우리는 우수한 기술 지원을 모니카 Tarnowska, 코르넬리아 알브레히트, 그리고 에바 Skoczylas에게 감사의 말씀을 전합니다. 이 연구는 SNF Sinergia 부여 CRSI33-125073 PP에 의해 투자되었다.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

저자는 더 경쟁 이익을 선언하지 않습니다.

디자이너 클레아 제 중심의 게놈 편집 방법은 크게 각각의 게놈 (10, 12)의 목표 수정에 순종하는 종의 범위를 확장했다. 생쥐에서 유전자 표적으로 ES 세포에서 두 년 이상을위한 표준 기술이다; 쥐의 ES 세포의 일부가 최근 성공 하였지만 그러나, 마우스 이외의 종에서 ES 세포에 적응하기 어려운 입증되었다. 심지어 EUCOMM, KOMP, 또는 ZFN 및 TALEN는 높은 정밀도와이 될 수 있습니다 수정의 스펙트럼에 대한 유연성을 제공하여 NorCOMM 3 게놈 편집과 같은 컨소시엄에 의해 제공 &quot;기성&quot;유전자 타겟 마우스 ES 세포 클론의 가용성 마우스 게놈에 도입했다. 클레아 제 - 매개 변이를 들고 설립자 동물은 항상 ES 세포의 배반포 주사에서 발생하는 키메라의 경우에는 해당되지 않습니다 높은 세균 줄 능력 4-6,20,21 될 것으로 보인다. 따라서, DES의 특정 경우의 미세 주입에igner의 클레아는 ​​표적으로 한 게놈 수정을 새로운 마우스 선 훨씬 빠르게 생성 될 수 있습니다. ZFN 및 TALEN의 주사로 녹아웃 마우스의 성공적인 세대는 주입 된 핵산 분해 효소 쌍의 활동에 따라 크게 좌우됩니다. TALENs 유기체의 수의 유전자의 넓은 범위를 대상으로 높은 성공률을 보여왔다; 그러나, 최근의 연구는 TALEN 바인딩 시토신 메틸화 (30, 31)에 민감한 것이 좋습니다. 따라서, 새로 생성 된 핵산 분해 효소 쌍, 예를 들어 TALENs이 pCAG-T7 벡터에 클로닝 등 NIH-3T3 또는 신경과 같은 마우스 세포주에 일시적으로 형질 전환 할 수 있습니다 다소 마우스 배아의 염색질 상태를 모방-2A. 여기서, 뉴 클레아 제 활성은 종래의 mRNA 합성과 마이크로 인젝션에 제 5 절에 설명 된 T7 효소 분석 또는 PCR 생성물의 제한 다이제스트를 사용하여 추정 될 수있다. 우리는 점에서 관심의 게놈 영역의 염기 서열을 추천합니다세포주 및 마이크로 인젝션 실험에 사용 된 마우스 균주를 필자. 마우스의 수정란에서 다른 TALEN 또는 ZFN 쌍은 서로 다른 mRNA의 농도에서 최적으로 작동하기 때문에 미세 주입 핵산 분해 효소의 mRNA의 최적의 작업 농도는 실험적으로 결정해야 할 수 있습니다. 너무 높은이 배아 치사 될 수있는 반면 뉴 클레아 쌍에 따라, 너무 낮은 농도는없는 분열을 초래할 것입니다. 