이 프로토콜에 설명 된 작품은 재생 의료에 대한 캘리포니아 연구소 (CIRM)와 공동 제휴의 일환으로 빅토리아 정부에서 자금을 지원에 의해 가능하게되었다.

모든 과정은 무균 층류 후드에서 수행된다. 달리 지정하지 않는 한 모든 미디어 및 솔루션은 37 ° C 평형을하고 있습니다. 형질에 대한 (이 프로토콜에 사용되는 인간 배아 줄기 및 hiPSCs, WA-09) 인간의 PSC를 1. 확장 참고 : 마트 리겔 또는 Geltrex에 인간 배아 줄기을 확장 할 필요가 없습니다. 마우스 배아 섬유 아 세포 (MEFs)에 확장 된 인간 배아 줄기는 MEF 제거 단계 다음 일렉트로 또는 nucleofection 사용할 수 있습니다 (2.8 절 참조). <ol><li> 1 × 100mm 요리와 MEF 미디어 cm 2 당 2.0 × 10 4 세포에서 DR4 MEFs의 1 개 75cm2 플라스크를 준비 / V 젤라틴 w 0.1 %로 사전 코팅 요리에 (표 1 참조). 주 : CF1, BLK6 또는 MF1 MEFs를 사용할 수있다, 그러나, 예를 들면, DR410, 항생제 내성 MEF 라인을 사용하는 것이 권장된다. </li><li> 다음날, 100mm 접시 위에 통로 인간 배아 줄기 섹션 1.1에서 준비 MEFs가 미리 도금. 이 ASPI을 수행하려면문화 요리에 환율이 hESC의 미디어,의 Ca2 + /의 Mg2 + - 무료 행크스 &#39;균형 염 용액 (HBSS)와 인간 배아 줄기를 씻어, 37 ° C / 5 % CO 2에서 가습 배양기에서 디스 파제 (해당 볼륨에 대한 표 2 참조)과 장소를 추가 할 수 있습니다. MEFs를 제거하는 HBSS로 2 회 - 3 ~ 5 분 배양 후, 부드럽게 흡인 디스 파제와 한을 씻는다. 부드럽게 배양 접시의 표면에서 식민지를 다쳤고, hESC의 미디어 (표 3 참조) 셀 스크레이퍼를 사용하여, 5 ml의 피펫을 추가합니다. </li><li> 15 ㎖의 원심 분리 관에 배양 접시에서 서스펜션의 식민지 조각을 수집합니다. hESC의 미디어와 15 ML 튜브로 전송 헹구고 배양 접시. 단일 세포 또는 작은 조각으로 대단히 짧은 시간을 휴식하지 않도록주의하십시오. </li><li> 식민지 조각을 펠렛 160 XG에서 5 분 동안 원심 분리기. </li><li> 기음 뜨는. 식민지 조각 펠릿을 풀어 손가락으로 15 ML 튜브의 바닥을 누릅니다. 분할 비율에 따라 hESC의 미디어에 부드럽게 재현 탁 식민지 조각 (normall4 일 : 8 적합한) 나중에 일 사이에 비율을 분할합니다. 효율성을 replating 영향을 미칠 것이 아니라 단일 세포 또는 작은 조각으로 대단히 짧은 렌더링하지 않도록 각별히주의해야합니다. </li><li> MEFs가 HBSS로 1 배 세척에 hESC의 조각을 replating 이전. 천천히 요리 MEFs가 사전에 도금 hESC의 매체에 hESC의 단편을 함유하는 세포 현탁액의 적당량 (표 2 참조) 추가한다. </li><li> 인큐베이터에있는 선반에 배양 접시를 놓고 고르게 식민지 조각을 배포 좌우로 앞뒤로 및 측면 천천히 이동합니다. </li><li> 매일 hESC의 미디어를 교체합니다. </li><li> MEFs (MEF-CM)에서 에어컨 미디어를 준비하기 위해 씻어 75cm 2 플라스크 MEFs HBSS로 1 개에 사전 도금. hESC의 미디어를 추가합니다. 24 시간을 따라 미디어를 조절하고 신선한 hESC의 미디어로 교체 수집합니다. 십이일 최대 매일 반복합니다. 필요할 때까지 4 ° C에서 MEF-CM을 저장합니다. </li></ol> 형질에 대한 인간의 ESCS의 2 준비 <ol><li> 인간 배아 줄기의 성장을 관찰매일 현미경. 