이 작품은 FPRFPR에 YS, RSL의 알프레드 P. 슬로안 재단의 교부금 및 건강 교부금의 미국 국립 연구소 R01 HG003224와 R21 CA130266에 미국 국방 고급 연구 프로젝트 기관 계약 N66001-12-C-4039에 의해 지원했던 건 또한 고급 연구 캐나다 연구소에서 친목 의해 캐나다 우수 연구 의자 프로그램에 의해 지원됩니다.

1. ProMonsters의 생성 <ol><li> tetO 2 GFP 마커와 순서와 프리 머를 사용하여 플라스미드 pYOGM012 (암피실린 저항)에서 URA3 마커를 증폭하여 보편적 인 GFP 교체 카세트 준비 : GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG 및 GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (굵게 표시된 지역 타겟이 분명한 교체를 허용 KanMX4 카세트의 측면을 노릴 지역에 호몰 로지를 제공합니다). PCR 반응은 Phusion의 효소 HF 버퍼, 그리고 0.5 NG / μl의 템플릿 DNA 농도로 시작 3퍼센트 디메틸 sulfoxide (뉴 잉글랜드 BioLabs)를 수행해야합니다. PCR 프로그램은 98 10 초 30 초 및 98 ° C의 35주기위한 ° C, 49 ° 30 초에 C, 그리고 1.5 분 72 ° C입니다. 반응 볼륨 각 변환 실험에 충분한 DNA를 제공하기 위해&gt; 50 μl해야합니다. 우리는 정화열 당 처리 PCR 반응 ~ 50 μl로 QIAquick PCR 정화 키트 (Qiagen)를 사용하지만, 정화 단계를 건너 뛰는 제품은 transformants의 수익율을 증가시킬 수있다. 또는 제한 효소 EcoRI (뉴 잉글랜드 BioLabs)를 사용하여 플라스미드 pYOGM057 (암피실린 저항)를 소화하여 타겟팅이 tetO 2 GFP 및 KanMX4에 대한 동종 URA3 마커뿐만 아니라 지역을 포함하는 조각을 놓습니다. 이 반응에서 DNA의 농도는 ~ 30 NG / μl해야합니다. 반응 볼륨&gt; 34 μl해야합니다. KanMX4 이외의 지역에 GFP 카세트 통합은 적절한 동종 시퀀스에 위의 PCR의 프리 머의 호몰 로지 영역을 조정합니다. </li><li> 보편적 인 GFP 삭제 카세트와 KanMX4 효모 한방 수집 12-haploid 부담을 변환 할 수 있습니다. 의 우즈와 Gietz 13 0.34 μl의 프로토콜에 따라DNA 샘플은 (정화 PCR 제품 또는 비 정화 제한 다이제스트) 각 변환 실험을 위해 사용되어야합니다. 판 CAA-우라 판로 변환 혼합물의 다섯 번째 (0.67 % 효모 질소 기지, 2 % 포도당, 0.6 % casamino 산, 0.0025 % 아데닌 hemisulfate, 0.005 %의 트립토판, 2 %의 한천). </li><li> 절연 식민지를 얻기 위해 신선한 CAA-우라 판에 transformants에서 승리. </li><li> 성장의 부족을 확인하기 위해 200 μg / ML G418을 포함하는 YPDA 판에 식민지에서 세포를 전송합니다. (1.9) 식민지 PCR을 수행 할 수 있습니다 - 성공적인 GFP 통합을 확인하려면 다음 단계 (1.5)가 따르십시오. </li><li> 0.2-ML PCR 튜브 또는 96 - 웰 플레이트 잘에 용해 버퍼 2 μl (0.1 M의 인산 나트륨, 산도 7.4, ZymoResearch에서 1 단위 zymolyase)에 식민지에서 가져온 세포를 추가합니다. 피펫 팁의 확대 및 솔루션을 pipetting하여 섞는다. </li><li> P200 Pipetman (Gilson)를 사용하여 미네랄 오일 한 방울 (약 20 μl)와 중첩. </li><li> 37 혼합물을 품다 °95의 다음 20 분 및 ° 10 분에 C에 대한 C. </li><li> 50 μl 물 lysate를 희석. 열 번과 아웃 솔루션을 pipetting하여 섞는다. </li><li> 상류 측면을 노릴 지역 anneals의 순서 CCTGAGAAAGCAACCTGACC (카세트의 처음부터 285 BP)의 입문서와 페어링하는 (A) 앞으로 입문서로 10 μl PCR 반응을 사용하여 lysate 1 μl, (B) 역을 분석 프라이머 그 순서 GCATTGGGTCAACAGTATAG (끝에서 375 BP)의 입문서와 짝을 하류 지역에 anneals (C)은 두 시퀀스를 CGTACTCCTGATGATGCATG과 (181 BP) GACGAAATACGCGATCGCTG과 KanMX4에 단련 프리 머, 그리고 (D)은 두 프리 머 그 대상 유전자 (그림 4)의 야생 형 시퀀스로 어닐링. 삭제 컬렉션에있는 긴장의 약 8 %가 aneuploidy 14을 포함하는 것으로 알려져 있기 때문에 (D) 중요합니다. 