우리는 론 데이비스, 아담 Deutschbauer, 그리고 토론과 조언 토론토 대학에서 전체 힙합 실험실 감사합니다. CN은 국가 인간 게놈 연구소 (부여 번호 HG000205), RO1 HG003317, CIHR 청소 - 84,305, 그리고 캐나다 암 협회 (# 020380)에서 기금에 의해 지원됩니다. JO는 스탠포드 게놈 연수 프로그램 (부여 번호 T32 HG00044 국가 인간 게놈 연구소에서)와 국립 보건원 (부여 번호 P01 GH000205)에 의해 지원되었다. GG는 DRS으로 혁신에 대한 캐나다 재단의 보조금에 의해 일부 지원 NHGRI RO1 HG003317와 캐나다 암 협회, 그랜트 # 020380, TD 및 도널리 시퀀싱 센터에 의해 지원됩니다. 브렌다 앤드류스와 잭 그린 블. AMS는 토론토 오픈 원정대의 대학에 의해 지원됩니다.

<ol>
	<li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+profiling+of+the+Saccharomyces+cerevisiae+genome.">Functional profiling of the Saccharomyces cerevisiae genome.</a> Nature. 418, 387-391 (2002).</li><li>Baba, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Molecular systems biology. 2, 2006.0008-2006.0008 (2006).</li><li>Claus, H., Frosch, M., Vogel, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+hotspot+for+transformation+of+Neisseria+meningitidis+by+shuttle+mutagenesis+using+signature-tagged+transposons.">Identification of a hotspot for transformation of Neisseria meningitidis by shuttle mutagenesis using signature-tagged transposons.</a> Mol Gen Genet. 259, 363-371 (1998).</li><li>Hava, D. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+identification+of+serotype+4+Streptococcus+pneumoniae+virulence+factors.">Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors.</a> Molecular microbiology. 45, 1389-1406 (2002).</li><li>Costanzo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genetic+Landscape+of+a+Cell.">The Genetic Landscape of a Cell.</a> Science. 327, 425-431 (2010).</li><li>Tong, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Pan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+toolkit+for+functional+profiling+of+the+yeast+genome.">A robust toolkit for functional profiling of the yeast genome.</a> Molecular cell. 16, 487-496 (2004).</li><li>Schuldiner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+Function+and+Organization+of+the+Yeast+Early+Secretory+Pathway+through+an+Epistatic+Miniarray+Profile.">Exploration of the Function and Organization of the Yeast Early Secretory Pathway through an Epistatic Miniarray Profile.</a> Cell. 123, 507-519 (2005).</li><li>Deutschbauer, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+haploinsufficiency+revealed+by+genome-wide+profiling+in+yeast.">Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast.</a> Genetics. 169, 1915-1925 (2005).</li><li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemogenomic+profiling:+identifying+the+functional+interactions+of+small+molecules+in+yeast.">Chemogenomic profiling: identifying the functional interactions of small molecules in yeast.</a> Proceedings of the National Academy of Sciences of the United States of America. 101, 793-798 (2004).</li><li>Lum, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovering+modes+of+action+for+therapeutic+compounds+using+a+genome-wide+screen+of+yeast+heterozygotes.">Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes.</a> Cell. 116, 121-137 (2004).</li><li>Hillenmeyer, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+TagModule+collection+for+parallel+genetic+analysis+of+microorganisms.">A universal TagModule collection for parallel genetic analysis of microorganisms.</a> Nucleic acids research. 38, e146-e146 (2010).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+annotation+and+drug+target+discovery+in+Candida+albicans+with+a+tagged+transposon+mutant+collection.">Gene annotation and drug target discovery in Candida albicans with a tagged transposon mutant collection.</a> PLoS pathogens. 6, (2010).</li><li>Nislow, C., Giaever, G., Stark, I., Stansfields, M. J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+387.">Chapter 387.</a> Yeast Gene Analysis. , 387-414 (2007).</li><li>Pierce, S. E., Davis, R. W., Nislow, C., Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+barcoded+Saccharomyces+cerevisiae+gene-deletion+mutants+in+pooled+cultures.">Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures.</a> Nature protocols. 2, 2958-2974 (2007).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2001).</li><li>Smith, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+phenotyping+via+deep+barcode+sequencing.">Quantitative phenotyping via deep barcode sequencing.</a> Genome Res. , (2009).</li><li>Hamady, M., Walker, J. J., Harris, J. K., Gold, N. J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Error-correcting+barcoded+primers+for+pyrosequencing+hundreds+of+samples+in+multiplex.">Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex.</a> Nature. 5, 235-237 (2008).</li><li>Gresham, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=System-Level+Analysis+of+Genes+and+Functions+Affecting+Survival+During+Nutrient+Starvation+in+Saccharomyces+cerevisiae.">System-Level Analysis of Genes and Functions Affecting Survival During Nutrient Starvation in Saccharomyces cerevisiae.</a> Genetics. 187, 299-317 (2011).</li></ol>

관심 없음 충돌 선언하지 않습니다.

