이 작품은 바이오 메디컬 연구 우수 웨스트 버지니아 아이디어 네트워크에 미국 항공 우주국 웨스트 버지니아 공간 부여 컨소시엄 (NASA WVSGC), 낭포 성 섬유증 재단 (CFF-YU11G0)와 NIH P20RR016477 및 P20GM103434에 의해 지원되었다. 우리는이 작업과 기술 지원을 Vonya M. Eisinger 감사합니다.

1. 균주의 제조 및 Biparental 활용 <ol><li> E.에게 접종 37 ℃에서 하룻밤 진탕 배양기에서 겐타 마이신과 장소의 15 ㎍ / ㎖로 보충 루리아 국물 (LB) 5 ㎖의 대장균 SM10/λpir/pFAC </li><li> P.에게 접종 녹농균 변형 LB 5 ㎖의 PAO1, 그리고 흔들리는 인큐베이터에있는 장소 하룻밤 42 ℃에서 </li><li> OD 하룻밤 문화 (600)를 측정하고 PAO1와 E 같은 양을 혼합 콜라이 pFAC은 최종 부피는 1-1.4 ML 사이 그러한된다. </li><li> 5 분 6,000 XG에 원심 분리기의 혼합물. </li><li> 한편, 활용을 위해 LB 플레이트를 건조 : 10 ~ 15 분 동안 37 ° C에서 인큐베이터에 열려있는 판을 둡니다. </li><li> 세포 혼합물로부터 상층 액 50 μL를 제외한 나머지를 모두 제거합니다. </li><li> 하나의 컴팩트 한 방울에 건조 LB 판에 뜨는 피펫의 나머지 50 μL의 세포 펠렛을 Resuspend. </li><li> 조심스럽게 (IMPO 건조 흄 후드에서 플레이트를 배치RTANT 참고) 접시에 걸쳐 세포가이 크게 활용의 효율성을 감소 할 수 있도록하지 마십시오. </li><li> 물방울이 건조되면, LB 플레이트를 거꾸로하고 4-6 시간 동안 37 ° C에서 알을 품다. </li><li> 세포 혼합물을 배양하는 동안, 겐타 마이신 300 μg / ㎖로 큰 (150 OD × 15 ㎜) PIA 판을 준비합니다. 사용하기 전에 15 ~ 20 분 동안 37 ° C에서 인큐베이터에 배치하여 잔류 수분을 제거합니다. </li><li> 세포 혼합액의 배양이 완료된 후, 멸균 접종 루프를 사용하여 세포를 수집하고 1 ㎖ LB와 소용돌이 또는 피펫을 함유하는 마이크로 원심 분리 튜브에서 충분히 섞고. </li><li> 큰 PIA 플레이트가 300 ㎍ / ㎖의 겐타 마이신을 포함에 균등하게 세포를 확산. (중요은 : 등), 500 μL 10 μL, 플레이트 2 : 50 μL, 플레이트 3 : 100 μL, 플레이트 4이 단계의 경우, 예를 들어 플레이트 1 (플레이트를 분리하는 세포 혼합물의 증가 볼륨을 추가하는 것이 가장 좋습니다 . </li><li> 37에서 하룻밤을 품다° C. </li></ol> 2. 감지 및 점액 식민지의 분리 <ol><li> 인큐베이터에서 접시를 제거하고 점액 식민지에 대한 검사. </li><li> 작은 판 PIA 겐타 마이신 300 μg / ㎖로 (100 OD × 10 ㎜)에 격리에 대해 하나의 점액 식민지 행진을 분리합니다. </li><li> 37 ℃에서 하룻밤 배양한다 </li><li> 이전 하룻밤 문화에 2.2 단계를 반복합니다. </li><li> 반복 점액 분리의 안정성을 결정하기 위해 2.2-2.4 두 번 더 반복합니다. </li><li> 최종 분리 단계 후, 하나의 점액 식민지와 LB의 4.5 ㎖를 접종하고 37 ℃에서 하룻밤 진탕 배양 </li><li> 다음날, 각 점액 돌연변이 레이블 3 마이크로 원심 튜브. </li><li> 게놈 DNA의 추출 및 트랜스포존 삽입 부위의 식별을위한 2 관 (프로토콜 3 참조)에 하룻밤 문화의 두 1.25 ㎖를 분취를 준비합니다. </li><li> 또한, appropriat에 1 ㎖ 하룻밤 문화를 피펫으로 각 점액 돌연변이를 보관10 % 탈지 우유를 동일 부피를 함유 엘리-표지 cryovial. -86 ° C.