올바른 transformant가 함께 긍정적이어야합니다 (A)와 (B) 및 제외 어있는 (C)와 (D). </li><li> 를 소개하려면transformant에 GMToolkit은 1.6 ML Eppendorf 튜브에 변형 변형에서 약 250,000 세포 있으며 RY0146 (GMToolkit -을 포함) 또는 RY0148 (GMToolkit-α를 포함하는)의 250,000 셀을 추가 할 수 있습니다. 와동. RY0146 및 RY0148의 genotypes은 MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit - [CMVpr - rtTA KanMX4 STE2pr-SP-his5]와 MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr - rtTA NatMX4 STE3pr - LEU2], 각각. 홍보 발기인를 나타냅니다. 휴대폰 번호는 앞의 문화의 광학 밀도의 추정해야합니다. </li><li> 2 분 800 XG에 원심 분리기. </li><li> 표면에 뜨는을 제거합니다. </li><li> 공기 교환을 할 수 있도록 70 %의 에탄올로 치료 고정 핀을 사용하여 뚜껑에 구멍을합니다. </li><li> YPDA 미디어 (1 % 효모 추출물, 2 % 펩톤, 2 %의 포도당, 그리고 0.003 % 아데닌 hemisulfat의 50 μl를 추가합니다E). 와동. </li><li> 5 분 800 XG에 원심 분리기. </li><li> 젖은 상자에서 튜브를 놓습니다. 이 작업은 빈 팁 상자, 작은 팁 스탠드, 그리고 젖은 종이 타월로 생성 할 수 있습니다. </li><li> 30에서 밤새 상자를 품다 ° C. </li><li> 먼저 CAA-우라 판에있는 셀을 좋겠어하여 정합 diploids을 선택합니다. 하루 30 ° C에서 판을 품다. </li><li> diploids을 선택에 대해 200 μg / ML G418을 포함 YPDA 판에서 분리 된 식민지 (1 % 효모 추출물, 2 % 펩톤, 2 %의 포도당, 0.003 % 아데닌 hemisulfate, 2 %의 한천)을 만들기 위해 대량 지​​역, 연속에서 그들을 세포를 촬영 포함 GMToolkit - 또는 100 μg / ML nourseothricin (NAT) GMToolkit-α를 포함하는 diploids 선택을위한 15. </li><li> 3 일 동안 30 ° C에서 판을 품다. </li><li> 격리 된 식민지에서 시작은, 한천없이 GNA 매체 500 μl로 세포의 대부분을 이전 (1 % 효모 추출물, 3% Difco 영양소 국물, 그리고 5 % 포도당, 압력솥 포도당과 t의 나머지그는 구성 요소는 별도로으로 뚜껑이있는 5 ML 문화 관 caramelization을 방지하기 위해 2 × 솔루션)은 느슨하게. </li><li> 30에 다섯 시간 동안 수평 관을 회전 ° C. 회전의 축은 튜브의 길이 방향 축에 평행 있어야합니다. </li><li> 에서 사용되는 식민지를 확인 (1.21) 우라는 + CAA-우라 판에 그들을 좋겠어으로. </li><li> 2 분 800 XG에 튜브를 원심 분리기. 표면에 뜨는 폐기하십시오. </li><li> 최소한의 sporulation 매체 (, 필터 소독 1 % 칼륨 아세테이트, 0.005 %의 아연 아세테이트) 500 μl를 추가합니다. 와동. </li><li> 2 분 800 XG에 튜브를 원심 분리기. 표면에 뜨는 폐기하십시오. </li><li> 반복 (1.25) - (1.26) 두 번. </li><li> 7.5 μg / ML 리신, 7.5 μg / ML 류신, 5 μg / ML 히스티딘, 5 μg / ML 메티오닌, 그리고 1.25 μg / ML uracil (auxotrophic 긴장의 sporulation 속도를 향상하기 위해)를 보충 최소한의 sporulation 매체 1 ML을 추가 . 와동. </li><li> 하루 실온에서 튜브를 회전합니다. </li><li> 2 일 30 ° C에서 튜브를 회전합니다. </li><li> 2 분 800 XG에서 1.6 ML Eppendorf 튜브에이 혼합물의 125 μl를 원심 분리기. 표면에 뜨는 폐기하십시오. </li><li> zymolyase 솔루션 (100 MM 나트륨 인산염 버퍼, 산도 7.4, 1 M sorbitol 및 ZymoResearch에서 2 단위 zymolyase) 50 μl를 추가합니다. 피펫 팁의 확대 및 솔루션을 pipetting하여 섞는다. </li><li> 1 시간에 30 ° C에서 알을 품다. </li><li> 0.02 % NP-40의 50 μl를 추가합니다. 피펫 팁의 확대 및 솔루션을 pipetting하여 섞는다. </li><li> 5 분 동안 실온에서 관 둡니다. </li><li> 물 500 μl를 추가합니다. </li><li> 얼음에 튜브를 놓습니다. </li><li> Sonifier 450 (브랜슨)와 3.2 mm microtip를 사용하여 15 초 1의 출력 설정 (약한 설정)에서 두 번이 혼합물을 Sonicate. sonication의 두 발 사이에, ~ 0 ° C.