클레아 쌍에 따라, 우리는 2 NG / μL, 200 ㎍ / UL의 높은 최저 총 mRNA의 농도를 사용하여 성공을 거두었습니다. 이러한 효과는 세포 배양 및 배아의 생존과 목표 궤적의 변형 속도가 모두 경험적으로 결정해야합니다에 대한 핵산 분해 효소의 농도 최적의 실험에서 예측하기 어렵다. 고 활성 ZFN 또는 TALEN는 미세 주입 배아의 한 세포 단계를 넘어 자신의 표적 서열을 절단하기 때문에 돌연변이 유발의 복잡한 패턴을 일으킬 수 있습니다설립자의 D 모자이. 우리와 다른 사람 (4)는 하나의 창시자 (그림 5C)에 세 개 이상의 서로 다른 돌연변이 대립 유전자를 관찰했다. 이 시조에서 새로운 마우스 라인을 설정할 때 따라서, 자식은 신중하게 소화 분석은 정의되지 않은 돌연변이가 존재하는 경우에만 있다는 증거를 제공하기 때문에 유리한 돌연변이의 존재에 대한 염기 서열 검사를해야한다. 비판 중 하나는 자주 ZFN 및 TALEN 시스템에 대해 표명이 클레아도 대상 사이트와 유사하다 게놈에 다른 곳에서 현재 시퀀스를 쪼개기의 할 수있는 가능성이있다. 이러한 오프 대상 효과는 homodimeric의 FokI 도메인을 사용하여 초기 세대 시약으로 관찰되었으며, 이종 구조는 오프 대상 효과 25을 완화하도록 설계되었습니다. 잠재적 오프 - 타겟 위치는 (32, 33)에 실리 다소 예측과 PCR 및 시퀀싱에 의해 스크리닝 할 수있다. 분명한 장점 O오히려 F 세포주보다 마우스를 생성하고 ZFNs TALENs를 사용하여 선택 야생형 균주 몇개 backcrosses를 수행하여 원하는 게놈 수식에 링크 해제 대상 돌연변이를 제거 할 가능성이있다. 창시자 마우스의 다수 클레아 타겟 궤적 생성 및 실리코 오프 - 타겟 예측 PCR 제품의 차세대 깊은 시퀀싱 분석 유전자좌는 PCR 생성물의 분해 분석에 대안 정량적 판독을 제공 할 수 있습니다. 이 프로토콜에서 설명하는 보조 생식 기술은 이러한 C57BL/6J 또는 B6D2F1 같은 미세 주입 실험에 사용되는 표준 마우스 종자에 최적화되어 있습니다. 이러한 이계 교배 균주 등 다양한 기원의 마우스는 원칙적으로 게놈 편집 방법에 사용할 수있는 특정 연구 질문에 대한 더 적합한 유전 배경을 제공 할 수 있습니다. 이러한 과배란 같은 보조 생식 기술의 성능은 predi이 될 수 있습니다변종 34-36의 번호를 cted하지만 클레아 미세 주입을위한 배아의 충분한 수를 얻기 위해 비표준 변종에 대한 최적화가 필요할 수 있습니다. ZFN 및 TALEN 게다가, 이러한 RNA 유도 CRISPR/Cas9 시스템 9,37,38 새로운 디자이너 클레아 지금 게놈 편집 응용 프로그램에 도입되었습니다. 미세 주입하고 여기에 설명 설립자 동물의 분석을위한 모든 방법은 CRISPR/Cas9 게놈 편집의 미래 모드에 적용 할 수있다.