에 저장 </li></ol> 3. gDNA를 제한 소화 및 결찰 <ol><li> 어떤 선호하는 방법 (예를 들면. 페놀 - 클로로포름, 스핀 열 등)를 사용하여 점액 돌연변이 체에서 gDNA를 압축을 풉니 다. </li><li> gDNA를의 농도를 결정, 제한 효소 SalI으로 2 μg 1 μL의 전체를 소화, 소 혈청 알부민, SalI로 효소 완충액 (100 mM의 염화나트륨, 50 mM 트리스 - 염산, 10 mM의 MgCl2를 5 μL의 0.5 μL , 1 mM의 Dithiothrietol (DTT), 실온에서 pH를 7.9) 및 50 μL의 총 부피를 달성하기 dH보다 2 O의 적절한 볼륨. </li><li> 37 ℃에서 하룻밤 DNA 다이제스트 (중요 :. 제한 효소의 효율에 따라서는 하룻밤 다이제스트에 추가 1 μl를 추가하고 1 ~ 2 시간 동안 37 ° C에서 배양 할 필요가있다이 밤새 다이제스트에 추가됩니다.) </li><li> DIGE 정화어떤 선호하는 방법 (예를 들어, 아가 로스 젤 정화, 스핀 열) 및 버퍼의 25 μL로 용출을 사용 STED DNA. </li><li> ~ 10-20 NG / μL의 바람직한 농도, 라이 게이션 완충액 1.5 μL (330 mM 트리스 - 아세테이트 pH를 7.5, 660 mM의 아세트산 칼륨, 100 mM의 아세트산 마그네슘, 5 mm의 정제 된 DNA의 11 μL를 혼합하여 소화 DNA를 결찰 DTT), 100 mM의 ATP의 1.5 μL, 1 μL의 DNA 리가 아제. </li><li> 실온에서 15 분 동안 혼합물을 부화 한 후 70 ℃에서 15 분 동안 배양하여 효소를 실활 (주 : 이상 동안 실온에서 혼합물을 배양하는 결찰의 성공을 증가시킬 수있다). </li></ol> 4. 역 PCR (iPCR을) 및 시퀀스 분석 <ol><li> 앞으로 다음과 역방향 프라이머와 조건을 열 순환을 이용하여 결찰 제품에 iPCR을을 수행합니다 : - 포워드 프라이머 (Gm3OUT) : GGGCATACGGGAAGAAGTGA - 역방향 프라이머 (Gm5OUT) : GACTGCCCTGCTGCGTAACA 열 순환기 콘돌리자tions : 1. 1 분 동안 94 ° C에서. 2. 1 분 동안 94 ° C에서. 3. 2 분 동안 58 ° C에서. 4. 2 분 72 ° C에서. 5. 8 분 72 ° C에서. 6. 10 ° C에서 개최. 반복 34 회 2-4 단계를 반복합니다. (참고 : 증폭 된 iPCR 제품은 4 ℃에서 저장 될 수 있습니다) </li><li> 성공하는 iPCR 증폭을 확인하는 아가로 오스 겔 전기 영동을 수행합니다. </li><li> Gm3OUT 및 Gm5OUT 프라이머를 사용하는 iPCR 제품에 대한 시퀀싱을 수행합니다. 삽입 부위와 himar1의 방향이 밖으로 매핑됩니다. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