식민지 40~50% 합류, 판 cm 2 당 2.0 × 10 5 MEFs와 3 × 100mm 요리 될 때. </li><li> 식민지가 60이 될 때 - 70 %의 합류 그들은 형질 전환 할 준비가 된 것입니다. 차별화 된 식민지 또는 식민지 코어를 제거하여 &#39;신랑&#39;식민지. 참고 : 우리는 높은 형질을 믿고 세포가 로그 위상 성장에있을 때 목표로 효율성이 발생, 그것은 인간 배아 줄기는 ≥ 70 % 포화 상태에 도달하기 전에 일렉트로이 실시하는 것이 좋습니다. </li><li> HBSS와 hESC의 식민지를 씻고 Accutase를 추가합니다. 참고 : ROCK 억제제에 미리 치료 인간 배아 줄기 필요가 없습니다 Y-27632 단계 2.7시 Y-27632와 함께 배양 할 때 충분한 억제가 발생합니다 </li><li> 37 ° C / 5 현미경으로 볼 때 식민지 단일 셀을 렌더링 할 때까지 %의 CO 2시 20 분 - 10 알을 품다. 1 ML의 피펫 씹다 세포. </li><li> 40 μm의 셀 straine를 사용하여 15 ML 원뿔 튜브에 hESC의 미디어와 필터를 추가세포 덩어리를 제거하려면 r. </li><li> 5 분 동안 160 XG에 원심 분리기. 신선한 hESC의 미디어에 재현 탁 세포 펠렛 및 잔여 Accutase 솔루션을 제거하는 반복합니다. </li><li> 10 μM Y-27632 및 100mm 접시에 총 세포 현탁액을 전송이 젤라틴으로 코팅 된 사전이 포함 hESC의 미디어에 재현 탁 세포. </li><li> 30 분의 최소 37 ° C / 5 % CO 2에서 품어. </li><li> 이 시간 동안 MEFs는 젤라틴 코팅 접시에 부착됩니다. 신선한 15 ML의 원심 분리기 튜브에 1 ㎖의 피펫을 사용하여 비 부착 인간 배아 줄기를 수집하고 혈구를 사용하여 셀 밀도를 결정한다. </li></ol> 인간 배아 줄기의 3 일렉트로 <ol><li> 0.22 μm의 필터 및 추가 10 NG / ml의 재조합 인간 섬유 아세포 성장 인자 2 (rhFGF2)를 사용하여 필터 CM-MEF 매체. </li><li> 5 분 동안 160 XG에서 새로운 15 ML 원뿔 튜브와 원심 분리기 섹션 2.9에서 7.5 × 106 인간 배아 줄기을 전송합니다. </li><li> 지수 전자 업계를위한 선택 프로그램 : electroporator를 설정이 시간 동안250 V, 용량 : ctroporation는 다음과 같은 매개 변수, 전압 설정 500 μF, 그리고 저항 : ∞-. </li><li> 뜨는을 기음과 얼음처럼 차가운 0.22 μm의 여과 HBSS의 0.8 ml의 세포 펠렛을 다시 일시 중지합니다. 멸균 0.4 cm의 일렉트로 큐벳에 솔루션을 전송합니다. </li><li> TV-hPITX3 앞으로 타겟팅 구조 (30 μg DNA)를 추가하고 200 μL 피펫으로 가볍게 섞는다. 5 분 동안 얼음 위에서 배양한다. 이 시간 동안 PITX3 ZFN의 mRNA 한 나누어지는 제거하고 얼음에 해동. 전기 천공 큐벳에 DNA / 세포 혼합물에 전송에게 ZFN의 mRNA의 7.5 μl를 해동합니다. 200 μL 피펫으로 가볍게 섞는다. 주 : 타겟팅되는 궤적은 효율에 기여 타겟팅 주요 요인이다. 이러한 PITX3 같은 유전자 침묵, ESCS 표현하지 유전자가 어려운 궤적 인코딩은 종래의 상 동성 재조합 (6)을 대상으로하여. 