에 온도를 반환 얼음에 튜브를 넣어 </li><li> 5 분 800 XG에 튜브를 원심 분리기. 표면에 뜨는 폐기하십시오. </li><li> SC-우라 - 그의 200 μl를 추가합니다() 또는 교차 GMToolkit - 또는 GMToolkit-α를 통합인지 여부에 따라 SC-우라 - 레우 (α) 매체. 미디어를 준비하려면 SC-우라 - 그의 - 레우 매체 (0.67 % 효모 질소 기지, 2 % 포도당, 0.01 % 아르기닌, 0.01 % 아스파르트 산, 0.01 % 글루탐산, 0.01 % 이소류신, 0.01 % 리신, 메티오닌 0.01 % 할 , 0.01 %의 페닐알라닌, 0.08 %의 세린, 0.04 %의 트레오닌, 0.002 %의 티로신, 0.03 %의 발린, 0.0025 %의 아데닌, 0.005 %의 트립토판, 0.003 %의 아데닌, 그리고 0.005 % 트립토판) 및 멸균 히스티딘 또는 류신로 보충을 사용하기 전에 0.01 %의 최종 농도. </li><li> 70 % 에탄올로 치료 고정 핀을 사용하여 뚜껑에 구멍을 확인합니다. </li><li> 2 일 30 ° C에서 수평 관을 회전합니다. 회전의 축은 튜브의 길이 방향 축에 평행 있어야합니다. </li><li> SC-우라 - 그의 또는 SC-우라 - 레우 한천 플레이트 (위의 동일한 재료를 플러스 2 % 한천에있는 세포에서 승리는, 트레오닌과 아스파르트 산 후 추가해야합니다utoclaving, ProMonster의 변종에 대한 절연 식민지를 만들기 위해) 주입 전에 히스티딘 또는 류신를 추가합니다. </li></ol> 2. 성적 사이클링 <ol><li> 100 SC-그의의 μl (A) 또는 30에서 결합 유형에 따라 SC-레우 (α)의 설립 GFP 삭제 스트레인의 문화를 회전 ° C 하룻밤 1.6 ML Eppendorf 튜브을 사용합니다. 공기 교환의 경우 70 % 에탄올로 치료 고정 핀을 사용하여 구멍을합니다. 수평 관을 회전합니다. 회전의 축은 튜브의 길이 방향 축에 평행 있어야합니다. 호텔은 실내 masse 결합을 통해 여러 변종을 넘는 할 수 있습니다. 정렬 샘플은 직접 2 일 30 ° C에서 200 μl이 목적, 문화, 전지에 사용하는 경우. SC-우라 - 그의 - 레우 매체와 히스티딘 (0.01 %) 나 루신 (0.01 %) : 매체를 준비하려면, uracil을 (0.0025 % 최종 농도)를 추가합니다. </li><li> 1.6-ML Eppe에 250,000 - haploid 세포와 GFP를 삭제 긴장의 250,000 α-haploid 세포를 혼합ndorf 관. 와동. </li><li> (1.17) - 다음 단계 (1.11)에 의해 이러한 세포를 버려. </li><li> 느슨하게 뚜껑으로 5 ML 문화 튜브에 200 μg / ML G418과 100 μg / ML NAT를 포함 500 μl GNA 매체에 결합 혼합물의 10 μl를 전송합니다. 시작 OD 600 약 0.1이다. </li><li> 24 시간 30 ° C에서 문화를 회전합니다. 만 diploids가 모두 KanMX4을 포함하기 때문에이 diploids의 선택을 허용 GMToolkit - GMToolkit-α 및 NatMX4는 G418 및 NAT의 존재 (그림 3)에서 증가 할 수 있습니다. </li><li> G418 및 NAT를 포함하는 신선한 GNA 500 μl에 하루 문화의 20 μl를 전송합니다. 시작 OD 600 약 0.2이다. </li><li> 로그 단계 (~ 1 OD 600)에 셀을 가져 오 시간에 30 ° C에서 튜브를 회전합니다. </li><li> diploids을 sporulate과 포자를 분리하고 (1.38) - 단계 (1.24)를 따르십시오. </li><li> 이 300 μl에 sporulated 세포 현탁액을 분할부품은 별도의 1.5 ML Eppendorf 튜브에 각각 넣어. </li><li> 5 분 800 XG에 튜브를 원심 분리기. 표면에 뜨는 폐기하십시오. </li><li> 한 튜브의 펠렛으로, A-haploids을 선택 SC-그 중간의 100 μl를 추가합니다. 다른 튜브의 펠렛으로, α-haploids를 선택 SC-레우 매체 100 μl를 추가합니다. </li><li> 30 ° C 하룻밤에 튜브를 회전합니다. 최종 OD 600 0.5 미만이어야합니다. OD 600 너무 높은 경향이있는 경우 실온에서 배양을 시도해보십시오. </li><li> GFP를 유도하기 위해 신선한 SC-그의 () 또는 20 μg / ML의 doxycycline가 포함 된 SC-레우 (α) 매체입니다. 100 μl를 추가합니다 doxycycline의 최종 농도는 10 μg / ML입니다. 와동. </li><li> 2 일 30 ° C에서 튜브를 회전합니다. </li></ol> 3. 유동 세포 계측법 <ol><li> 캡 5 ML 폴리 프로필렌 튜브 (BD 팔콘 # 352063)에 10 μg / ML doxycycline을 포함하는 사전 필터링 TE 버퍼 900 μl (산도 7.5)를 추가로 교체 세포5 ML 폴리스티렌 튜브의 스트레이너 캡 (BD 팔콘 # 352235). 