저자 훙 웨이 D. 유 최고 과학 책임자 Progenesis 기술의 공동 설립자, LLC입니다.

또한이 방법은 이러한 변경과 다른 슈도모나스 종에서 사용할 수 있음을주의하는 것이 중요하다 : P.보기 부화 의 fluorescens와 P. 30 ° C에서 푸티하고, P. 42 ° C에서 stutzeri, P. stuzeri은 겐타 마이신 150 ㎍ / mL의 보충 LB 플레이트에서 배양되어야한다 단계 1.11, P.에 stutzeri 세포는 LB 500 ㎕를 대신 1 ㎖로 전송해야한다. 또한이 프로토콜에 대한 두 가지 중요한 단계?...

알긴산 염을 과잉 생산하는 기회, 그람 음성 병원균 녹농균의 능력은 생물막을 확립하는 기능의 주요 요인이다. 알긴산의 과잉 생산은 종종 mucoidy 언급 표현형이다. 낭포 성 섬유증 (CF)로 고통받는 개인의 가래에서 점액 콜로니의 절연은 만성 감염 나타낸다 직접 환자의 건강 하나의 전체적인 감소와 연관된다. 현재는 것이 이해된다 P.있는 알긴산의 규제 및 생산 녹농균은 주로 두 오페론에서 발생한다. 에서 알긴산 고분자의 합성 및 수출에 대한 책임이 있습니다 (조류 - alg8 - alg44 - algK - ALGE - algG - algX - algL - algI - algJ - - algF algD) 첫 번째는 12 유전자를 포함하는 알긴산 생합성 오페론이다 세포 environme에 페리 플라 즘NT 2-5. 두 번째 오페론은 대체 시그마 인자에게도 누군가 / T로 시작 mucA, mucB 및 MUCD 계속 유전자의 클러스터입니다. mucAB-D는 알긴산 생산 6-8의 부정적인 규제로 분류하는 동안 당신에게도 누군가 / T는, 긍정적 인 레귤레이터이다. 또한, 전사 등 ALGB, AlgQ, AlgR 및 RpoN 등의 규제뿐만 아니라, 전사 후 및 이화 억압 제어, 키나제 활성 (KinB) 및 intramembrane 단백질 분해에 의해 번역 후 변형은 또한 알긴산에 관여하는 것으로 밝혀졌다 규제 9-14. pFAC로 알려진 미니 himar1의 트랜스포존 벡터는 원래 하버드 의과 대학 (15) 박사 Mekalanos &#39;실험실에서 만들어졌습니다. pFAC 플라스미드는 두 개의 27 비트로의 반전 반복 중간에 겐타 마이신 저항 카세트 테이프 (aacC1 : 534 BP)에 의해 형벌 인자 (transposable element)로 구성되어, hyperact를 코딩하는 유전자선원 트랜스 포사 (16) 및 코딩하는 유전자 β-락타 마제 (BLA) (그림 1) 필자. DQ366300 13 : pFAC의 인자 (transposable element)의 시퀀스 정보는 GenBank 액 번호로 사용할 수 있습니다. pFAC에서, 역 PCR을 사용하여 염색체의 삽입 부위의 식별을 위해 사용된다 aacC1 유전자 뒤에 다중 클로닝 부위 (MCS)가있다. 미니 himar1의 트랜스포존을 사용하여 하나의 큰 장점은 특정 호스트 요인 트랜스 (돌연변이) 필요하지 않습니다이다. 또한, P.의 게놈에 걸쳐 발견 TA 디 뉴클레오티드 삽입 사이트의 높은 풍부가있다 녹농균. 각각의 게놈을, 예를 들어, TA 디 ​​뉴클레오티드 삽입 사이트는 PAO1에 94404과 100229 번 발생 (6264404 BPS, GenBank 액 번호 NC_002516.2) 및 PA14 (GenBank 등록 액세스 번호 NC_008463 6537648 BPS). 때문에 게놈, 미니 himar1에서 TA 디 뉴클레오티드의 풍요 </em&gt; 트랜스포존 독성 유전자의 분석 및 고도로 조절되는 유전자에 특히 적합하다 고밀도 및 무작위 돌연변이 유발을 일으킬 수있다. 이론적으로, 미니 himar1의 트랜스포존은 P.의 게놈 내에서 중요하지 않은 유전자에 삽입 할 수있는 녹농균. 이 PAO1 게놈의 오픈 리딩 프레임 당 약 18 TA 삽입 사이트를 제공합니다. 여기, 우리는 P.에 mucoidy의 새로운 규제를 식별하는 미니 himar1의 트랜스포존 매개 돌연변이 유발을 사용하여 프로토콜을 설명 녹농균. 보다 구체적으로, 우리 biparentally E.부터 미니 himar1 트랜스포존을 함유 pFAC 벡터를 접합 nonmucoid prototrophic 변형 PAO1에 대장균 SM10/λpir. 트랜스포존은 게놈에 통합 된 후, 수신자 균주는 슈도모나스 분리 한천 E.의 성장을 억제 (PIA) 덴타에 배양 대장균. 따라서,의 돌연변이 체 라이브러리 <em&gt; P. 녹농균은 겐타 마이신 및 유 점액 표현형의 존재로 보충 PIA 접시에 성장에 의해 선택 될 수있다. 진정한 트랜스포존 매개 통합 돌연변이 대 겐타 마이신 내성 및 실린 민감한 표현형을해야합니다 유의하십시오. 본 연구에서는 PAO1 약 80,000 삽입 돌연변이 체는 네 개의 별도의 활용형을 분리 하였다. 우리는 그 점액 분리에 대한 검사를하고, 제한 효소 소화, 결찰 및 역 PCR에 의한 삽입의 위치를​​ 결정. 우리는 게놈 당 삽입의 수를 볼 프로브로 겐타 마이신 저항 카세트를 사용하여 서던 블롯 분석을 수행 하였다. 우리는이 프로토콜을 사용하여 접합 당 얻은 돌연변이의 90 % 이상이 게놈에 himar1의 단 하나의 사본을 가지고 있었고, 겐타 마이신 내성 및 실린 민감한 표현형을 표시 것으로 판단. 32 점액 분리의 총이 확인되었으며, 그 중 22 P.의 다른 궤적에 매핑 된 녹농균 PAO1염색체. 삽입이 비율은 알긴산 과잉 생산의 몇 가지 새로운 규제를 식별하기 위해 적절한 범위를 제공합니다.