마우스는 유전자 변형 동물 모델을 생성하기위한 지금까지 가장 인기있는 플랫폼이다. 마우스 배아 1-3의 유전 공학에 대한 다양한 도구 상자는 최근 아연 핑거 뉴 클레아 제 (ZFN)와 같은 디자이너 클레아 제에 따라 게놈 편집 방법에 의해 4-6, 전사 활성제와 같은 이펙터 클레아 제 (TALEN)를 7,8 확장되었습니다 및 클러스터 정기적으로 interspaced 짧은 회문 반복 (CRISPR) / CRISPR 관련 (CAS) 9 시스템 9. ZFN하고, 각각 FokI 효소 10-12에 결합된다 (각각 징크 핑거 단백질의 배열과 반복 변수를 디 - 잔기 (RVDS))이 맞춤 설계 단백질 기반의 DNA-결합 도메인 쌍으로서 TALEN 기능. 반대로, Cas9 매개 DNA 절단의 특이성은 (또한 하나의 키메라 RNA 분자라고 가이드 RNA에 결합 할 수 있습니다 crRNA 및 tracrRNA) CRISPR RNA를을 transactivating에서 제공하는 복잡 한 행동 (11)CRISPR 단백질. RVDS의 정의 된 순서와 TALENs 빠르게 13-17 선택할 수있는 조립 전략 다수의 개별 실험자에 의해 구성 될 수있다. CRISPR/Cas9 그러나 가이드 RNA-DNA의 특이성은 아직 완전히 18, 19가 해결되지 바인딩, 디자이너 클레아의 더 적은 노동 집약적 인 발전을 약속합니다. 사용자 정의 ZFNs의 생성은 지금까지 전문 대학 실험실과 같은 Sangamo Biosciences에와 시그마 CompoZr 서비스로 상용 공급 업체로 제한하고있다. 일반적으로 디자이너 클레아와 편집 게놈 이후에 합류 동종 끝 (NHEJ) 또는 상동 재조합 (HR) DNA 수리 기계 (10, 12)을 유치 정의 게놈 유전자 좌에서, 이중 가닥 휴식 (DSB)를 소개하는 것을 목표로하고있다. DSB의 NHEJ - 중재 수리는 종종 수리의 사이트에 근접 삽입과 삭제의 도입 발생합니다. 따라서 NHEJ 수리 C는 유전자의 단백질 - 코딩 서열 4,7,9 내에 프레임 쉬프트 돌연변이를 도입함으로써 표적 유전자의 기능을 노크 위해 이용 될 수있다. 대안 적으로, 또는 추가로 정의 된 유전 정보의 보충은 가방 클레아 함께 DNA 공여체를 제공함으로써 달성 될 수있다. DNA 기증자 따라서 HR에 의해 DSB 복구를위한 템플릿으로 봉사 대상 궤적 상 동성 지역으로 측면에 조사 설계 DNA 서열을 포함한다. 플라스미드 5,6,20 및 단일 가닥 올리고 뉴클레오타이드 8,9,21 모두 성공적으로 기증자로 사용되었습니다. NHEJ-또는 이용 HR-매개 게놈 편집 둘다 전체적인 유전자 구조를 방해하지 않고, 염기 배열에서의 작은 변화를 생성하기위한 이러한 전략이 특히 적합하게 마우스 배아의 게놈에 선별 마커의 도입을 필요로한다. 이 프로토콜에서 우리의 게놈 편집을위한 모든 필수 절차에 대해 설명합니다TALENs를 사용하여 마우스 배아. 이들은 TALEN 대상 사이트 22의 1) 식별을 포함, 골든 게이트 복제 (13)에 의해 TALENs 2) 건설, TALEN의 mRNA, 수정 된 마우스 난자, 배아 전송을 위해 5) 수술 절차에 TALEN의 mRNA 4) 미세 주입 3) 체외 합성 , 6) 설립자 동물 TALEN 유발 돌연변이의 분석. 우리는 TALEN mRNA의 미세 주입 및 NHEJ에 의한 삽입 / 삭제에 설립자의 심사에 초점을 맞 춥니 다. 이 목적을 위해 우리는 플라스미드로 마우스 배아에 미세 주입을위한 TALEN의 mRNA의 생체 합성에 형질 때 포유 동물 세포 모두에서 발현을 허용 관능 TALEN 구조를 생성 한. 이러한 구조는 이종이 FokI 융합 잘린 이야기 백본 (23)는 포유 동물 세포에서 최적의 게놈 편집 (24, 25)를 도메인을 포함한다. 이 프로토콜은 다른 디자이너 클레아의 미세 주입 또는 디자이너 클레아의 결합 주사를 채택 할 수있다기증자 구조 (DNA 기증자의 디자인 Wefers 등. (26, 27)에 의해 우수한 기술 문서에 기술되어있다). 윤리 정책 모든 동물 실험은 광저우 취리히 주립 동물 병원의 지침과 규정에 따라 수행되었다.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