폴리 프로필렌 튜브는 유동 세포 계측법에 적합합니다. 스트레이너 캡은 대형 입자를 제거하기 위해 원하는 수 있습니다. </li><li> 부드럽게 셀 스트레이너 캡에 doxycycline과 TE 버퍼의 75 μl를 놓습니다. </li><li> 캡의 솔루션으로 유도 세포의 25 μl를 추가합니다. </li><li> 메쉬에 대한 Pipetman의 끝을 누르면 있지만, 스트레이너를 통해 통합 솔루션을 모두 쏴. </li><li> 스트레이너 캡과 소용돌이 관을 누릅니다. </li><li> SC-그의 또는 SC-레우 200 μl로 가득 수집 튜브를 (1.6-ML Eppendorf 튜브) 준비합니다. </li><li> 셀 정렬을 시작하고 제조업체 설명서에 따라 설정을 조정합니다. </li><li> 소용돌이 수집 관 (코트 매체로 벽을에)와 셀 정렬에를로드하기 전에 세포를 포함하는 관 모두. </li><li> 샘플의 유동 세포 계측법 데이터를 수집. GFP을 포함하지 않는 변형은 대조군이 될 수 있습니다. </li><li> 정렬을위한 문을 그립니다. (A)높은 GFP의 강도를 전시 할 수 셀 집계를 방지하기 위해 FSC 높이의 줄거리와 FSC를 사용하여 펄스 폭 및 펄스 높이 MoFlo 정렬 또는 불균형 작은 FSC 높이의 도면을 사용하여 앞으로 분산 (FSC)에 어울리지 않게 큽니다 펄스 폭과 특이점을 취소 FACSAria 정렬 (그림 5, 왼쪽 위 패널)의 공간을 제공합니다. (B) 대형 FSC (면적)은 세포 집계에 예상되어 있기 때문에, 낮은 FSC, 측면 분산 (SSC) 세포 파편은 종종 발견되는 값으로 지역을 피하면서 만 FSC의 낮은 20 %에 세포를 (그림 5, 오른쪽 상단 패널). (C) SSC (지역)와 GFP 신호 (지역) 종종 긍정적으로 서로 관련되어 있습니다. 단순히 위의 문 주어진 가장 밝은 세포를 복용 때문에도 높은 SSC 값이 세포에 풍부 것, 각 지점에서 가장 밝은 세포의 비슷한 비율을 취할 GFP 강도와 SSC의 도면을 사용하여 인구의 주변을 따라 문을 그려 SSC 축 (그림 5, bott의)도 톰 - 좌. (C)에서 선택한 인구 (B)에서 선택한 인구의 0.1-1 %이어야합니다. </li><li> (3.10)에 기준을 제공 수집 관에 200 세포를 정렬합니다. 필요에 따라 전용 masse 과정 또는 더 복잡한 인구를 요구하는 다른 프로젝트에 대한 더 많은 세포를 정렬합니다. </li><li> 소용돌이 수집 관은 매체와 정렬 셀을 포함합니다. </li><li> 판 genotyping에 대한 YPDA 접시에 세포의 일부 (예를 들어, 50 셀). </li><li> 2 일 30 ° C에서 판을 품다. </li><li> (1.8) - 단계 (1.5)에 따라 ~ 12 식민지의 lysate를 확인합니다. </li><li> 부드럽게 팁과 플레이트를 터치하여 G418 및 NAT를 포함하는 YPDA 플레이트에 입단에 사용되는 팁 (1.5)에 잔여 세포를 전송합니다. 선택한 haploids이 접시에 성장해서는 안됩니다. Diploids 더 GFP 사본이있을 수 있으므로 밝게 할 수 있습니다. 이 테스트는 haploid 선택의 효율성을 표시 할 수 있습니다. </li><li> genotyping를 들어, 10 μl PCR R을 사용하여 lysate의 1 μl를 분석순서 CCTGAGAAAGCAACCTGACC의 입문서와 짝을 각각 삭제 유전자의 상류 측면을 노릴 지역에 anneals하는 기대 입문서로 eaction. 멀티 플렉스 PCR 반응 가능하면 (조건은 단일 돌연변이의 lysates를 사용하여 결정 할 수 있습니다.) 또는 384도 형식 - PCR은 96에서 수행 할 수 있습니다. 후자의 형식은 최소 5와 μl의 반응 볼륨에 적합합니다. PCR 마스터의 Arraying은 프리 머 이러한 믹스에 세포 lysates의 추가는 멀티 채널 피펫 또는 액체 처리 로봇을 사용하여 수행 할 수에 차이가 조화를 이루고 있습니다. 다른 PCR 믹스에 동일한 lysate을 추가 할 때 팁 변경은 선택 사항입니다. </li><li> PCR 제품을 분석합니다. 젤 XL 울트라 V-2 전기 시스템 (Labnet)는 멀티 채널 피펫을 사용하여 샘​​플 로딩과 호환됩니다. </li><li> 의 정보 (3.16) 및 (3.18)에 따라 genotypes을 원하는 한 것 haploids를 확인합니다. </li><li> 신선한 플레이트 (YPDA, CAA-우라, 또는 SC-Ura-His/Leu)에 이러한 변종을 설정합니다. 또한,에서 그들을 동결-80에서 25 % 글리세롤 ° C. 이러한 삭제 유전자 및 펄스 - 필드 겔 전기 영동을위한 야생 형 시퀀스의 부재의 확인 등의 추가 시험이 권장됩니다. </li><li> 유용한 긴장과 성적 자전거 (2.1)를 반복합니다. </li></ol>