<table border="0" cellpadding="0" cellspacing="0" width="780">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:267px;">Luria Broth</td>
			<td style="width:187px;">Difco</td>
			<td style="width:125px;">240230</td>
			<td style="width:203px;">via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pseudomonas isolation agar</td>
			<td>Difco</td>
			<td>292710</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small Plates (100 O.D. x 10 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-13</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Large Plates (150 O.D. x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-14</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td>Fisher Scientific</td>
			<td>BP229-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Shaking Incubator</td>
			<td>New Brunswick Scientific</td>
			<td>Innova 4080</td>
			<td>shake at 200 rpm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cabinet Incubator</td>
			<td>VWR</td>
			<td>1540</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Microcentrifuge</td>
			<td>Sorvall</td>
			<td>75-003-287</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td>Bio-Rad</td>
			<td>170-2525</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diposable Inoculation Loops</td>
			<td>Fisher Scientific</td>
			<td>22-363-597</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.5 mL Microcentrifuge Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15 mL Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Skim Milk</td>
			<td>Difco</td>
			<td>DF0032-17-3</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNeasy Blood and Tissue (250)&#160;</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick PCR Purification Kit (250)</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit (250)&#160;</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastLink II DNA Ligation Kit</td>
			<td>Epicentre Technologies</td>
			<td>LK6201H</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accu block Digital Dry Bath&#160;</td>
			<td>Labnet</td>
			<td>NC0205808</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sal1, restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0138L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStart Micro 50</td>
			<td>Molecular BioProducts</td>
			<td>6020</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England BioLabs</td>
			<td>M0267L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iCycler, Thermocycler</td>
			<td>Bio-Rad</td>
			<td>170-8740</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LE agarose</td>
			<td>Genemate</td>
			<td>3120-500</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP918-1</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
	</tbody>
</table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