여기, 우리가 쉽게 태그 돌연변이 컬렉션을 만드는 다른 미생물의 barcoded 돌연변이 컬렉션의 기존 컬렉션의 다양한 적용할 수 있습니다, 겸손한 수정과 프로토콜을 설명했다. 우리가 병원성 효모 C.에 대한 태그 transposon의 돌연변이 유발에 대한 프로토콜을보고있을 때 우리가 그것을 강조 albicans는 매우 유사한 프로토콜은 단세포 진균류의 다양한 적응 수 있습니다. 수정이 프로토콜은 박테리아 13 잘 작동하고, 현재 추가로 곰팡이와 세균 genomes의 번호 컬렉션 공사중입니다. 현재,이 분석은 유전자 작은 분자 상호 작용에 대한 유일한 종합 게놈 차원의 편견 화면을 제공합니다. 분석 중 하나는 특히 강력한 기능은 유전자 또는 작은 분자에 대한 사전 지식이 필요하지 않습니다 것입니다. 이러한 assays의 범위와 능력에도 불구하고, 다른 실험실 자신의 양도는 결과의 분석을위한 초기 자본 투자 및 정보학 도구에 의해 다소 방해했습니다. 분석을위한 강력한 도구와 함께 차세대 시퀀스 판독의 채택과 함께, 우리는 그들의 채택이 증가 기대합니다.