<ol>
	<li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science's STKE. 294, 2364-23 (2001).</li><li>Hillenmeyer, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Beh, C. T., Cool, L., Phillips, J., Rine, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+functions+of+the+yeast+oxysterol-binding+protein+homologues.">Overlapping functions of the yeast oxysterol-binding protein homologues.</a> Genetics. 157, 1117 (2001).</li><li>Wieczorke, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+knock-out+of+at+least+20+transporter+genes+is+required+to+block+uptake+of+hexoses+in+Saccharomyces+cerevisiae.">Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae.</a> FEBS letters. 464, 123-128 (1999).</li><li>Alani, E., Cao, L., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gene+disruption+that+allows+repeated+use+of+URA3+selection+in+the+construction+of+multiply+disrupted+yeast+strains.">A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.</a> Genetics. 116, 541-545 (1987).</li><li>Akada, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+seamless+gene+deletion+and+marker+recycling+in+Saccharomyces+cerevisiae.">PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae.</a> Yeast. 23, 399-405 (2006).</li><li>Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+efficient+gene+disruption+cassette+for+repeated+use+in+budding+yeast.">A new efficient gene disruption cassette for repeated use in budding yeast.</a> Nucleic acids research. 24, 2519 (1996).</li><li>Delneri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+redundancy+in+the+yeast+genome:+an+improved+strategy+for+use+of+the+cre-loxP+system.">Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system.</a> Gene. 252, 127-135 (2000).</li><li>Storici, F., Lewis, L. K., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+site-directed+mutagenesis+using+oligonucleotides.">In vivo site-directed mutagenesis using oligonucleotides.</a> Nat. Biotech. 19, 773-776 (2001).</li><li>Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+repeat+coupled+with+endonuclease+cleavage+(TREC):+a+seamless+modification+tool+for+genome+engineering+in+yeast.">Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast.</a> Nucl. Acids Res. 38, 2570-2576 (2010).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+out+multigene+redundancies+via+cycles+of+sexual+assortment+and+fluorescence+selection.">Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection.</a> Nat. Methods. 8, 159-164 (2011).</li><li>Winzeler, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+the+S.+Genome+by+Gene+Deletion+and+Parallel+Analysis.">Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis.</a> Science. 285, 901-906 (1999).</li><li>Woods, R. A., Gietz, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+plasmid+DNA+into+yeast.">High-efficiency transformation of plasmid DNA into yeast.</a> Methods Mol. Biol. 177, 85-97 (2001).</li><li>Hughes, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+aneuploidy+revealed+by+DNA+microarray+expression+profiling.">Widespread aneuploidy revealed by DNA microarray expression profiling.</a> Nature. 25, 333-337 (2000).</li><li>Goldstein, A. L., McCusker, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+new+dominant+drug+resistance+cassettes+for+gene+disruption+in+Saccharomyces+cerevisiae.">Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.</a> Yeast. 15, 1541-1553 (1999).</li><li>Newman, J. R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+proteomic+analysis+of+S.+cerevisiae+reveals+the+architecture+of+biological+noise.">Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise.</a> Nature. 441, 840-846 (2006).</li><li>Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+regulation+at+the+single-cell+level.">Gene regulation at the single-cell level.</a> Science. 307, 1962 (2005).</li></ol>