녹농균은 다양한 대사 기능이있는 그람 음성, 환경 세균이다. P. 녹농균은 낭포 성 섬유증 (CF) 환자에서 만성 폐 감염을 확립 기회 세균성 병원체이다. 또한 mucoidy로 알려진 알긴산이라는 캡슐 다당류의 생산 과잉은 항생제 화학 요법과 호스트 방어에 플랑크톤 세포보다 더 많은 저항 점액 바이오 필름의 형성을 촉진한다. 또한, 점액 표현형 nonmucoid의 변환은 CF 만성 감염의 발병에 대한 임상 마커입니다. P.에 의해 알긴산 과잉 생산 녹농균은 크게 세포 에너지를 세금을 에너지 흡수성 과정이다. 따라서, 알긴산 생산은 매우 P.에서 규제 녹농균. 더 알긴산 규제를 이해하기 위해, 우리는 신규 알긴산 레귤레이터의 식별을위한 미니 himar1 트랜스포존 돌연변이 유발을 사용하여 프로토콜을 설명프로토 타입의 변형 PAO1에서의. 이 절차는 두 가지 기본 단계로 구성됩니다. 첫째, 우리는 호스트 E.에서 미니 himar1의 트랜스포존 (pFAC)을 전송 받는 사람 P.에 대장균 SM10/λpir 겐타 마이신으로 보충 슈도모나스 분리 아가 플레이트상에서 선택 하였다 고밀도 삽입 돌연변이 체 라이브러리를 생성하기 biparental 공액 통해 녹농균 PAO1. 둘째, 우리는 검사 및 겐타 마이신 카세트 및 DNA 염기 서열에서 바깥쪽으로 가리키는 DNA 프라이머를 사용하여 PCR 역을 통해 삽입 사이트를 매핑하는 점액 식민지입니다. 이 프로토콜을 사용하여, 우리는 (22 σ AlgT) 야생형 mucA 마스터 알긴산 레귤레이터에게도 누군가의 안티 - 시그마 인자 MucA을 인코딩 변형 PAO1 두 ​​소설 알긴산 조절기, MUCE (PA4033) 및 kinB (PA5484)를 확인했습니다 . 이것은 높은 처리량 돌연변이 유발 프로토콜은 깔깔 변화를 일으키는 다른 병원성 관련 유전자의 식별을 위해 수정 될 수있다뉴욕의 형태.

도 1에 도시 된 바와 같이, 미니 himar1 마리너 트랜스포존 벡터 pFAC는 TA 삽입 위치가 σ 70-의존성 프로모터 및 다중 클로닝 부위 (MCS)와 aacC1의 겐타 마이신 내성 카세트를 플 랭킹 두 27 bp의 반전이 반복을 포함한다. 또한, pFAC 벡터는 높은 활성 himar1의 트랜스 포사, β-락타 마제 (BLA) 및 육 차원 속의 전송 오페론을 코딩하는 유전자를 포함하고 있...

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

여기서 우리는, 화면 고밀도 삽입 돌연변이 체 라이브러리를 생성하기위한 미니 himar1 마리너 트랜스포존-매개 돌연변이 유발을 사용하여 프로토콜을 설명 분리 및 프로토 타입 녹농균 스트레인 PAO1 참신한 알긴산 레귤레이터를 식별한다.

에 알긴산 생산과 관련된 새로운 유전자의 식별<em&gt; 녹농균</em&gt; 사용 미니<em&gt; himar1</em&gt; 마리너 트랜스포존 매개 돌연변이 유발

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K 조회수.  Marshall University.  여기서 우리는, 화면 고밀도 삽입 돌연변이 체 라이브러리를 생성하기위한 미니 himar1 마리너 트랜스포존-매개 돌연변이 유발을 사용하여 프로토콜을 설명 분리 및 프로토 타입 녹농균 스트레인 PAO1 참신한 알긴산 레귤레이터를 식별한다. 

비디오: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living surfaces. In this paper, we describe protocols for forming Pseudomonas aeruginosa biofilms on human airway epithelial cells (CFBE cells) grown in culture. In the first method (termed the Static Co-culture Biofilm Model), P. aeruginosa is incubated with CFBE cells grown as confluent monolayers on standard tissue culture plates. Although the bacterium is quite toxic to epithelial cells, the addition of arginine delays the destruction of the monolayer long enough for biofilms to form on the CFBE cells. The second method (termed the Flow Cell Co-culture Biofilm Model), involves adaptation of a biofilm flow cell apparatus, which is often used in biofilm research, to accommodate a glass coverslip supporting a confluent monolayer of CFBE cells. This monolayer is inoculated with P. aeruginosa and a peristaltic pump then flows fresh medium across the cells. In both systems, bacterial biofilms form within 6-8 hours after inoculation. Visualization of the biofilm is enhanced by the use of P. aeruginosa strains constitutively expressing green fluorescent protein (GFP). The Static and Flow Cell Co-culture Biofilm assays are model systems for early P. aeruginosa infection of the Cystic Fibrosis (CF) lung, and these techniques allow different aspects of P. aeruginosa biofilm formation and virulence to be studied, including biofilm cytotoxicity, measurement of biofilm CFU, and staining and visualizing the biofilm.