<table border="1"><tbody><tr><td> 항생제 </td><td> 공급 업체 및 카탈로그 번호 </td></tr><tr><td> Carbenicillin </td><td> 시그마, 부분 # C1613 </td></tr><tr><td> Kanamycin </td><td> 시그마, 부분 # K1876 </td></tr><tr><td> spectinomycin </td><td> 시그마, 부분 # S0692 </td></tr><tr><td> Chloramphenicol </td><td> 시그마, 부분 # C0378 </td></tr><tr><td> DNA 클린 - 업 및 농도 키트 </td><td></td></tr><tr><td> QIAprep 스핀 Miniprep 키트 </td><td> Qiagen, 부분 # 27106 </td></tr><tr><td> HiSpeed​​ 플라스미드 맥시 키트 </td><td> Qiagen, 부분 # 12663 </td></tr><tr><td> QIAquick PCR의 정제 키트 </td><td> Qiagen, 부분 # 28106 </td></tr><tr><td> QIAquick 겔 추출 키트 </td><td> Qiagen, 부분 # 28704 </td></tr><tr><td> PCR과 전기 영동의 시약 </td><td></td></tr><tr><td> DNA 형성 촉매의 DNA 중합 효소 (MG - 무료) 버퍼 </td><td> 뉴 잉글랜드 Biolabs, 부분 # M0320L </td></tr><tr><td> Deoxynucleotide 솔루션 믹스 </td><td> 뉴 잉글랜드 Biolabs, 부분 # N0447L </td></tr><tr><td> 25 MM MgCl 2 </td><td> 시그마, 부분 # 63036 </td></tr><tr><td> 아가로 오스, 로딩 염색하고, 핵산은 겔 전기 영동에 적합 얼룩 </td><td> 여러 </td></tr><tr><td> 10X 태 버퍼 </td><td> 시그마, 부분 # T8280 </td></tr><tr><td> 1 KB 플러스 DNA 레더 </td><td> Invitrogen, 부분 # 10787026 </td></tr><tr><td> YPD 수프 </td><td></td></tr><tr><td> 효모 추출물의 10g </td><td> 시그마, 부분 # Y1625 </td></tr><tr><td> 20g Bacto 펩톤 </td><td> BD Biosciences, 부분 # 211677 </td></tr><tr><td> 덱스 트로 오스의 20g </td><td> 시그마, 부분 # D9434 </td></tr><tr><td> Labware </td><td></td></tr><tr><td> 멀티채널 pipettes (1000, 200, 20 μL) </td><td> 여러 </td></tr><tr><td> 일회용 pipetting 저수지 </td><td> 여러 </td></tr><tr><td> 15 50 ML 원심 분리기 튜브 </td><td> 여러 </td></tr><tr><td> 96 - 및 384 자 딥 웰 플레이트 </td><td> Axygen 과학, 부분 # P - 2ML - SQ - CS &amp; P - 384240SQCS </td></tr><tr><td> 96 - 잘하고 384 잘 PCR 플레이트 및 밀봉 필름 </td><td> 여러 </td></tr><tr><td> 실링 멀티 잘 번호판을위한 플레이트 롤러 </td><td> 시그마, 부분 # R1275 </td></tr><tr><td> 30 ° C와 37 ° C 접시에 박테리아와 효모 성장과 튜브에 incubators를 흔들어 </td><td> 여러 </td></tr><tr><td> 체외 transposon 돌연변이 유발에 </td><td></td></tr><tr><td> EZ - Tn5의 Transposase </td><td> Epicentre의 Biotechnologies, 부분 # TNP92110 </td></tr><tr><td> 높은 처리량 변환 </td><td></td></tr><tr><td> Seqprep 96 HT 플라스미드 준비 키트 </td><td> 에지 Biosystems, 부분 # 84359 </td></tr><tr><td> 폴리에틸렌 글리콜, 분자량 3,350 </td><td> 여러 </td></tr><tr><td> 리튬 아세테이트 </td><td> 시그마, 부분 # 517992 </td></tr><tr><td> 무균, 접시 6 - 웰 </td><td> 코닝, 부분 # 3335 </td></tr><tr><td> 50 MG / ML 유리딘 </td><td> 시그마, 부분 # U3750 </td></tr><tr><td> 100X 트리스 - EDTA (에틸렌 다이아 민 테트라 초산) 버퍼 솔루션 </td><td> 시그마, 부분 # T9285 </td></tr><tr><td> 1X TE/0.1M LiOAc </td><td> 여러 </td></tr><tr><td> 연어 testis DNA </td><td> 시그마, 부분 # 1626 </td></tr><tr><td> barcoded 컬렉션의 성장 </td><td></td></tr><tr><td> 48 잘 접시, 접시의 문화를 성장하는 경우 </td><td> 그레 이너 부분 # M9437 </td></tr><tr><td> 접착제 플레이트 씰 </td><td> ABgene, 부분 # AB - 0580 </td></tr><tr><td> 200 ML 문화 flasks </td><td> 여러 </td></tr><tr><td> 흡광도 수있는 분광 광도계 </td><td> 여러 </td></tr><tr><td> 250 ML flasks이나 흔들림 분광 광도계를위한 온도 제어 흔드는 </td><td> 여러 </td></tr><tr><td> 안전 잠금 Microcentrifuge 튜브, 2 ML </td><td> Eppendorf, 부분 # 0030 120.094 </td></tr><tr><td> 하이브리드화 장비 </td><td></td></tr><tr><td> 하이브 리다이 제이션 오븐 640 </td><td> Affymetrix, 부분 # 800138 </td></tr><tr><td> GeneChip 유체 역 450 </td><td> Affymetrix, 부분 # 00-0079 </td></tr><tr><td> GeneArray 스캐너 3000 </td><td> Affymetrix, 부분 # 00-0212 </td></tr><tr><td> 플로팅 랙과 함께 끓는 물 목욕 </td><td> 여러 </td></tr><tr><td> 하이브 리다이 제이션 소모품 </td><td></td></tr><tr><td> Genflex 태그 16K 배열 V2 </td><td> Affymetrix, 부분 # 511331 </td></tr><tr><td> Denhardt의 솔루션, 50X 집중 </td><td> 시그마, 부분 # D2532 </td></tr><tr><td> Streptavidin, R - phycoerythrin 공액 (SAPE) </td><td> Invitrogen, 부분 # S866 </td></tr><tr><td> 안전 잠금 Microcentrifuge 튜브, 0.5 ML </td><td> Eppendorf, 부분 # 0030 123.301 </td></tr><tr><td> 작은 터프 - 명소 </td><td> 다양 생명 공학, 부분 # LTTM - 1000 </td></tr><tr><td> 0.5 M EDTA (에틸렌 다이아 민 테트라 초산) </td><td> BioRad, 부​​분 # 161-0729 </td></tr><tr><td> 10% 트윈 </td><td> 시그마, 부분 # T2700 </td></tr><tr><td> MES 무료 산성 일수화물 </td><td> 시그마, 부분 # M5287 </td></tr><tr><td> MES 나트륨 소금 </td><td> 시그마, 부분 # M5057 </td></tr><tr><td> 5 M NaCl </td><td> 시그마, 부분 # 71386 </td></tr><tr><td> 20X SSPE </td><td> 시그마, 부분 # S2015 </td></tr><tr><td> 분자 생물학 등급 물 </td><td> 시그마, 부분 # W4502 </td></tr><tr><td> 하이브 리다이 제이션 Primers </td><td> 다양한 공급 업체 (표준 탈염) </td></tr><tr><td> Uptag </td><td> 5 &#39;GATGTCCACGAGGTCTCT 3&#39; </td></tr><tr><td> Buptagkanmx4 </td><td> 5 &#39;비오틴 - GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntag </td><td> 5 &#39;CGGTGTCGGTCTCGTAG 3&#39; </td></tr><tr><td> Bdntagkanmx4 </td><td> 5 &#39;비오틴 - GAAAACGAGCTCGAATTCATCG 3&#39; </td></tr><tr><td> B213 </td><td> 5 &#39;비오틴 - CTGAACGGTAGCATCTTGAC 3&#39; </td></tr><tr><td> Uptagkanmx </td><td> 5 &#39;3 GTCGACCTGCAGCGTACG&#39; </td></tr><tr><td> Dntagkanmx </td><td> 5&#39;GAAAACGAGCTCGAATTCATCG 3 &#39; </td></tr><tr><td> Uptagcomp </td><td> 5&#39;AGAGACCTCGTGGACATC 3 &#39; </td></tr><tr><td> Dntagcomp </td><td> 3 5&#39;CTACGAGACCGACACCG &#39; </td></tr><tr><td> Upkancomp </td><td> 5&#39;CGTACGCTGCAGGTCGAC 3 &#39; </td></tr><tr><td> Dnkancomp </td><td> 5&#39;CGATGAATTCGAGCTCGTTTTC 3 &#39; </td></tr><tr><td> 시퀀싱 Primers : Illumina 플랫폼 </td><td> 다양한 공급 업체 </td></tr><tr><td> UpTag 전달 (100uM) </td><td> 5 &#39;CAA GCA GAA GAC GGC ATA CGA GCT CTT CCG GAT GTC ATC T CAC GTC TCT 개그 3&#39; </td></tr><tr><td> UpTag 역방향 (100uM) </td><td> 5 &#39;AAT GAT GCG ACG ACC ACC GAC ACT CTT TCC CTA CAC GAC CTT GCT CCG ATC T NNNNN GTC GAC CTG CGT 전투 편대 ACG 3&#39; </td></tr><tr><td> DownTag 전달 (100uM) </td><td> 5 &#39;CAA GCA GAA GAC GGC ATA CGA GCT CTT GAA CCG ATC T AAC 개그 CTC GAA TTC ATC G 3&#39; </td></tr><tr><td> DownTag 역방향 (100uM) </td><td> 5 &#39;AAT GAT GCG ACG ACC ACC GAC ACT CTT TCC CTA CAC GAC CTT GCT CCG ATC T NNNNN CGG TGT CGG TCT CGT AG 3` </td></tr><tr><td> 1 읽기 UP - 태그 seq 프라이머 (100uM) </td><td> 5 &#39;GTC GAC CTG C​​GT 전투 편대 ACG 3&#39; </td></tr><tr><td> 1 DOWN 태그 seq 프라이머 (100uM)을 읽기 </td><td> 5 &#39;CGG TGT CGG TCT CGT AG 3&#39; </td></tr><tr><td> 이 인덱스 시퀀싱 프라이머 (표준 Illumina R1 프라이머) (100uM)을 읽기 </td><td> 5 &#39;AC ACT CTT TCC CTA CAC GAC CTT GCT CCG ATC T 3&#39; </td></tr><tr><td> 추가 시퀀싱의 시약 / 장비 </td><td></td></tr><tr><td> Qiagen MinElute 96 UF PCR 정화 키트 </td><td> Qiagen, 부분 # 29051 </td></tr><tr><td> 배기기 </td><td> 모든 공급 업체 </td></tr><tr><td> Macherey - 나겔 진공 매니폴드 </td><td> Macherey - 나겔, 부분 # 740 681 </td></tr><tr><td> Invitrogen 퀀트 - IT dsDNA BR 어세이 키트 </td><td> Invitrogen, 부분 # Q32853 </td></tr><tr><td> Invitrogen