사이트 별 게놈 수정 (녹아웃, 노크에있는)를 운반하는 형질 전환 마우스는 복잡한 생물학적 시스템을 해부뿐만 아니라 인간의 질병을 모델링 및 치료 전략을 테스트하기 위해 매우 중요합니다. 아연 핑거 뉴 클레아 제 (ZFNs), 전사 활성제와 같은 이펙터 클레아 제 (TALENs) 및 클러스터 정기적으로 interspaced 짧은 회문 반복 (CRISPR) / 대한 CRISPR 관련 (CAS) 9 시스템 사이트로 디자이너 클레아의 사용에서 최근의 진보 특정 게놈 공학은 배아 줄기 (ES) 세포 기술에 의존 할 필요없이 거의 모든 실험 종 급속한 표적 유전자 변형을 수행 할 수있는 가능성을 연다. 게놈 편집 실험은 일반적으로 조사 정의 게놈 현장에 핵산 분해 효소의 활동을 직접 지정 DNA 결합 도메인의 구성에 따라 관심의 유전자 내에서 디자이너 클레아 대상 사이트의 식별로 시작합니다. 가방 클레아 플라스미드 체외에 &lt;/ EM&gt; 수정 된 마우스 난자의 미세 주입에의 mRNA를 생성하는 전사. 여기, 우리는 수정 된 마우스의 난자에 TALEN mRNA를 직접 분사 대상이 게놈 수정을 달성하기위한 프로토콜을 제공합니다.

우리는 포유 동물 세포에서 TALENs의 표현뿐만 아니라 T7 파지 프로모터 (그림 1C)에서 체외 mRNA의 합성을 허용 Cermak 등. (13)에 의해 발표 된 골든 GateTALEN 어셈블리와 호환 대상 플라스미드를 건설했다. 이 플라스미드 FokI 동종이 량체에 대해 오프 대상 영향을 줄이기 위해 FokI는 25,29를 이종 첫 번째 세대에 비해 분열 활동을 강화하는 것으로 나타났다 이종이 FokI 도메인 (ELD 또는 KKR 돌연변이)를 수행한다. 골든 게이트 조립 반응 # 1과 # 2는 일반적으로 매우 효율적이며, 모든 흰색 식민지, 식민지 PCR로 분석 할 때, 복제 RVDS (그림 1B와 1D)의 특정 번호에 대한 예상 패턴을 보여줍니다. 체외 합성의 mRNA의 젤 분석 (그림 2) 분석의 모든 샘플에 대한 거의 또는 전혀 얼룩으로 하나의 구별 밴드를 공개한다. 성공적인 폴리아 데 닐화를 나타내는 샘플 L1/R1 및 L2/R2, L3/R3, 사이에 명확한 크기의 변화가 있어야합니다. 설립자 동물은 효소를 사용하여 하나 T7 엔도 뉴 클레아 제 소화에 이어 유전자형 PCR (도 3) 또는 제한 다이제스트를 사용 NHEJ 유도 돌연변이 대립 유전자에 대해 스크리닝 할 수 클레아 쌍의 스페이서 영역 내의 클리브 야생형 서열 (도 4)이. T7 엔도 뉴 클레아 제 분석은 상관없이 주입 클레아 쌍의 스페이서 영역 내의 특정 게놈 서열의 돌연변이 모든 종류에 적용될 수있다; 그러나 heteroduplex PCR 제품에서 DNA 가닥 사이에만 불일치를 검출한다. 따라서, 설립자가 동일한 두 변이 대립 유전자를 운반하는 드문 경우에, PCR 제품은 T7 소화 패턴을 보여주지 않을 것입니다. 특정 제한 부위가 NHEJ 의해 제거 될 클레아 스페이서 영역 내에 위치 할 때 그러한 구별은 항상 그러나 가능삽입 / 삭제 (그림 5) 유도. 여기에, 소화되지 않은 밴드는 돌연변이의 존재를 표시하고 모든 소화 제품의 부재는 강하게 (그림 (b)에 별표로 표시) 대상 유전자의 두 대립 유전자의 돌연변이를 운반하는 창업자을 제안합니다. <img alt="그림 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> 그림 1. pFUS 벡터에 RVD 배열의 이종이 pCAG-T7-대상 벡터에 TALEN RVDS의 골든 게이트 복제.) 조립. 다음 예는 각각의 이야기 배열은 각각 15 RVDS 17 RVDS를 포함와 TALEN 쌍에 대해 표시됩니다 (이상 21 RVDS보다 이야기 배열에 세 pFUS-RVDS 어셈블리가 표시되지 요구된다). 