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

This paper describes different methods of growing Pseudomonas aeruginosa biofilms on cultured human airway epithelial cells. These protocols can be adapted to study different aspects of biofilm formation, including visualization of the biofilm, staining of the biofilm, measuring the colony forming units (CFU) of the biofilm, and studying biofilm cytotoxicity.

공동 문화 모델 녹농균 Biofilms는 라이브 인간 에어웨이 세포에 들어라

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living ...

연구

면역학 및 감염병학

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

옥내 핵산 - 수정 Oligonucleotides에 의해 Transfection 및 모기 세포 대상 유전자의 돌연변이 유발

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological properties compared to free living microorganisms. Biofilms in nature are often difficult to investigate and reside under poorly defined conditions1. Using a transparent substratum it is possible to device a system where simple biofilms can be examined in a non-destructive way in real-time: here we demonstrate the assembly and operation of a flow cell model system, for in vitro 3D studies of microbial biofilms generating high reproducibility under well-defined conditions2,3.
The system consists of a flow cell that serves as growth chamber for the biofilm. The flow cell is supplied with nutrients and oxygen from a medium flask via a peristaltic pump and spent medium is collected in a waste container. This construction of the flow system allows a continuous supply of nutrients and administration of e.g. antibiotics with minimal disturbance of the cells grown in the flow chamber. Moreover, the flow conditions within the flow cell allow studies of biofilm exposed to shear stress. A bubble trapping device confines air bubbles from the tubing which otherwise could disrupt the biofilm structure in the flow cell.
The flow cell system is compatible with Confocal Laser Scanning Microscopy (CLSM) and can thereby provide highly detailed 3D information about developing microbial biofilms. Cells in the biofilm can be labeled with fluorescent probes or proteins compatible with CLSM analysis. This enables online visualization and allows investigation of niches in the developing biofilm. Microbial interrelationship, investigation of antimicrobial agents or the expression of specific genes, are of the many experimental setups that can be investigated in the flow cell system.

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Protocol describing the application of a flow cell system for growing and analyzing microbial biofilms for Confocal Laser Scanning Microscopy (CLSM).

흐름 세포 녹농균 및 Saccharomyces cerevisiae의의 Biofilm

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological ...

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host&#x2019;s immune status.
As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

A reliable method for the RNA isolation of Pseudomonas aeruginosa recovered from murine cecums is described. The RNA recovered is of sufficient quantity and quality for subsequent qPCR, transcription profiling, and RNA Seq experiments. This technique can be adapted for RNA isolation of other intestinal microbes.

의 RNA 격리 녹농균 Murine 위장관을 Colonizing

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with ...

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

There is growing concern about the relevance of in vitro antimicrobial susceptibility tests when applied to isolates of P. aeruginosa from cystic fibrosis (CF) patients. Existing methods rely on single or a few isolates grown aerobically and planktonically. Predetermined cut-offs are used to define whether the bacteria are sensitive or resistant to any given antibiotic1. However, during chronic lung infections in CF, P. aeruginosa populations exist in biofilms and there is evidence that the environment is largely microaerophilic2. The stark difference in conditions between bacteria in the lung and those during diagnostic testing has called into question the reliability and even relevance of these tests3.
 Artificial sputum medium (ASM) is a culture medium containing the components of CF patient sputum, including amino acids, mucin and free DNA. P. aeruginosa growth in ASM mimics growth during CF infections, with the formation of self-aggregating biofilm structures and population divergence4,5,6. The aim of this study was to develop a microtitre-plate assay to study antimicrobial susceptibility of P. aeruginosa based on growth in ASM, which is applicable to both microaerophilic and aerobic conditions.
 An ASM assay was developed in a microtitre plate format. P. aeruginosa biofilms were allowed to develop for 3 days prior to incubation with antimicrobial agents at different concentrations for 24 hours. After biofilm disruption, cell viability was measured by staining with resazurin. This assay was used to ascertain the sessile cell minimum inhibitory concentration (SMIC) of tobramycin for 15 different P. aeruginosa isolates under aerobic and microaerophilic conditions and SMIC values were compared to those obtained with standard broth growth. Whilst there was some evidence for increased MIC values for isolates grown in ASM when compared to their planktonic counterparts, the biggest differences were found with bacteria tested in microaerophilic conditions, which showed a much increased resistance up to a &gt;128 fold, towards tobramycin in the ASM system when compared to assays carried out in aerobic conditions.
 The lack of association between current susceptibility testing methods and clinical outcome has questioned the validity of current methods3. Several in vitro models have been used previously to study P. aeruginosa biofilms7, 8. However, these methods rely on surface attached biofilms, whereas the ASM biofilms resemble those observed in the CF lung9 . In addition, reduced oxygen concentration in the mucus has been shown to alter the behavior of P. aeruginosa2 and affect antibiotic susceptibility10. Therefore using ASM under microaerophilic conditions may provide a more realistic environment in which to study antimicrobial susceptibility.