Qubit 분석 튜브 </td><td> Invitrogen, 부분 # Q32856 </td></tr><tr><td> 40 % 아크릴 아미드 플러스 1 % N, N&#39; - 메틸렌 - 비스 - 아크릴 아미드, 37.5:1 </td><td> 바이오 래드, 부분 # 161-0148 </td></tr><tr><td> 트리스베이스 </td><td> 시그마, 부분 # T1503 - 1KG </td></tr><tr><td> 붕산 </td><td> 시그마, 부분 # B6768 - 500G </td></tr><tr><td> 0.5M EDTA (에틸렌 다이아 민 테트라 초산), 산도 8.0 </td><td> Teknova, 부분 # E0306 </td></tr><tr><td> 암모늄 Persulfate </td><td> 시그마, 부분 # A3678 - 25G </td></tr><tr><td> TEMED </td><td> Bioshop, 부분 # TEM001.25 </td></tr><tr><td> Ethidium의 브로마이드 솔루션 </td><td> Bioshop, 부분 # ETB444.10 </td></tr><tr><td> 0.5M 질산 에틸 </td><td> Teknova, 부분 # A2000 </td></tr><tr><td> 10mM 마그네슘 아세테이트 tetrahydrate </td><td> 시그마, 부분 # M0631 - 100G </td></tr><tr><td> 1mM EDTA (에틸렌 다이아 민 테트라 초산), 산도 8.0 </td><td> 0.5M EDTA (에틸렌 다이아 민 테트라 초산), 산도 8.0를 참조 </td></tr><tr><td> 에탄올 </td><td> 여러 </td></tr><tr><td> 아세트산 나트륨, 산도 5.2 </td><td> Teknova, 부분 # S0297 </td></tr><tr><td> 스피드 진공 </td><td> 여러 </td></tr><tr><td> 단일 읽기 클러스터 생성 키트 </td><td> Illumina, 부분 # GD - 300-1001 </td></tr><tr><td> V4 36c 시퀀싱 키트 </td><td>Illumina, 부분 # FC - 104-4002 </td></tr><tr><td></td><td></td></tr></tbody></table> 10X TBE 요리법 <table border="1"><tbody><tr><td> 금액 </td><td> 시약 </td></tr><tr><td> 108g </td><td> 트리스베이스 </td></tr><tr><td> 55g </td><td> 붕산 </td></tr><tr><td> 40mL </td><td> 0.5M EDTA (에틸렌 다이아 민 테트라 초산) (산도 8.0) </td></tr><tr><td colspan="2"> 1L 표시 DH 2 O 추가 </td></tr></tbody></table> 12 % Polyacrylamide 젤 제조법 <table border="1"><tbody><tr><td> 볼륨 </td><td> 시약 </td></tr><tr><td> 5.8 ML </td><td> 40 % 아크릴 아미드 플러스 1 % N, N&#39; - 메틸렌 - 비스 - 아크릴 아미드, 37.5:1 </td></tr><tr><td> 12 ML </td><td> DH 2 O </td></tr><tr><td> 2 ML </td><td> 10X TBE </td></tr><tr><td> 140 μl </td><td> 10 % 질산 Persulfate </td></tr><tr><td> 총 부피 : 20ml </td><td></td></tr></tbody></table> 프라이머 믹스를 Uptag : Resuspend Uptag 100 μm의에서 ddH 2 O의 Buptagkanmx4 각각 다음 50 μm의 각 최종 농도에 대해 1:1 비율로 섞는다. -20 ° C.에 저장 프라이머 믹스를 Downtag : Resuspend Dntag 및 Bdntagkanmx4 100 μm의에서 ddH 2 O에서 각 후, 50 μm의 각 최종 농도에 대해 1:1 비율로 섞는다. -20 ° C.에 저장 혼합 oligonucleotides : 100 μm의에서 ddH 2 O에 다음과 같은 여덟 oligos (표준 desalted)의 각 Resuspend : Uptag, Dntag, Uptagkanmx, Dntagkanmx, Uptagcomp, Dntagcomp, Upkancomp, Dnkancomp. 12.5 μm의 각 최종 농도에 대한 8 oligonucleotides의 동일한 음량을 섞는다. 12 배 MES 재고 : 10 ML 들어, 8 ML 분자 생물학 등급 물 0.7 g MES 무료 산성 일수화물과 1.93 g MES 나트륨 소금을 풀다. 잘 혼합 후, 산도를 확인하고 산도 6.5-6.7 필요하면 조정합니다. 10 ML의 총 볼륨에 물을 추가합니다. 소독 필터와 4 저장 ° C 빛 (예 : 포일에있는 튜브를 랩)에서 보호. 솔루션은 눈에 보이게 노란색 또는 6 개월 후이된다면 바꿉니다. 2X 하이브 리다이 제이션 버퍼 : 50 ML 들어, 12 배 MES 재고 8.3 ML (2.9.14에서), 5 M NaCl, 0.5 M EDTA (에틸렌 다이아 민 테트라 초산) 10 % 트윈 20 0.1 ML (권 / 권)의 4.0 ML, 그리고 19.9 ML ddH 필터링의 17.7 ML를 섞어 2 O. 소독 필터. 와시 : 혼합 300 ML 20X SSPE, 1 ML 10% 트윈 (권 / 권), 699 ML ddH 2 O.을 소독 필터. 와시 B : 믹스 150 ML 20X SSPE, 1 ML 10% 트윈 (권 / 권), 849 ML ddH 2 O. 소독 필터. 바코드 시퀀싱의 primers UP - 태그 프라이머 시퀀스에서 5 &#39;꼬리 (굵게) F와 R 프라이머에 통합 Illumina 특정 어댑터 시퀀스입니다. 변수 순서 (이탤릭체)는 색인 / 멀티플렉싱 읽기 밖에서 사용하는 5 메르 색인 태그를 나타냅니다. 3 &#39;꼬리 (밑줄) uptag 바코드 측면을 노릴 일반적인 뇌관을 상징하고 효모 바코드를 증폭하기 위해 필요합니다. DOWN - 태그에 뇌관은 5 단, 3 &#39;꼬리가 (밑줄) 증폭하는 데 사용되는 일반 primers로 대체될 것이며, UP - 태그 primers (Illumina 특정 순서)의 꼬리&#39;꼬리가 5 동일 &#39;시퀀스 DOWN을 태그는 바코드.