따라서,이 프로토콜은 사용자 DNA 이중 가닥을 유도하기 위해 B 인간 PITX3 궤적 위해 활용한다 ZFNs 설계reak. </li><li> electroporator의 화면 지침에 따라 Electroporate. </li><li> 200 μL 피펫 10ml로 hESC의 매체를 함유하는 15 ㎖의 튜브에 전기 천공 큐벳에서 컨텐츠를 전송할 사용. hESC의 매체의 200 ㎕의 15 ML 튜브 각 시간과 전송 두 번 큐벳을 씻으십시오. 가있을 것 &quot;점액 같은&quot;파편에 부정적인 세포 생존에 영향을 미칠 용해 세포에서 DNA와 단백질로 구성. 이 파편을 제거하기 위해 5 분 동안 160 XG에 원심 분리기. </li><li> 뜨는을 대기음 부드럽게 풀어 세포 펠렛을 누릅니다. 10 μM Y-27632을 포함 MEF-CM 보충 30 ㎖에 다시 일시 중지하고 MEFs와 예비 도금 3 × 100mm 요리에 replate. </li><li> 매일 미디어를 변경합니다. 2 일에, Y-27632는 회수 될 수 있고 세포는 hESC의 미디어 만 재배. </li><li> 2-3일 후 인간 배아 줄기는 50-70% 합류해야한다. 이 시점에서 항생제 선택 (예를 들어, 0.5 μg / ㎖의 퓨로 마이신)를 시작합니다. </li><li> 셀프 유지매일 신선한 hESC의 / 퓨로 마이신 미디어를 추가하여 ection. ~ 칠일 후에 작은 콜로니를 볼 수 있어야합니다. 항생제 내성 MEFs를 사용하지 않는 경우는 MEFs cm 당 2 부가 1.0 × 104 세포를 첨가하여 보충 할 수있다. </li></ol> 4 따기 형질 전환 hESC의 클론 <ol><li> 약 14 - (식민지 ~ 1mm 직경에 도달 한) 선택 다음 21 일 확장과 심사에 대 한 번호판을 준비합니다. 5 시간의 최소 4 ° C에서 마트 리젤 또는 Geltrex의 분취 량을 해동하여 시작합니다. 제조업체의 지침에 따라 희석하고 3 × 96 - 웰 플레이트의 각 웰에 75 μl를 추가합니다. cm 2 당 2.0 × 10 4 세포에 MEFs을 도금 3 × 48 - 웰 플레이트를 준비합니다. 37 ° C / 5 % CO 2에서 두 판 O / N을 품어. </li><li> 다음날 격자를 절단하여 2 ml의 피펫의 끝에서 21 G 바늘을 사용하여 16-25 개로 콜로니 해부. </li><li> 기음 96 - 웰 플레이트에서 마트 리젤과 supplem로 교체ented CM-MEF 미디어. 48 - 웰 플레이트 한 HBSS와 x와 hESC의 미디어를 추가 씻으 MEFs. </li><li> 200 μL 피펫을 사용하여 부드럽게 확장을 위해 48 웰 플레이트에 해부 식민지의 3 분의 전송할 수 있습니다. 보충 CM-MEF 매체를 함유 대응 96 웰 플레이트로 해부 콜로니의 다른 2/3 옮긴다. </li><li> 매일 미디어를 변경하여 두 판을 유지 (MEFs를 포함하는 48 웰 플레이트에 96 웰 마트 리겔 코팅 플레이트와 hESC의 미디어를 CM-MEF 매체를 보완, 모두 0.5 μg / ml의 퓨로 마이신으로 보충). </li><li> 96 - 웰 플레이트가 100 % 합류 된 후 초기 PCR을 통해 화면까지 확대. </li></ol> (5) 검사 및 긍정적 인 클론의 확장 <ol><li> 게놈 DNA (11에 따라 방법을) 준비 반전 판에서 모든 미디어를 제거하려면 다음 종이 타월에시킨다. </li><li> RT PBS (100 μL / 웰 각 세척), 단계 5.1로 반전하고 오와 각 웰에 두 번 씻어. -80 ° C의 F에서 장소 판또는 1-2 시간이 세포 용해에 도움 (플레이트는 다음과 같이 무한정에 저장 될 수 있습니다.) </li><li> 세포가 Sarcosyl 용해 버퍼를 만들 C -80 °에있는 동안 (표 4 참조) (50 μL / 웰). 