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

Current diagnostic antimicrobial susceptibility testing relies on the planktonic growth of isolates in nutrient rich, aerobic conditions. Here, we employ an alternative artificial sputum medium to study antimicrobial susceptibility of Pseudomonas aeruginosa biofilms under both aerobic and microaerophilic conditions more representative of the cystic fibrosis lung.

위반 항생제 효능을 테스트하는 인공 가래 매체의 사용<em&gt; 녹농균</em&gt; 낭성 섬유증의 폐 관련성이 높은 조건에서

There  is growing concern about the relevance of in vitro antimicrobial  susceptibility tests when applied to isolates of P. aeruginosa from  cystic ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

장기 만성<em&gt; 녹농균</em마우스의&gt;기도 감염

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Pseudomonas aeruginosa Induced Lung Injury Model

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. Here we have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa (P. aeruginosa or PA). Using this model, we were able to show lung inflammation at the early phase of injury. In addition, alveolar epithelial barrier leakiness was observed by analyzing bronchoalveolar lavage (BAL); and alveolar cell death was observed by Tunel assay using tissue prepared from injured lungs. At a later phase following injury, we observed cell proliferation required for the repair process. The injury was resolved 7 days from the initiation of P. aeruginosa injection. This model mimics the sequential course of lung inflammation, injury and repair during pneumonia. This clinically relevant animal model is suitable for studying pathology, mechanism of repair, following acute lung injury, and also can be used to test potential therapeutic agents for this disease.

Pseudomonas aeruginosa Induced Lung Injury Model

We have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa. This model mimics lung injury during pneumonia and is clinically relevant.

녹농균 유발 폐 손상 모델

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. ...

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. typhimurium bacteria are quickly detected and phagocytized by macrophages, and contained in vesicles known as phagosomes in order to be degraded. Isolation of S. typhimurium-containing phagosomes have been widely used to study how S. typhimurium infection alters the process of phagosome maturation to prevent bacterial degradation. Classically, the isolation of bacteria-containing phagosomes has been performed by sucrose gradient centrifugation. However, this process is time-consuming, and requires specialized equipment and a certain degree of dexterity. Described here is a simple and quick method for the isolation of S. typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin-streptavidin-conjugated magnetic beads. Phagosomes obtained by this method can be suspended in any buffer of choice, allowing the utilization of isolated phagosomes for a broad range of assays, such as protein, metabolite, and lipid analysis. In summary, this method for the isolation of S. typhimurium-containing phagosomes is specific, efficient, rapid, requires minimum equipment, and is more versatile than the classical method of isolation by sucrose gradient-ultracentrifugation.

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

We describe here a simple and quick method for the isolation of Salmonella typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin and streptavidin.

살 모 넬 라 typhimurium의 절연-대 식 세포에서 Phagosomes를 포함 하

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

주문, 녹 농 균 스트레인 PA14 Transposon 삽입 돌연변이의 비중복 라이브러리의 복제

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

감염의 간단한 마우스 모델에서 녹농균 및 독성 감쇠에 대한 테스트에서 프레임 내 유전자 삭제 돌연변이의 생성

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...