competitive genomic screens of barcoded yeast libraries

차세대 시퀀싱 기술의 진보 미덕으로, 우리는 거의 매일 새로운 게놈 시퀀스에 액세스할 수 있습니다. 이러한 발전의 템포는보다 깊이와 폭이 약속, 가속됩니다. 이러한 놀라운 발전에 비추어, 유전자 기능을 정의하기 위해 고속, 병렬 방법에 대한 필요성이 점점 중요 해지고 있습니다. 효모와 E.의 게놈 전체 삭제 돌연변이의 컬렉션 대장균은 유전자 기능의 기능 특성에 대한 workhorses 역임 있지만,이 접근법은 확장성 아니라, 현재의 유전자 삭제 방법은 삭제하고 확인하는 게놈을 구성하는 유전자의 수천의 각 필요합니다. 이 작업이 완료 후에 우리는 높은 처리량 phenotyping을 추구하실 수 있습니다. 지난 10 년간 우리 연구실 경쟁, 소형, 높은 처리량 게놈 - 와이드 병렬로 수행할 수 있습니다 assays의 포트폴리오를 정제하고 있습니다. 이 parallelization은 바코드가 돌연변이에 대한 프록시 역할을 함께하기 때문에 DNA &#39;태그&#39;또는 각각의 돌연변이에 &#39;바코드&#39;의 포함 가능한이며 하나는 돌연변이 적합성을 평가하기위한 바코드 풍부한을 측정할 수 있습니다. 본 연구에서는, 우리는 DNA 시퀀스 및 barcoded 돌연변이 컬렉션 사이의 간격을 채우기 위해 추구합니다. 이를 위해 우리는 새로 합성 최대 병렬 바코드 assays를 열고 있지만, 제대로 미생물 특징 결합 transposon 중단 - barcoding 방식을 소개합니다. 이 접근법을 설명하기 위해 우리는 새로운 캔디다 albicans barcoded 중단 수집을 제시하고 모두 microarray 기반 및 차세대 시퀀싱 기반 플랫폼이 10,000 수집하는 데 사용할 수있는 방법에 대해 설명 - 단일 실험에서 1,000,000 유전자 - 유전자 및 약물 - 유전자 상호 작용합니다.

Watch this Scientific Journal Video about Competitive Genomic Screens of Barcoded Yeast Libraries at JoVE.com

Competitive Genomic Screens of Barcoded Yeast Libraries

우리는 유전자 - 약물 및 유전자 - 환경 상호 작용을 이해하는 포괄적인 불편 게놈 - 와이드 스크린을 개발했습니다. 이러한 돌연변이 컬렉션을 검사 방법이 제공됩니다.

Barcoded 효모 게놈 라이브러리의 경쟁력 화면

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

competitive-genomic-screens-of-barcoded-yeast-libraries

Research

JoVE Journal

Biology

18.1K 조회수.  University of Toronto. 우리는 유전자 - 약물 및 유전자 - 환경 상호 작용을 이해하는 포괄적인 불편 게놈 - 와이드 스크린을 개발했습니다. 이러한 돌연변이 컬렉션을 검사 방법이 제공됩니다.

비디오: Competitive Genomic Screens of Barcoded Yeast Libraries

Large-Scale Screens of Metagenomic Libraries

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation. Generating a streamlined procedure for creating and screening metagenomic libraries is therefore useful for efficient high-throughput investigations into the genetic and metabolic properties of uncultured microbial assemblages. Here, key protocols are presented on video, which we propose is the most useful format for accurately describing a long process that alternately depends on robotic instrumentation and (human) manual interventions. First, we employed robotics to spot library clones onto high-density macroarray membranes, each of which can contain duplicate colonies from twenty-four 384-well library plates. Automation is essential for this procedure not only for accuracy and speed, but also due to the miniaturization of scale required to fit the large number of library clones into highly dense spatial arrangements. Once generated, we next demonstrated how the macroarray membranes can be screened for genes of interest using modified versions of standard protocols for probe labeling, membrane hybridization, and signal detection. We complemented the visual demonstration of these procedures with detailed written descriptions of the steps involved and the materials required, all of which are available online alongside the video.

Metagenomic 도서관 대규모 화면

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation.  Generating a ...

연구

생물학

Isolation of Genomic DNA from Mouse Tails

마우스 뒷면에서 게놈 DNA의 분리

Large Insert Environmental Genomic Library Production

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent environmental genomic (i.e. metagenomic) approaches have emerged, enabling researchers to bridge this cultivation gap by capturing the genetic content of indigenous microbial communities directly from the environment. To this end, genomic DNA libraries are constructed using standard albeit artful laboratory cloning techniques. Here we describe the construction of a large insert environmental genomic fosmid library with DNA derived from the vertical depth continuum of a seasonally hypoxic fjord. This protocol is directly linked to a series of connected protocols including coastal marine water sampling [1], large volume filtration of microbial biomass [2] and a DNA extraction and purification protocol [3]. At the outset, high quality genomic DNA is end-repaired with the creation of 5 -phosphorylated blunt ends. End-repaired DNA is subjected to pulsed-field gel electrophoresis (PFGE) for size selection and gel extraction is performed to recover DNA fragments between 30 and 60 thousand base pairs (Kb) in length. Size selected DNA is purified away from the PFGE gel matrix and ligated to the phosphatase-treated blunt-end fosmid CopyControl vector pCC1 (EPICENTRE <a href="http://www.epibio.com/item.asp?ID=385">http://www.epibio.com/item.asp?ID=385</a>). Linear concatemers of pCC1 and insert DNA are subsequently headfull packaged into phage particles by lambda terminase, with subsequent infection of phage-resistant E. coli cells. Successfully transduced clones are recovered on LB agar plates under antibiotic selection and archived in 384-well plate format using an automated colony picking robot (Qpix2, GENETIX). The current protocol draws from various sources including the CopyControl Fosmid Library Production Kit from EPICENTRE and the published works of multiple research groups [4-7]. Each step is presented with best practice in mind. Whenever possible we highlight subtleties in execution to improve overall quality and efficiency of library production. The whole process of fosmid library production and automated colony picking takes at least 7-10 days as there are many incubation steps included. However, there are several stopping points possible which are mentioned within the protocol.