관심 없음 충돌이 선언 없습니다.

우리가 그린 몬스터 접근 방식을 개발로서, 우리는 게놈 다시 정리하기로 이어지는, 다른 GFP 교체 카세트 사이의 재조합의 가능성에 관심을했습니다. 이 가능성에 대한 완화하는 것은 성공적으로 결합하고 세포의 감수 분열의 여러 순찰을받은 세포에 대한 선택입니다. 재 배열 genomes을 간직한 세포는 동일한 다시 정리하기없이 셀에 결합 후 더 적합 할 것으로 예상됩니다. 사실, 우리는 GFP 카세트...

<table border="1"><tbody><tr><td> 시약이나 악기의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 코멘트 (선택 사항) </td></tr><tr><td> G418 </td><td> 시그마 - 알드리치 </td><td> A1720 </td><td> (0.2-μm 필터) 물에 녹아 및 필터 - 소독. 주식 농도 : 200 밀리그램 / ML. 4 ° C.에 저장 </td></tr><tr><td> ClonNAT (nourseothricin) </td><td> 워너 BioAgents </td><td> 5001000 </td><td> (0.2-μm 필터) 물에 녹아 및 필터 - 소독. 주식 농도 : 100 밀리그램 / ML. 4 ° C.에 저장 </td></tr><tr><td> Doxycycline </td><td> 시그마 - 알드리치 </td><td> D9891 </td><td> (0.2-μm 필터) 50 % 에탄올에 용해 여과 - 소독. 주식 농도 : 10 밀리그램 / ML. 4 주마다 신선한하십시오. 4에 알루미늄 호일 및 매장을 사용하여 빛의 방패 ° C. </td></tr><tr><td> Zymolyase </td><td> ZymoResearch </td><td> E1005 </td><td></td></tr><tr><td> Difco 효모 질소 기지 w / O 아미노산 </td><td> BD </td><td> 291940 </td><td></td></tr><tr><td> 권총 (튜브 용 회전하는 것) </td><td> Labnet </td><td> H5600 </td><td></td></tr><tr><td> Enduro 젤 XL 전기 영동 장치 </td><td> Labnet </td><td> E0160 </td><td></td></tr><tr><td> Sonifier 450 </td><td> 브랜슨 </td><td> 101-063-198 </td><td></td></tr><tr><td> Sonifier 450에 대한 Microtip </td><td> 브랜슨 </td><td> 101-148-062 </td><td></td></tr><tr><td> FACSAria 셀 정렬 </td><td> BD </td><td></td><td></td></tr><tr><td> MoFlo 셀 정렬 </td><td> Beckman - 보습 바로 앞에 달린 풀 베는 날 </td><td></td><td></td></tr><tr><td> Biomek FX 또는 동급 로봇 </td><td> Beckman 보습 바로 앞에 달린 풀 베는 날 </td><td></td><td> 선택 사항입니다. genotyping의 PCRs을 설정하십시오. </td></tr></tbody> &lt;/ TABLE&gt;

the green monster process for the generation of yeast strains carrying multiple gene deletions

유전자 삭제에 대한 Phenotypes은 종종 변이가 특정 유전 배경이나 환경 조건 1,2에서 테스트하는 경우에만 공개됩니다. 많은 유전자 숨겨진 유전자의 기능에게 3,4 가면을 벗어 라하기 삭제해야 예제가 있습니다. 중요한 발견의 가능성에도 불구하고, 세 개 이상 유전자를 포함한 유전자 상호 작용은 크게 미개척 있습니다. 다중 돌연변이의 상호 작용 철저한 검색의 삭제 가능한 조합의 깎아 지른듯한 숫자로 인해 비실용적 것입니다. 그러나, 이러한 일반적인 기능을 공유 큰 사전 기회로 paralogs 세트 등 유전자,의 선택한 세트의 연구 정보를 것입니다. 효모 Saccharomyces cerevisiae에서 유전자 녹아웃는 상동 재조합을 통해 선택 마커로 유전자를 대체하여 수행됩니다. 마커의 수가 제한되어 있기 때문에, 방법은 샘을 제거하고 재사용을 위해 개발 된<html> 전자 표시 5,6,7,8,9,10. 시간이 생성 될 삭제의 수와 비늘 선형 필요하기 때문에 그러나, 이러한 방법을 사용하여 순차적으로 엔지니어링 여러 변이은 시간이 오래 걸릴 수 있습니다. 여기 정기적으로 효모 11 여러 삭제를 꾸민위한 그린 몬스터 방법을 설명합니다. 이 방법에서는, 삭제에 통합 녹색 형광 단백질 (GFP) 기자는 각 변형에 포함 된 삭제의 수 (그림 1)에 따라 양적 라벨 긴장하는 데 사용됩니다. 효모 결합 및 세포의 감수 분열을 통해 GFP-표시의 삭제 구색의 반복 라운드는 긴장의 삭제의 축적 (그림 2)로 연결이 삭제 더 많은을 가진 변종의 흐름 cytometric 강화와 결합. , 라운드 당 하나 이상의 삭제를 통합하는 각 과정, 병렬로 여러 프로세스를 수행하면 변형 건설에 필요한 시간을 줄일 수 있습니다. 내용이 &quot;&gt; 첫 번째 단계는 haploid 단일 돌연변이는 칭했다 준비하는 것입니다 &#39;ProMonsters&#39;를 GFP를 삭제 궤적에서 기자와 &#39;툴킷&#39;중 하나를 수행 각각의 loci을 하나 그린 몬스터 GMToolkit -이나 GMToolkit-α .. can1Δ 궤적 (그림 3) 효모 삭제 컬렉션 12 일부터 변종을 사용하여이 GFP-마크 삭제 편리하게 보편적 GFP을 통해 이러한 변종에 존재하는 일반적인 KanMX4 카세트 교체에 의해 생성 될 수있다 - URA3 조각을 각 GMToolkit에는 다음이 포함됩니다 중 - 또는 α-결합 형 특정 haploid 선택 마커 1과 정확히 두 GMToolkits이 존재 경우, 이하 diploids의 선택을 허용, 그런 두 마커 중 하나입니다. 두 번째 단계는 삭제 loci는 무작위 구색 및 / 또는 meiotic recomb하여 단일 세포 내에서 결합 할 수있는을 통해 성적 자전거를 수행하는 것입니다결합 및 sporulation의 각주기를 함께 ination.

