primary adult rodent heart cells are an important model system for cardiovascular research.  Nevertheless, establishment of robust, viable ...

연구

생물학

Dissection of Hippocampal Dentate Gyrus from Adult Mouse

The hippocampus is one of the most widely studied areas in the brain because of its important functional role in memory processing and learning, its remarkable neuronal cell plasticity, and its involvement in epilepsy, neurodegenerative diseases, and psychiatric disorders. The hippocampus is composed of distinct regions; the dentate gyrus, which comprises mainly granule neurons, and Ammon's horn, which comprises mainly pyramidal neurons, and the two regions are connected by both anatomic and functional circuits. Many different mRNAs and proteins are selectively expressed in the dentate gyrus, and the dentate gyrus is a site of adult neurogenesis; that is, new neurons are continually generated in the adult dentate gyrus. To investigate mRNA and protein expression specific to the dentate gyrus, laser capture microdissection is often used. This method has some limitations, however, such as the need for special apparatuses and complicated handling procedures. In this video-recorded protocol, we demonstrate a dissection technique for removing the dentate gyrus from adult mouse under a stereomicroscope. Dentate gyrus samples prepared using this technique are suitable for any assay, including transcriptomic, proteomic, and cell biology analyses. We confirmed that the dissected tissue is dentate gyrus by conducting real-time PCR of dentate gyrus-specific genes, tryptophan 2,3-dioxygenase (TDO2) and desmoplakin (Dsp), and Ammon's horn enriched genes, Meis-related gene 1b (Mrg1b) and TYRO3 protein tyrosine kinase 3 (Tyro3). The mRNA expressions of TDO2 and Dsp in the dentate gyrus samples were detected at obviously higher levels, whereas Mrg1b and Tyro3 were lower levels, than those in the Ammon's horn samples. To demonstrate the advantage of this method, we performed DNA microarray analysis using samples of whole hippocampus and dentate gyrus. The mRNA expression of TDO2 and Dsp, which are expressed selectively in the dentate gyrus, in the whole hippocampus of alpha-CaMKII+/- mice, exhibited 0.037 and 0.10-fold changes compared to that of wild-type mice, respectively. In the isolated dentate gyrus, however, these expressions exhibited 0.011 and 0.021-fold changes compared to that of wild-type mice, demonstrating that gene expression changes in dentate gyrus can be detected with greater sensitivity. Taken together, this convenient and accurate dissection technique can be reliably used for studies focused on the dentate gyrus.

A dissection technique for removal of the dentate gyrus from adult mouse under a stereomicroscope was demonstrated in this video-recorded protocol.

성인 마우스 Hippocampal 이가있는 이랑의 해부

The hippocampus is one of the most widely studied areas in the brain because of its important functional role in memory processing and learning, its ...

Isolation of Human Atrial Myocytes for Simultaneous Measurements of Ca2+ Transients and Membrane Currents

The study of electrophysiological properties of cardiac ion channels with the patch-clamp technique and the exploration of cardiac cellular Ca2+ handling abnormalities requires isolated cardiomyocytes. In addition, the possibility to investigate myocytes from patients using these techniques is an invaluable requirement to elucidate the molecular basis of cardiac diseases such as atrial fibrillation (AF).1 Here we describe a method for isolation of human atrial myocytes which are suitable for both patch-clamp studies and simultaneous measurements of intracellular Ca2+ concentrations. First, right atrial appendages obtained from patients undergoing open heart surgery are chopped into small tissue chunks ("chunk method") and washed in Ca2+-free solution. Then the tissue chunks are digested in collagenase and protease containing solutions with 20 &mu;M Ca2+. Thereafter, the isolated myocytes are harvested by filtration and centrifugation of the tissue suspension. Finally, the Ca2+ concentration in the cell storage solution is adjusted stepwise to 0.2 mM. We briefly discuss the meaning of Ca2+ and Ca2+ buffering during the isolation process and also provide representative recordings of action potentials and membrane currents, both together with simultaneous Ca2+ transient measurements, performed in these isolated myocytes.

Isolation of Human Atrial Myocytes for Simultaneous Measurements of Ca2+ Transients and Membrane Currents

We describe the isolation of human atrial myocytes which can be used for intracellular Ca2+ measurements in combination with electrophysiological patch-clamp studies.

칼슘의 동시 측정을위한 인간의 심방 근육 세포의 분리<sup&gt; 2 +</sup&gt; 과도하고 막 전류

The study of  electrophysiological properties of cardiac ion channels with the patch-clamp  technique and the exploration of cardiac cellular Ca2+ ...