화살표는 pFUS 특정 식민지 PCR 반응. B) PCR 제품에 대한 프라이머를 나타냅니다올바른 pFUS의 어셈블리에서 증폭 일반적으로) 밴드가 복제 된 모든 RVDS (10 RVDS 용 등 약 1.1 KB) 및 적법 RVD 배열의 반복 특성으로 작은 덜 눈에 띄는 밴드의 &quot;사다리&quot;. C의 결합 길이에 대응 보여 최종 조립 pFUS-RVD 배열과 각각 FokIELD 및 FokIKKR 변형과 이종이 TALEN 발현 벡터에 마지막 반복 (PLR)를 포함하는 플라스미드. (N과 C로 주석) TALEN 백본 T7 파지 프로모터에 허용하는 동안 CAG (CMV 초기 증강 요소 / 닭 베타 - 액틴) 프로모터가 형질 전환 된 포유류 세포에서 높은 발현 수준을 보장 밀러 등. (23)에 의해 발표 된 아키텍처와 유사 체외 mRNA의 합성 (클레아 제 STOP 코돈의 하류 벡터의 선형화를위한 SacI에 사용). D) C에서 화살표로 표시된 프라이머를 이용하여 콜로니 PCR)가 제대로 조립 TALENs을 식별 할 수 있습니다. 전체 lengt에&quot;사다리 효과&quot;성공적으로 어셈블리의 강력한 지표를 나타낸다 H PCR 제품은 종종 덜 눈에 띄는입니다. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오</a> . <img alt="그림 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> 그림 2. . 아가로 오스 겔 전기 영동을 사용하여 시험 관내 합성 핵산 분해 효소의 mRNA의 품질 관리가 ZFN의의 mRNA는 예로 표시됩니다 (L, ZFN을 왼쪽, R, 우측 ZFN). 샘플 전에 폴리아 데 닐화에 mRNA를 보여 L1/R1, mRNA와 L3/R3 폴리아 데 닐화 샘플 L2/R2 쇼 정제 폴리아 데 닐화의 mRNA를 보여줍니다. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오</a> . <img<html> 콘텐츠 폭 FO = &quot;6 인치&quot;: SRC = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot;SRC = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot;폭 = &quot;600&quot;FO 고도는 = &quot;그림 3&quot; /&gt; 그림 3. 대상 현장의 핵산 분해 효소에 의한 돌연변이를 들고 설립자 동물의 식별에 사용 T7 효소 분석의 예. A) TALEN 쌍이 마우스 프리온 단백질 유전자 (PRNP의 코딩 영역 내에서 절단하도록 설계되었다 TALEN 표적 서열)은 요청에 따라 제공 될 수있다. PCR 생성물을 PCR 생성물이 연속적으로 형성 및 T7 엔도 뉴 클레아 제 소화를 heteroduplex 행 하였다 상류 110 BP 위치한 정방향 프라이머 (F) 및 역방향 프라이머 (R) TALEN 절단 부위. B의 하류 250 BP)를 이용하여 생성된다. C) 하나의 설립자의 대상으로 게놈 영역 내에서 TALEN에 의한 돌연변이 유발은 소화 (250)의 제품 및 110 bps의 전체 길이 PCR 제품의 존재에 의해 드러났습니다.50930/50930fig3highres.jpg &quot;대상 =&quot;_blank &quot;&gt; 큰 이미지를 보려면 여기를 클릭하십시오. <img alt="그림 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> 그림 4. 대상 현장의 핵산 분해 효소에 의한 돌연변이 마우스 Rosa26 궤적 29 대상 인트론 (1)의 내부를 XbaI 제한 사이트. ZFN의 특정을 들고 설립자 동물의 식별에 사용되는 PCR 제품의 제한 다이제스트의 예.) 설립자는 사용하여 PCR 유전형에 의해 상영되었다 앞으로 프라이머 (F)는 500 상류 BP와 역방향 프라이머 (R) 절단 부위. B의 하류 250 BP)를 XbaI과 PCR 제품의 소화가 별표로 표시 양방향 대립 유전자 돌연변이 생쥐 ()를 나타내는 소화 패턴을 보여, 모노 위치 - 대립 유전자의 돌연변이 (소화 소화되지 않은 밴드, 예를 들어 동물 2)잠재적 인 양 대립 유전자 변형 생쥐의 중량 및 마우스 (완전 소화, 예를 들어 동물 21). C) 연속 3 (동물 24) 별개의 삽입 / 삭제에 나타납니다. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오</a> . <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 프라이머의 이름 </td><td> &#39;3&#39;시퀀스 5 </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> 표 1. 골든 게이트 TALEN 어셈블리 내에서 식민지의 PCR 및 시퀀싱에 사용되는 프라이머 시퀀스프로토콜입니다. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 플라스미드 / 컬렉션 </td><td> 기부자 </td><td> Addgene ID </td><td> 댓글 </td></tr><tr><td> 골든 게이트 TALEN 및 TAL 이펙터 키트 2.0 </td><td> Voytas 실험실 </td><td> 1000000024 </td><td> 골든 게이트 TALEN의 조립에 필요한 모든 플라스미드를 포함 </td></tr><tr><td> pCAG-T7-TALEN -KKR/ELD 대상 벡터 </td><td> Pelczar 실험실 </td><td> 40131, 40132 </td><td> 부가 기능에 대한 포유 동물 세포의 체외 mRNA의 합성 TALEN 식에 대한 플라스미드 </td></tr></tbody></table> 표 2. 골든 게이트 TALEN 조립에 필요한 플라스미드 플라스미드 컬렉션 Addgene (에서 얻을 수 있습니다 <a href="http://www.addgene.org">www.addgene.org</a> ). <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 온라인으로자원 </td><td> 댓글 </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> TALEN의 디자인; TALEN 오프 대상 예측 </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> TALEN, OPEN ZFN, 코다 ZFN, CRISPR/Cas9의 디자인 </td></tr><tr><td> http://www.genome-engineering.org </td><td> TALEN, CRISPR/Cas9의 디자인; CRISPR/Cas9 오프 대상 예측 </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> TALEN의 조립 순서의 결과를 확인하는 시퀀스 </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> 모듈 조립 ZFN 설계 </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> 모듈 조립 ZFN 설계 </td></tr></tbody></table> 표 3. ZFN, TALEN 및 CRISPR/Cas9 설계를위한 온라인 리소스. </strong&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

아연 핑거 뉴 클레아 제 (ZFNs) 및 전사 활성제와 같은 이펙터 클레아 제 (TALENs)와 같은 디자이너 클레아는 ​​동종 최종 합류 (NHEJ)과 상동 재조합 (HR) 경로 모두를 트리거하여 마우스의 착상 전 배아의 게놈을 수정하는 데 사용할 수 있습니다. 이러한 진보는 정확한 유전자 변형 생쥐의 신속한 생성을 가능하게한다.

디자이너 클레아 제를 사용하여 마우스 게놈 엔지니어링

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.5K 조회수.  University of Zurich.  아연 핑거 뉴 클레아 제 (ZFNs) 및 전사 활성제와 같은 이펙터 클레아 제 (TALENs)와 같은 디자이너 클레아는 ​​동종 최종 합류 (NHEJ)과 상동 재조합 (HR) 경로 모두를 트리거하여 마우스의 착상 전 배아의 게놈을 수정하는 데 사용할 수 있습니다. 이러한 진보는 정확한 유전자 변형 생쥐의 신속한 생성을 가능하게한다. 