각 웰에 5 다음 실온에서 분 피펫 용해 버퍼 세포, 따뜻한 판을 용해합니다. 습도를 만들 촉촉한 종이 타월을 포함하는 밀봉 용기에 테이프, 장소, 각 판의 가장자리를 밀봉하고, 60 ° C에서 O / N을 배양한다. </li><li> 배양 후, -20 ° C 무수 에탄올 10 ㎖에 500의 NaCl 150 μl를 추가 잘 혼합하고, 각 웰에 100 μl를 추가 (참고 : NaCl을 추가 할 때 에탄올 흐린 갈 것입니다). 탭 판 부드럽게 믹스 (안 피펫을) 및 RT에서 30 분의 최소 떠나. 이 시간 동안 용액은 맑은 꺼지고 DNA가 침전된다. </li><li> 다음 각 웰에 70 % 에탄올 150 μl를 추가 단계 5.1에서와 같이 솔루션을 제거합니다. 부드럽게 접시 전환 및 이전시킨다. 이 단계 더 배를 반복합니다. 참고 : 때문에 침전 된 DNA 자연스럽게 adhE 유전자조직 배양 플라스틱에 입술은 이러한 세척 단계 동안에서 이탈하지 않습니다.) </li><li> 최종 세척 후 최고 속도로 간단히 원심 분리 판은 적어도 30 분 동안 실온에서 각 웰 후 자연 건조의 하단 (또는 37 ° C)에 DNA를 집중합니다. </li><li> 40 추가 - 50 μL의 T0.1E (pH8.0)을 1 시간 동안 65 ° C에서 각 웰과 장소 플레이트 또는 TE (pH8.0) (표 5 참조) 또는 4 ° CO / N PCR을 위해 사용하기 전에. 부드럽게 플레이트의 측면을 활용하여 DNA를 재현 탁. 다시 중단 DNA / 10 ㎕의 PCR 반응의 1-2 μl를 사용합니다. </li><li> 이 hPITX3의 L 팔 세대와 긴 템플릿 PCR 시스템을 확장 사용. F 및 hPITX3의 L 팔 GFP의 R 프라이머는 58 ° C에서 어닐링, 45 초 연장, 35 사이클에서 클론의 초기 검사를 수행합니다. </li><li> 1 % 아가 로스 젤 Hyperladder의 1킬로바이트와 Electrophorese 샘플은 45 분 동안 100 V에서 GelRed 및 UV 조명을 통해 긍정적 인 클론을 감지 함유. </li><li> expa에서 게놈 DNA를 소화하여 PCR 긍정적 인 클론의 유효성을 검사남부 오 점에 벡터 동성 팔을 HindIII 및 혼성화 프로브 5 &#39;와 3&#39;와 nded 클론 (아래 참조) (이전에 하나의 설명 참조). 프로브는 프라이머 쌍 hPITX3 5 &#39;프로브 F와 R, 및 hPITX3 3&#39;프로브 F와 R,를 EcoRI으로 절단하며, 일반적인 클로닝 벡터에 라이 게이션을 사용하여 PCR에 의해 생성됩니다. </li><li> 양성 클론의 수에 따라, MEFs (2 cm 당 2.0 × 104 세포)와 전도금하여 6 - 웰 플레이트의 웰 (2)을 준비한다. </li><li> 그 다음날은 1 시간의 최소 10 μM Y-27632와 함께 48 웰 플레이트에 긍정적 인 클론을 전처리. </li><li> HBSS에 긍정적 인 클론을 씻고 Accutase의 300 μl를 추가합니다. </li><li> 식민지 단일 셀을 렌더링 할 때, hESC의 미디어 1 ㎖를 추가하고 15 ML 튜브에 수집합니다. </li><li> 매일 미디어를 변경합니다. 일이에, Y-27632 철회 할 수 있으며, 세포는 hESC의 미디어에서 성장. </li><li> 80 % 합류, 계대하고 깔깔 나머지 동결 - 콜로니 70되면뉴욕 조각. </li></ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