Imaging Cell Membrane Injury and Subcellular Processes Involved in Repair

The ability of injured cells to heal is a fundamental cellular process, but cellular and molecular mechanisms involved in healing injured cells are poorly understood. Here assays are described to monitor the ability and kinetics of healing of cultured cells following localized injury. The first protocol describes an end point based approach to simultaneously assess cell membrane repair ability of hundreds of cells. The second protocol describes a real time imaging approach to monitor the kinetics of cell membrane repair in individual cells following localized injury with a pulsed laser. As healing injured cells involves trafficking of specific proteins and subcellular compartments to the site of injury, the third protocol describes the use of above end point based approach to assess one such trafficking event (lysosomal exocytosis) in hundreds of cells injured simultaneously and the last protocol describes the use of pulsed laser injury together with TIRF microscopy to monitor the dynamics of individual subcellular compartments in injured cells at high spatial and temporal resolution. While the protocols here describe the use of these approaches to study the link between cell membrane repair and lysosomal exocytosis in cultured muscle cells, they can be applied as such for any other adherent cultured cell and subcellular compartment of choice.

The process of healing injured cells involves trafficking of specific proteins and subcellular compartments to the site of cell membrane injury. This protocol describes assays to monitor these processes.

이미징 세포 막 상해 및 수리에 관여하는 세포 내 프로세스

The ability of injured cells to heal is a fundamental cellular process, but cellular and molecular mechanisms involved in healing injured cells are poorly ...

Isolation and Culture of Adult Mouse Cardiomyocytes for Cell Signaling and in vitro Cardiac Hypertrophy

Technological advances have made genetically modified mice, including transgenic and gene knockout mice, an essential tool in many research fields. Adult cardiomyocytes are widely accepted as a good model for cardiac cellular physiology and pathophysiology, as well as for pharmaceutical intervention. Genetically modified mice preclude the need for complicated cardiomyocyte infection processes to generate the desired genotype, which are inefficient due to cardiomyocytes&#8217; terminal differentiation. Isolation and culture of high quantity and quality functional cardiomyocytes will dramatically benefit cardiovascular research and provide an important tool for cell signaling transduction research and drug development. Here, we describe a well-established method for isolation of adult mouse cardiomyocytes that can be implemented with little training. The mouse heart is excised and cannulated to an isolated heart system, then perfused with a calcium-free and high potassium buffer followed by type II collagenase digestion in Langendorff retrograde perfusion mode. This protocol yields a consistent result for the collection of functional adult mouse cardiomyocytes from a variety of genetically modified mice.

Isolation and Culture of Adult Mouse Cardiomyocytes for Cell Signaling and in vitro Cardiac Hypertrophy

We describe a reliable method for isolation of adult mouse cardiomyocytes. This protocol yields a consistent result for the culture of functional adult cardiomyocytes from a variety of genetically modified mice.

분리 및 문화 성인 마우스 세포 신호 전달 용의 Cardiomyocytes과의<em&gt; 시험관</em&gt; 심장 비대

Technological advances have made genetically modified mice, including transgenic and gene knockout mice, an essential tool in many research fields. Adult ...

DNA Electroporation, Isolation and Imaging of Myofibers

Mature muscle has a unique structure that is amenable to live cell imaging. Herein, we describe the experimental protocol for expressing fluorescently labeled proteins in the flexor digitorum brevis (FDB) muscle. Conditions have been optimized to provide a large number of high quality myofibers expressing the electroporated plasmid while minimizing muscle damage. The method employs fluorescent tags on various proteins. Combining this expression method with high resolution confocal microscopy permits live cell imaging, including imaging after laser-induced damage. Fluorescent dyes combined with imaging of fluorescently-tagged proteins provides information regarding the basic structure of muscle and its response to stimuli.

This protocol utilizes electroporation to introduce and express fluorescently labeled proteins in mouse muscle fibers. Following recovery after electroporation, fibers are isolated. Individual fibers are then imaged using high resolution confocal microscopy to visualize muscle structure.

DNA 일렉트로, 근섬유의 분리 및 이미징

Mature muscle has a unique structure that is amenable to live cell imaging. Herein, we describe the experimental protocol for expressing fluorescently ...

Methods for the Isolation, Culture, and Functional Characterization of Sinoatrial Node Myocytes from Adult Mice

Sinoatrial node myocytes (SAMs) act as the natural pacemakers of the heart, initiating each heart beat by generating spontaneous action potentials (APs). These pacemaker APs reflect the coordinated activity of numerous membrane currents and intracellular calcium cycling. However the precise mechanisms that drive spontaneous pacemaker activity in SAMs remain elusive. Acutely isolated SAMs are an essential preparation for experiments to dissect the molecular basis of cardiac pacemaking. However, the indistinct anatomy, complex microdissection, and finicky enzymatic digestion conditions have prevented widespread use of acutely isolated SAMs. In addition, methods were not available until recently to permit longer-term culture of SAMs for protein expression studies. Here we provide a step-by-step protocol and video demonstration for the isolation of SAMs from adult mice. A method is also demonstrated for maintaining adult mouse SAMs in vitro and for expression of exogenous proteins via adenoviral infection. Acutely isolated and cultured SAMs prepared via these methods are suitable for a variety of electrophysiological and imaging studies.

Methods are demonstrated for the isolation of sinoatrial node myocytes (SAMs) from adult mice for patch clamp electrophysiology or imaging studies. Isolated cells can be used directly or can be maintained in culture to permit expression of proteins of interest, such as genetically encoded reporters.