Construction of a fosmid library with environmental genomic DNA isolated from the vertical depth continuum of a seasonally hypoxic fjord is described. The resulting clone library is picked into 384-well plates and archived for downstream sequencing and functional screening by the application of an automated colony picking system.

대형 삽입 환경 게놈 라이브러리 제작

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent ...

Purification of Mitochondria from Yeast Cells

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play essential roles in apoptotic cell death2, cell survival3, mammalian development4, neuronal development and function4, intracellular signalling5, and longevity regulation6. Our understanding of these complex biological processes controlled by mitochondria relies on robust methods for assessing their morphology, their protein and lipid composition, the integrity of their DNA, and their numerous vital functions. The budding yeast Saccharomyces cerevisiae, a genetically and biochemically manipulable unicellular eukaryote with annotated genome and well-defined proteome, is a valuable model for studying the molecular and cellular mechanisms underlying essential biological functions of mitochondria. For these types of studies, it is crucial to have highly pure mitochondria. Here we present a detailed description of a rapid and effective method for purification of yeast mitochondria. This method enables the isolation of highly pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification. Mitochondria purified by this method are suitable for cell-free reconstitution of essential mitochondrial processes and can be used for the analysis of mitochondrial structure and functions, mitochondrial proteome and lipidome, and mitochondrial DNA.

We describe a rapid and effective method for purification of mitochondria from the yeast Saccharomyces cerevisiae. This method enables the high-yield isolation of pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification.

효모 세포 Mitochondria의 정화

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play ...

Development of automated imaging and analysis for zebrafish chemical screens.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK pathway in zebrafish embryos. The zebrafish embryo is an ideal system for in vivo high-content chemical screens. The 1-day old embryo is approximately 1mm in diameter and can be easily arrayed into 96-well plates, a standard format for high throughput screening. During the first day of development, embryos are transparent with most of the major organs present, thus enabling visualization of tissue formation during embryogenesis. The complete automation of zebrafish chemical screens is still a challenge, however, particularly in the development of automated image acquisition and analysis. We previously generated a transgenic reporter line that expresses green fluorescent protein (GFP) under the control of FGF activity and demonstrated their utility in chemical screens 1. To establish methodology for high throughput whole organism screens, we developed a system for automated imaging and analysis of zebrafish embryos at 24-48 hours post fertilization (hpf) in 96-well plates 2. In this video we highlight the procedures for arraying transgenic embryos into multiwell plates at 24hpf and the addition of a small molecule (BCI) that hyperactivates FGF signaling 3. The plates are incubated for 6 hours followed by the addition of tricaine to anesthetize larvae prior to automated imaging on a Molecular Devices ImageXpress Ultra laser scanning confocal HCS reader. Images are processed by Definiens Developer software using a Cognition Network Technology algorithm that we developed to detect and quantify expression of GFP in the heads of transgenic embryos. In this example we highlight the ability of the algorithm to measure dose-dependent effects of BCI on GFP reporter gene expression in treated embryos.

We report the development of a system for automated imaging and analysis of zebrafish transgenic embryos in multiwell plates. This demonstrates the ability to measure dose dependent effects of a small molecule, BCI, on Fibroblast Growth Factor reporter gene expression and provide technology for establishing high-throughput zebrafish chemical screens.

zebrafish 화학 화면을위한 자동화 이미징 및 분석의 개발.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK ...

Yeast Colony Embedding Method

Patterning of different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms also display patterns of cell types. For example, in the yeast S. cerevisiae, sporulated cells and pseudohyphal cells are not uniformly distributed in colonies. The functional importance of patterning and the molecular mechanisms that underlie these patterns are still poorly understood.
One challenge with respect to investigating patterns of cell types in fungal colonies is that unlike metazoan tissue, cells in colonies are relatively weakly attached to one another. In particular, fungal colonies do not contain the same extensive level of extracellular matrix found in most tissues . Here we report on a method for embedding and sectioning yeast colonies that reveals the interior patterns of cell types in these colonies. The method can be used to prepare thick sections (0.5 &mu;) useful for light microscopy and thin sections (0.1 &mu;) suitable for transmission electron microscopy. Asci and pseudohyphal cells can easily be distinguished from ovoid yeast cells by light microscopy , while the interior structure of these cells can be visualized by EM.
The method is based on surrounding colonies with agar, infiltrating them with Spurr's medium, and then sectioning. Colonies with a diameter in the range of 1-2 mm are suitable for this protocol. In addition to visualizing the interior of colonies, the method allows visualization of the region of the colony that invades the underlying agar.

A method for embedding yeast colonies allowing sectioning for light and electron microscopy. This protocol allows determination of the distribution of sporulated cells and pseudohyphal cells within colonies providing a new tool toward understanding the organization of cell types within a fungal community.

효모 콜로니 임베딩 방법

Patterning of  different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms ...

Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in their nucleotide composition and consist of a complex mosaic of sequence patterns. These patterns include so-called Mid-Range Inhomogeneity (MRI) regions -- sequences 30-10000 nucleotides in length that are enriched by a particular base or combination of bases (e.g. (G+T)-rich, purine-rich, etc.). MRI regions are associated with unusual (non-B-form) DNA structures that are often involved in regulation of gene expression, recombination, and other genetic processes (Fedorova &amp; Fedorov 2010). The existence of a strong fixation bias within MRI regions against mutations that tend to reduce their sequence inhomogeneity additionally supports the functionality and importance of these genomic sequences (Prakash et al. 2009).
Here we demonstrate a freely available Internet resource -- the Genomic MRI program package -- designed for computational analysis of genomic sequences in order to find and characterize various MRI patterns within them (Bechtel et al. 2008). This package also allows generation of randomized sequences with various properties and level of correspondence to the natural input DNA sequences. The main goal of this resource is to facilitate examination of vast regions of non-coding DNA that are still scarcely investigated and await thorough exploration and recognition.

We present a public computational web site for the analysis of genomic sequences. It detects DNA sequence patterns with various non-random nucleotide compositions. This resource also generates randomized sequences with diverse levels of complexity.

게놈 MRI - 게놈 DNA 시퀀스 내의 패턴을 학습에 대한 공개 자료

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in ...

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic redundancy affecting simple genetics in higher plants. The novel model organism Ostreococcus tauri is the smallest free-living eukaryote known to date, and possesses a greatly reduced genome size and cellular complexity1,2, manifested by the presence of just one of most organelles (mitochondrion, chloroplast, golgi stack) per cell, and a genome containing only ~8000 genes. Furthermore, the combination of unicellularity and easy culture provides a platform amenable to chemical biology approaches. Recently, Ostreococcus has been successfully employed to study basic mechanisms underlying circadian timekeeping3-6. Results from this model organism have impacted not only plant science, but also mammalian biology7. This example highlights how rapid experimentation in a simple eukaryote from the green lineage can accelerate research in more complex organisms by generating testable hypotheses using methods technically feasible only in this background of reduced complexity. Knowledge of a genome and the possibility to modify genes are essential tools in any model species. Genomic1, Transcriptomic8, and Proteomic9 information for this species is freely available, whereas the previously reported methods6,10 to genetically transform Ostreococcus are known to few laboratories worldwide.
In this article, the experimental methods to genetically transform this novel model organism with an overexpression construct by means of electroporation are outlined in detail, as well as the method of inclusion of transformed cells in low percentage agarose to allow selection of transformed lines originating from a single transformed cell. Following the successful application of Ostreococcus to circadian research, growing interest in Ostreococcus can be expected from diverse research areas within and outside plant sciences, including biotechnological areas. Researchers from a broad range of biological and medical sciences that work on conserved biochemical pathways may consider pursuing research in Ostreococcus, free from the genomic and organismal complexity of larger model species.

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

This article describes genetic transformation of the unicellular marine alga Ostreococcus tauri by electroporation. This eukaryotic organism is an effective model platform for higher plants, possesing greatly reduced genomic and cellular complexity and being readily amenable to both cell culture and chemical biology.

Picoeukaryote의 게놈 변환<em&gt; Ostreococcus 타우 리</em

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

게놈 DNA에서 도보로 5 hydroxymethylcytosine의 선택적 캡처

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Assessing Differences in Sperm Competitive Ability in Drosophila

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the number of successful mating events rather than on maximizing survival and viability 1. Sperm competition represents the competition between males after copulating with the same female 2, in which their sperm are coincidental in time and space. This phenomenon has been reported in multiple species of plants and animals 3. For example, wild-caught D. melanogaster females usually contain sperm from 2-3 males 4. The sperm are stored in specialized organs with limited storage capacity, which might lead to the direct competition of the sperm from different males 2,5.
Comparing sperm competitive ability of different males of interest (experimental male types) has been performed through controlled double-mating experiments in the laboratory 6,7. Briefly, a single female is exposed to two different males consecutively, one experimental male and one cross-mating reference male. The same mating scheme is then followed using other experimental male types thus facilitating the indirect comparison of the competitive ability of their sperm through a common reference. The fraction of individuals fathered by the experimental and reference males is identified using markers, which allows one to estimate sperm competitive ability using simple mathematical expressions 7,8. In addition, sperm competitive ability can be estimated in two different scenarios depending on whether the experimental male is second or first to mate (offense and defense assay, respectively) 9, which is assumed to be reflective of different competence attributes.
Here, we describe an approach that helps to interrogate the role of different genetic factors that putatively underlie the phenomenon of sperm competitive ability in D. melanogaster.

Assessing Differences in Sperm Competitive Ability in Drosophila

Differential sperm competitive ability among Drosophila males with distinct genotypes can be ascertained through double-mating experiments. Each of these experiments involves one of the males of interest and a reference male. Readily identifiable markers in the progeny allow inference of the fraction of individuals fathered by each male.

정자 경쟁의 능력에 대한 평가의 차이<em&gt; 초파리</em

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the ...