저자가 공개하는 게 없다.

리포터 세포주의 생성은, 추적 시각화하고 인간 배아 줄기 유래의 이종 집단으로부터 관심 세포를 분리하기위한 강력한 수단을 제공한다. 그러나, 기존의 상동 재조합을 통해 표적 유전자는 인간의 ESCS 3 매우 비효율적 인 것으로 입증되었습니다. 이 프로토콜에서는 ZFNs 함께 널리 타겟팅 벡터를 이용하여 인간 배아 줄기에서 엑손 PITX3 궤적 중 하나에 RP를 도입하는 비교적 간단한 ?...

현재 배아 줄기 세포 (ESC) 분화 프로토콜은 특히 특정 신경 표현형의 유도와 관련하여, 이종 세포 집단에서 발생. 배양이 원하는 세포 표현형, 다른 신경 세포가 포함되지만 이에 따라, 비 - 신경 세포와 분화되지 않은 세포 유형은 종종 하나 존재한다. 이러한 특성은 ESC의 적용 세포 대체 요법에 사용하기위한 시험 관내 및 질병 모델링 셀 소스를 유도 제한한다. 유전자 리포터 세포주 시각화 추적 관심 셀을 분리하는 수단을 제공하는, 리포터 단백질 (RP)의 발현은 내인성 발현을 재현 한한다. 유전자 코딩 영역의 바로 상류 프로모터의 사용은 유전자 조 기자를 유도하는 데 사용될 수 있지만, 이러한 구조는 내인성 유전자 발현을 제어하는​​ 조절 요소 정확한 부족하다. 대조적으로, 상 동성 재조합이 구비기회는 RP의 고품질 표현을 보장합니다. 과거에, 관심있는 특정 유전자좌에 상 동성 재조합을 위해 설계된 벡터를 표적으로하는 DNA 1,2 전달하는 수단으로 전기 천공을 사용하여 마우스 ESCS (mESCs)에서의 RP를 대상으로 사용되어왔다. 그러나 종래의 상 동성 재조합을 통해 리포터 세포주의 생성 인간 ESCS (인간 배아 줄기) 매우 비효율적이다, 따라서 전용 (3에서 검토)의 경우 소수의 문서화되었다. 징크 핑거 뉴 클레아 제 (ZFNs)로 통칭 사이트 특정 징크 핑거 모티프와 FOK I 클레아의 융합을 포함하는 엔지니어링 키메라 단백질을 사용하여 DNA 이중 가닥 나누기 소정 게놈 유전자좌에 도입 될 수있다. DNA 이중 가닥 브레이크 양측 상 동성을 가진 DNA 벡터가 추가 될 때, 사이트는 게놈 DNA 공여체 서열의 혼입을 허용, 상동 재조합에 의해 복구 될 수있다. 이 기술은 유용 F를 증명했다인간 일차 전지 4,5와 인간 배아 줄기 6,7 모두에서 게놈 편집. 보다 최근의 작업들이 이용했다 전사 활성제와 같은 이펙터 클레아 (TALENs), 공장에서 사용 전사 인자는 부위 - 특이 적 뉴 클레아 제 (9)의 설계에 도움 8 병원체. 다음의 프로토콜에서는 인간 뇌하수체 메오 3 (PITX3)에 대한 궤적 ZFNs 함께 상동 타겟팅 벡터 (6)를 함유 EGFP의 일렉트로 hESC의 리포터 세포주의 생성을 보여준다. 2~3주에 대한 항생제의 선택에 따라, 제대로 통합 된 DNA를 가진 인간 배아 줄기 수동으로 집어 확장 및 PCR을 통해 처음 상영하고,이어서 남부 블로 팅에 의해 검증 될 수있다.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

현재 인간 배아 줄기 세포 (ESC) 분화 프로토콜을 하나의 주요 제한은 이종 세포 집단의 생성이다. 이러한 배양 관심의 세포를 포함 할뿐만 아니라 미분화 ESCS 비 신경 유도체 및 다른 신경 세포 아형로 오염된다. 이것은 시험 관내에서 이러한 약물 발견 또는 세포 대체 요법에 대한 시험 관내 모델로서 생체 애플리케이션에서의 사용을 제한한다. 이것을 극복하기 위해, 시각화 트랙과 관심 셀을 분리하는 수단을 제공 리포터 세포주는 설계 될 수있다. 종래의 상 동성 재조합은 매우 비효율적이다 통해 그러나, 인간 배아 줄기 세포에 이것을 달성한다. 이 프로토콜과 함께 뇌하수체의 호 메오 박스 (homeobox) 인간 배아 줄기 세포에서 삼 (PITX3) 궤적 사이트 별 이중 가닥 DNA 나누기를 소개 맞춤 설계된 아연 핑거 뉴 클레아 제를 사용하는 대상에 대해 설명PITX3 - EGFP - 특정 DNA 기증자 벡터입니다. PITX3 리포터 세포주의 발생에 이어, 그 다음 그러한 체외 파킨슨 병 모델링 또는 세포 대체 요법으로 연구에 사용하기 위해 발행 프로토콜을 사용하여 구별 될 수있다.