성인 마우스에서 동방 노드 근육 세포의 분리, 문화 및 기능 특성화하는 방법

Sinoatrial node myocytes (SAMs) act as the natural pacemakers of the heart, initiating each heart beat by generating spontaneous action potentials (APs). ...

Isolation, Characterization, and Differentiation of Cardiac Stem Cells from the Adult Mouse Heart

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead myocardium after MI. Although several strategies have been used to regenerate myocardium, stem cell therapy remains a major approach to replenish the dead myocardium of an MI heart. Accumulating evidence suggests the presence of resident cardiac stem cells (CSCs) in the adult heart and their endocrine and/or paracrine effects on cardiac regeneration. However, CSC isolation and their characterization and differentiation toward myocardial cells, especially cardiomyocytes, remains a technical challenge. In the present study, we provided a simple method for the isolation, characterization, and differentiation of CSCs from the adult mouse heart. Here, we describe a density gradient method for the isolation of CSCs, where the heart is digested by a 0.2% collagenase II solution. To characterize the isolated CSCs, we evaluated the expression of CSCs/cardiac markers Sca-1, NKX2-5, and GATA4, and pluripotency/stemness markers OCT4, SOX2, and Nanog. We also determined the proliferation potential of isolated CSCs by culturing them in a Petri dish and assessing the expression of the proliferation marker Ki-67. For evaluating the differentiation potential of CSCs, we selected seven- to ten-days cultured CSCs. We transferred them to a new plate with a cardiomyocyte differentiation medium. They are incubated in a cell culture incubator for 12 days, while the differentiation medium is changed every three days. The differentiated CSCs express cardiomyocyte-specific markers: actinin and troponin I. Thus, CSCs isolated with this protocol have stemness and cardiac markers, and they have a potential for proliferation and differentiation toward cardiomyocyte lineage.

The overall goal of this article is to standardize the protocol for the isolation, characterization, and differentiation of cardiac stem cells (CSCs) from the adult mouse heart. Here, we describe a density gradient centrifugation method to isolate murine CSCs and elaborated methods for CSC culture, proliferation, and differentiation into cardiomyocytes.

절연, 특성, 및 성인 마우스 심장에서 심장 줄기 세포의 분화

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead ...

Isolation and Characterization of Adult Cardiac Fibroblasts and Myofibroblasts

Cardiac fibrosis in response to injury is a physiological response to wound healing. Efforts have been made to study and target fibroblast subtypes that mitigate fibrosis. However, fibroblast research has been hindered due to the lack of universally acceptable fibroblast markers to identify quiescent as well as activated fibroblasts. Fibroblasts are a heterogenous cell population, making them difficult to isolate and characterize. The presented protocol describes three different methods to enrich fibroblasts and myofibroblasts from uninjured and injured mouse hearts. Using a standard and reliable protocol to isolate fibroblasts will enable the study of their roles in homeostasis as well as fibrosis modulation.

Obtaining a pure population of fibroblasts is crucial to studying their role in wound repair and fibrosis. Described here is a detailed method to isolate fibroblasts and myofibroblasts from uninjured and injured mouse hearts followed by characterization of their purity and functionality by immunofluorescence, RTPCR, fluorescence-assisted cell sorting, and collagen gel contraction.

성인 심장 섬유 아세포 및 근섬유 아세포의 격리 및 특성화

Cardiac fibrosis in response to injury is a physiological response to wound healing. Efforts have been made to study and target fibroblast subtypes that ...

Simultaneous Isolation and Culture of Atrial Myocytes, Ventricular Myocytes, and Non-Myocytes from an Adult Mouse Heart

The isolation and culturing of cardiac myocytes from mice has been essential for furthering the understanding of cardiac physiology and pathophysiology. While isolating myocytes from neonatal mouse hearts is relatively straightforward, myocytes from the adult murine heart are preferred. This is because compared to neonatal cells, adult myocytes more accurately recapitulate cell function as it occurs in the adult heart in vivo. However, it is technically difficult to isolate adult mouse cardiac myocytes in the necessary quantities and viability, which contributes to an experimental impasse. Furthermore, published procedures are specific for the isolation of either atrial or ventricular myocytes at the expense of atrial and ventricular non-myocyte cells. Described here is a detailed method for isolating both atrial and ventricular cardiac myocytes, along with atrial and ventricular non-myocytes, simultaneously from a single mouse heart. Also provided are the details for optimal cell-specific culturing methods, which enhance cell viability and function. This protocol aims not only to expedite the process of adult murine cardiac cell isolation, but also to increase the yield and viability of cells for investigations of atrial and ventricular cardiac cells.

A method is described for the simultaneous isolation of myocytes and non-myocytes from both the atria and ventricles of a single adult mouse heart. This protocol results in consistent yields of highly viable cardiac myocytes and non-myocytes and details optimal cell-specific culture conditions for phenotyping and in vitro analysis.

성인용 마우스 심장에서 심방 심근 세포, 심실 심근 세포 및 비근구의 동시 격리 및 문화

The isolation and culturing of cardiac myocytes from mice has been essential for furthering the understanding of cardiac physiology and pathophysiology. ...