네 GFP-마크 삭제합니다 (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) 수행 - haploid 변형은 네 삭제를 수행 α-haploid 변형으로 건너되었을 때 (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), 두 삭제와 (ycl033cΔ yer042wΔ)은 두 변종이 대표에서 공유 결과는 얻은 것입니다. 짝짓기 혼합물은 diploids을 선택 G418 및 NAT를 포함하는 YPDA 매체에 배양되었다. 그 결과 diploids는 sporulation 매체에 배양 하였다. 포자는 zymolyase ...

Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

그린 몬스터 방법은 리포터 유전자 인코딩 녹색 형광 단백질로 표시된 여러 삭제의 급속한 조립이 가능합니다. 이 방법은 반복 삭제의 성적 구색의 사이클 등 삭제를 들고 세포의 형광 기반의 강화를 통해 효모 변종 운전에 기반을두고 있습니다.

여러 유전자 삭제를 운반 효모 종자의 생성에 대한 초록 괴물 프로세스

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

the-green-monster-process-for-generation-yeast-strains-carrying

Research

JoVE Journal

Biology

14.2K 조회수.  J. Craig Venter Institute. 그린 몬스터 방법은 리포터 유전자 인코딩 녹색 형광 단백질로 표시된 여러 삭제의 급속한 조립이 가능합니다. 이 방법은 반복 삭제의 성적 구색의 사이클 등 삭제를 들고 세포의 형광 기반의 강화를 통해 효모 변종 운전에 기반을두고 있습니다.

비디오: The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

A Rapid Technique for the Visualization of Live Immobilized Yeast Cells

We present here a simple, rapid, and extremely flexible technique for the immobilization and visualization of growing yeast cells by epifluorescence microscopy. The technique is equally suited for visualization of static yeast populations, or time courses experiments up to ten hours in length. My microscopy investigates epigenetic inheritance at the silent mating loci in S. cerevisiae. There are two silent mating loci, HML and HMR, which are normally not expressed as they are packaged in heterochromatin. In the sir1 mutant background silencing is weakened such that each locus can either be in the expressed or silenced epigenetic state, so in the population as a whole there is a mix of cells of different epigenetic states for both HML and HMR. My microscopy demonstrated that there is no relationship between the epigenetic state of HML and HMR in an individual cell. sir1 cells stochastically switch epigenetic states, establishing silencing at a previously expressed locus or expressing a previously silenced locus. My time course microscopy tracked individual sir1 cells and their offspring to score the frequency of each of the four possible epigenetic switches, and thus the stability of each of the epigenetic states in sir1 cells. See also  Xu et al., Mol. Cell 2006.

A rapid technique for the visualization of growing immobilized yeast cells, here applied to fluorescent reporters at the silent mating loci HML and HMR

라이브 고정화 효모 세포의 시각화에 대한 신속한 기술

We present here a simple, rapid, and extremely flexible technique for the immobilization and visualization of growing yeast cells by epifluorescence ...

연구

생물학

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

Electroporation에 대한 Murine 골수에서 조혈 세포 차 문화의 준비

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

원자력 교통 단일 분자 이미징

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

활성 T.의 체외의 Reconstitution에서 castaneum의 Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

게놈 전체 유전자 삭제할에<em&gt; 연쇄상 구균 sanguinis</em&gt; 높은 처리량 PCR에 의한

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously hard to disrupt. Here we describe the use of a bead mill homogenizer for the extraction of proteins into buffers optimized to maintain the functions, interactions and post-translational modifications of proteins. Logarithmically growing cells expressing the protein of interest are grown in a liquid growth media of choice. The growth media may be supplemented with reagents to induce protein expression from inducible promoters (e.g. galactose), synchronize cell cycle stage (e.g. nocodazole), or inhibit proteasome function (e.g. MG132). Cells are then pelleted and resuspended in a suitable buffer containing protease and/or phosphatase inhibitors and are either processed immediately or frozen in liquid nitrogen for later use. Homogenization is accomplished by six cycles of 20 sec&#160;bead-beating (5.5 m/sec), each followed by one minute incubation on ice. The resulting homogenate is cleared by centrifugation and small particulates can be removed by filtration. The resulting cleared whole cell extract (WCE) is precipitated using 20% TCA for direct analysis of total proteins by SDS-PAGE followed by Western blotting. Extracts are also suitable for affinity purification of specific proteins, the detection of post-translational modifications, or the analysis of co-purifying proteins. As is the case for most protein purification protocols, some enzymes and proteins may require unique conditions or buffer compositions for their purification and others may be unstable or insoluble under the conditions stated. In the latter case, the protocol presented may provide a useful starting point to empirically determine the best bead-beating strategy for protein extraction and purification. We show the extraction and purification of an epitope-tagged SUMO E3 ligase, Siz1, a cell cycle regulated protein that becomes both sumoylated and phosphorylated, as well as a SUMO-targeted ubiquitin ligase subunit, Slx5.