PITX3와 함께 사용자 정의 설계 PITX3 아연 손가락 쌍의 공동 일렉트로에 따라 - EGFP - 특정 DNA 기증자 벡터, 이후 퓨로 마이신 선택, 양 hESC의 클론은 처음 게놈 PCR 검사 (그림 1)를 통해 검출되었다. 이러한 PCR 5 긍정적 인 클론 &#39;및 3&#39;특정 프로브의 남부 오 하이브리드는 19 %의 효율로, PITX3 궤적 (그림 2)의 한 엑손하는 정확한 타겟팅을 확인했다...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

리포터 세포주 시각화 추적 이종 집단의 관심의 세포를 분리 할 수​​있는 수단을 제공한다. 그러나, 유전자 - 표적 인간 배아 줄기 세포에서 종래의 상동 재조합을 사용하여 매우 비효율적이다. 여기서, 우리는 아연 핑거 클레아 향상된 상동 재조합을 사용하여 EGFP CNS 중뇌 특정 전사 인자 PITX3 궤적 타겟팅 기술한다.

인간 배아 줄기 세포에 표적으로 아연 손가락 핵산 분해 효소 향상된 유전자

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.7K 조회수.  Monash University.  리포터 세포주 시각화 추적 이종 집단의 관심의 세포를 분리 할 수​​있는 수단을 제공한다. 그러나, 유전자 - 표적 인간 배아 줄기 세포에서 종래의 상동 재조합을 사용하여 매우 비효율적이다. 여기서, 우리는 아연 핑거 클레아 향상된 상동 재조합을 사용하여 EGFP CNS 중뇌 특정 전사 인자 PITX3 궤적 타겟팅 기술한다. 

비디오: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

인간의 배아 줄기 (ES) 세포의 전파

연구

생물학

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Immunosurgery에 의해 인간 배아 줄기 세포의 유도

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

인간 배아 줄기 세포에서 Mitochondrial 복잡한 활동에 대한 탐색

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

체외에서 인간 배아 줄기 세포의 생체내의 Bioluminescence 리포터 진 영상에

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

인간 배아 줄기 세포에서 염색질의 Immunoprecipitation

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of the predominant imaging modalities to assess the restoration of the injured myocardium. Furthermore, ex-vivo labeling agents, such as iron-oxide nanoparticles, have been employed to track and localize the transplanted stem cells. However, this method does not monitor a fundamental cellular biology property regarding the viability of transplanted cells. It has been known that manganese chloride (MnCl2) enters the cells via voltage-gated calcium (Ca2+) channels when the cells are biologically active, and accumulates intracellularly to generate T1 shortening effect. Therefore, we suggest that manganese-guided MRI can be useful to monitor cell viability after the transplantation of hESC into the myocardium.
In this video, we will show how to label hESC with MnCl2 and how those cells can be clearly seen by using MRI in vitro. At the same time, biological activity of Ca2+-channels will be modulated utilizing both Ca2+-channel agonist and antagonist to evaluate concomitant signal changes.

In this video, we are showing how to label human embryonic stem cells (hESC) with manganese chloride (MnCl2) which can enter cells via voltage-gated calcium channels when the cells are biologically active. Additionally, we show the use of MnCl2 as cellular MRI contrast agent to determine the in vitro viability of hESC.

자기 공명 영상을위한 인간 배아 줄기 세포의 체외 라벨에

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

인간 배아 줄기 세포의 문화 및 유지 관리

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

인간 배아 줄기 세포를 동결 융해

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Oligodendrocyte 엽 성의 전구 물질로 배아 줄기 세포의 분화

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.