The preparation of high quality yeast cell extracts is a necessary first step in the analysis of individual proteins or entire proteomes. Here we describe a fast, efficient, and reliable homogenization protocol for budding yeast cells that has been optimized to preserve protein functions, interactions, and post-translational modifications.

함수의 연구, 상호 작용, 그리고 번역 후 수정을위한 신진 효모 단백질 추출 및 정제

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the plasma membrane and the Golgi. As a result the endosomal system plays a central role in maintaining cell homeostasis, and mutations in genes belonging to this network of organelles interconnected by vesicular transport, cause severe pathologies including cancer and neurobiological disorders. It is therefore of prime relevance to understand the mechanisms underlying the biogenesis and organization of the endosomal system. The yeast Saccharomyces cerevisiae has been pivotal in this task. To specifically label and analyze at the ultrastructural level the endosomal system of this model organism, we present here a detailed protocol for the positively charged nanogold uptake by spheroplasts followed by the visualization of these particles through a silver enhancement reaction. This method is also a valuable tool for the morphological examination of mutants with defects in endosomal trafficking. Moreover, it is not only applicable for ultrastructural examinations but it can also be combined with immunogold labelings for protein localization investigations.

Yeast, Saccharomyces cerevisiae, has been a key model organism to identify and study genes regulating the biogenesis and functions of the endosomal system. Here we present a detailed protocol for the specific labeling of the endosomal compartments for ultrastructural studies.

미세 구조의 분석을위한 효모 엔도 좀의 시스템 Nanogold 라벨링

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic lateral sclerosis, and &#945;-synuclein, implicated in Parkinson&#8217;s disease, are toxic and form cytoplasmic aggregates in yeast. These features recapitulate protein pathologies observed in patients with these disorders. Thus, yeast are an ideal platform for isolating toxicity suppressors from libraries of protein variants. We are interested in applying protein disaggregases to eliminate misfolded toxic protein conformers. Specifically, we are engineering Hsp104, a hexameric AAA+ protein from yeast that is uniquely capable of solubilizing both disordered aggregates and amyloid and returning the proteins to their native conformations. While Hsp104 is highly conserved in eukaryotes and eubacteria, it has no known metazoan homologue. Hsp104 has only limited ability to eliminate disordered aggregates and amyloid fibers implicated in human disease. Thus, we aim to engineer Hsp104 variants to reverse the protein misfolding implicated in neurodegenerative disorders. We have developed methods to screen large libraries of Hsp104 variants for suppression of proteotoxicity in yeast. As yeast are prone to spontaneous nonspecific suppression of toxicity, a two-step screening process has been developed to eliminate false positives. Using these methods, we have identified a series of potentiated Hsp104 variants that potently suppress the toxicity and aggregation of TDP-43, FUS, and &#945;-synuclein. Here, we describe this optimized protocol, which could be adapted to screen libraries constructed using any protein backbone for suppression of toxicity of any protein that is toxic in yeast.

Yeast proteinopathy models are valuable tools to assess the toxicity and aggregation of proteins implicated in disease. Here, we present methods for screening Hsp104 variant libraries for toxicity suppressors. This protocol could be adapted to screen any protein library for toxicity suppressors of any protein that is toxic in yeast.

효력을 더 Hsp104 변종 사용 효모 Proteinopathy 모델을 분리

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

CRISPR / Cas9를 통해 포유 동물 세포주의 게놈에 삭제 세대

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Applications of pHluorin for Quantitative, Kinetic and High-throughput Analysis of Endocytosis in Budding Yeast

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal remodeling and vesicular trafficking in living cells. Quantitative methodologies using chimeric GFP fusions have been developed for many applications; however, GFP is somewhat resistant to proteolysis, thus its fluorescence persists in the lysosome/vacuole, which can impede quantification of cargo trafficking in the endocytic pathway. An alternative method for quantifying endocytosis and post-endocytic trafficking events makes use of superecliptic pHluorin, a pH-sensitive variant of GFP that is quenched in acidic environments. Chimeric fusion of pHluorin to the cytoplasmic tail of transmembrane cargo proteins results in a dampening of fluorescence upon incorporation of the cargo into multivesicular bodies (MVBs) and delivery to the lysosome/vacuole lumen. Thus, quenching of vacuolar fluorescence facilitates quantification of endocytosis and early events in the endocytic pathway. This paper describes methods using pHluorin-tagged cargos for quantification of endocytosis via fluorescence microscopy, as well as population-based assays using flow cytometry.

Accurate quantification of vesicular trafficking events often provides key insights into roles for specific proteins and the effects of mutations. This paper presents methods for using superecliptic pHluorin, a pH-sensitive GFP variant, as a tool for quantification of endocytic events in living cells using quantitative fluorescence microscopy and flow cytometry.

신진 효모의 세포 내 이입의 양적, 운동 및 높은 처리량 분석을위한 pHluorin의 응용 프로그램

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal ...