저자는 금융 지원을위한 로버트 W. 독일어 재단, 국방 위협 감소 기관 (DTRA), 연구의 국립 과학 재단 (National Science Foundation) 신흥 프론티어와 혁신 (EFRI)을 인정합니다. 저자는 또한 클린 룸 시설 지원을 위해 메릴랜드 Nanocenter과 Fablab 감사합니다.

미세 유체 칩의 1 미세 <ol><li> 전기 칩을 준비 <ol><li> 패턴 골드 ​​전극 <ol><li> 아세톤, 메탄올, 이소프로판올 ( &quot;AMI&quot;청소)와 빈 사 &#39;&#39;실리콘 웨이퍼 (프라임 등급의 품질을) 씻어. N이 총을 건조하여 탈 이온수 (DI)과 웨이퍼의 이소프로판올을 씻어. </li><li> 플라즈마 강화 화학 기상 증착 (PECVD) 도구 1 μm의 두께의 SiO2 보호 층을 성장한다. DC 스퍼터링 도구로 금 2,000 두꺼운 층 다음에 크롬 200 두꺼운 층을 증착. </li><li> 스핀 &quot;PR1&quot;긍정적 인 포토 레지스트 (회전 매개 변수 : 3,000 rpm으로, 1000 RPM / 초, 30 초) 1.6 μm의 두께 균일 한 막 ~을 만들 수 있습니다. 전 빵을 핫 플레이트에 100 ° C에서 1 분 동안 웨이퍼. </li><li> 190 엠제이 / 포토 마스크를 통해 405 nm 파장에서 cm 2 웨이퍼를 노출. DEV (352)에서 30 초 동안 웨이퍼를 개발eloper는 N이 총 DI와 웨이퍼 건조를 씻어. </li><li> 1.5 분 동안 골드 에칭액 금을 에칭. ~ 30 초 동안 크롬에 천트와 크롬 에칭. DI와 웨이퍼를 씻어 N이 총을 건조. </li><li> &quot;AMI&quot;청소 절차에 포토 레지스트를 벗겨. 참고 : 강산 화제 및 폭발 위험. </li><li> 한 H 2 SO 4 : 4 : 4로 웨이퍼를 청소 H 2 O 2 혼합물 ( &quot;피라&quot;클린)을 1 분 동안. DI와 웨이퍼를 씻어 N이 총을 건조. </li></ol></li><li> 패턴 백금 전극 <ol><li> 스핀 &quot;PR2&quot;긍정적 인 포토 레지스트 (회전 매개 변수 : 3,000 rpm으로, 1000 RPM / 초, 30 초) 1.4 μm의 두께 균일 한 막 ~을 만들 수 있습니다. 전 빵을 핫 플레이트에 100 ° C에서 1 분 동안 웨이퍼. </li><li> 30 엠제이 / 포토 마스크를 통해 405 nm 파장에서 cm 2 웨이퍼를 노출. 핫 플레이트에서 125 ° C에서 45 초 동안 웨이퍼를 굽는다. 홍수에 노출1000 엠제이 / 포토 마스크없이 405 nm 파장에서 cm 2 웨이퍼. 6에서 2 분 동안 웨이퍼를 개발 : 1 AZ400K 개발자 및 DI와 웨이퍼를 씻어 N이 총을 건조. </li><li> E-빔 증착 시스템을 이용하여 백금의 1600 두꺼운 층이어서 티탄의 (400)의 두꺼운 층을 증착. </li><li> 아세톤 및 이소프로판올로 세척 한 다음 5 분간 초음파 아세톤 욕조에 포토 레지스트를 들어 올립니다. DI와 웨이퍼를 씻어 N이 총을 건조. </li></ol></li></ol></li><li> 분석 채널을 준비 <ol><li> 분석 채널에 대한 금형을 준비 <ol><li> &quot;AMI&quot;청소 절차에 빈 사 &#39;&#39;실리콘 웨이퍼 (테스트 수준의 품질을) 씻어. DI와 웨이퍼의 이소프로판올을 씻어 것은 N이 총을 건조 하였다. </li><li> 스핀 &quot;PR3&quot;네가티브 포토 레지스트 (2 단계 회전 매개 변수 :. 단계 일 - 600 회전, 120 회전 / 초, 10 초 두 단계 - 1,150 rpm으로, 383 회전 / 초,27 초) 균일 한 막 ~ 100 μm의 두께를 만들 수 있습니다. 전 빵을 핫 플레이트 (2 단계 베이킹 매개 변수에 대한 웨이퍼 :. 단계 일 - 300 ° C / 시간에서 65 ° C로 실온에서 진입로와 10 분 동안 온도를 유지 2 단계 - 95 ° C까지 상승 300 ° C에서 / 시간 30 분 동안 대기 온도). </li><li> 2500 엠제이 / 포토 마스크를 통해 405 nm 파장에서 cm 2 웨이퍼를 노출. 포스트 - 빵을 300 ° C / 시간에서 95 ° C까지 올렸와에 의해 웨이퍼 핫 플레이트에서 10 분 동안 온도를 유지. 프로필렌 글리콜 모노 메틸 에테르 아세테이트 (PGMEA) 개발자에서 10 분 동안 웨이퍼를 개발한다. N이 총을 이소프로판올 건조와 웨이퍼를 씻어. </li></ol></li><li> 분석 채널을 제작합니다 <ol><li> 20 분 동안 진공 챔버에서 1 폴리 디메틸 실록산 (PDMS) 혼합물 (엘라스토머 20g, 경화제 2g)과 완전히 탈기 : 10을 준비한다. </li><li> 알루미늄 호일로 몰드 웨이퍼 주위 인클로저를 정의하고 천천히 부어 PDMS 비경금형 이상. </li><li> 상자로에서 PDMS 몰드와 구우 (2 단계 베이킹 매개 변수 :. 한 단계 - 5 분​​ 80 °로 실온에서 진입로 C 2 단계 - 17 분 동안 80 ° C에서 개최). </li><li> 알루미늄 호일에 금형과 장소에서 껍질 멀리 PDMS. 생검 펀치 도구로 구멍을 정의하고, 외과 의사의 칼을 분석 칩을 잘라. </li></ol></li></ol></li></ol> 2 장치를 조립 <ol><li> 수동으로 전기 칩에 작업 전극 PDMS 분석 채널을 맞 춥니 다. PDMS는 채널을 밀봉하고 누설을 방지, 전기 화학적 칩에 잘 스틱. </li><li> 플라스틱 또는 직쇄 엘보 커넥터 어댑터 (0.1875 OD &#39;및 ID 0.0625&#39;)로 짧은가요 성 관을 사용하여가요 성 호스 (0.087 OD &#39;및 ID 0.015&#39;)에 연결. 장치의 구멍을 천공 입구 각 커넥터를 연결합니다. </li><li> 의 타단에 주사기를 연결튜브 및 주사기 펌프에 주사기를 배치합니다. 교대 부 (3)에서 요구되는 절차 단계 및 해당 용액에 의한 주사기의 세트, 튜브와 커넥터를 변경. </li></ol> 3 DNA 하이브리드 분석 NOTE : 전체 채널이 채워질 때까지 200 μL / hr의 유속으로 각 채널에 천천히 용액을 소개. <ol><li> 다른 ssDNA를 프로브 서열과 각각 수직 마이크로 채널을 기능화 (3 별도 수직 마이크로 평행 수행) <ol><li> 각각 다른 ssDNA를 프로브 배양 용액 마이크로 채우기 (10 mM의 인산 완충액을 100 mM의 염화나트륨, 10 μM 트리스 (2 - 카르복시 에틸) 포스 핀 (TCEP), 및 1 μM 프로브 ssDNA를), 및 마이크로 세정 뒤에 1 시간 동안 배양 PBS와 함께. </li><li> 10 mM의 PBS, 100 mM의 염화나트륨 및 1.395 mM의 TCEP의 버퍼에 6 - 머 캅토 -1 - 헥산 올 (MCH)의 1 ㎜를 포함하는 용액과 함께 인큐 마이크로 채우기1 시간 동안 BATE는 PBS와 마이크로 채널을 세정 하였다. </li></ol></li><li> , PDMS를 들어 올려 수평 방향으로 90 ° 회전하고, 고유의 카운터 및 기준 전극 (그림 S1)를 포함하는 각 행과 반응 챔버의 별도의 행을 노출 아래로 배치합니다. </li><li> 4 배의 제어 계측 솔루션 마이크로는 생리 식염수 구연산 나트륨 (SSC) 버퍼를 집중 입력하고 20 분 동안 배양한다. </li><li> 배경 측정 : (작업, 카운터에 접속 텐쇼을 사용하여, 참조 전극 5 밀리미터가 PBS 용액 / 5 mM의 페로을 시안화하여 마이크로 채우고 (EIS 전기 화학 임피던스 분광법) 다른 주파수에 대한 전기 시스템의 임피던스 값을 기록 EIS 파라미터 : 1 MHz의 0.1 Hz에서, 10 년대 당 주파수 데이터 포인트 25 MV 진폭, 기준 전극에 비해 5 MV 편광) 주파수 범위. 마이크로 채널의 각 작동 전극이 측정을 반복합니다. </리&gt; <li> (각 비 보완 및 보완 ssDNA의 목표를 위해 수행) DNA 혼성화를 측정한다. <ol><li> 4X의 대상 ssDNA를 측정 용액 마이크로 채우기 대상 ssDNA를 1 μM을 포함하는 SSC 완충액을 농축시키고, 20 분 동안 배양한다. 단계 3.4에 기재된 DNA를 측정한다. </li></ol></li></ol>

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

저자가 공개하는 게 없다.

우리의 절차는 마이크로 유체 기반의 전기 화학적 바이오 칩의 제조 및 DNA 혼성화 이벤트 분석에 대한 활용도를 보여줍니다. 고 수율 제어 미세 공정을 통해 우리는 전기 화학 센서의 배열과 통합 마이크로 채널로 구성된 장치를 개발한다. 우리는 반복적 인 접근을 통해 전기 화학 칩 및 마이크로 유체 몰드의 포토 리소그래피 절차를위한 제어 처리 파라미터를 고안 하였다. 이 단계는 다른 소형?...

미세 유체 랩 온어 칩 (LOC) 장치는 임상 진단, 환경 모니터링과 생물 의학 연구에 많은 장점을 제공한다. 이러한 장치는 다양한 절차 1-4 배양 시약 혼합, 결합 친화도 기반, 신호 전달, 세포를 포함하여 이루어질 수있는 칩의 영역에 유체 유동을 제어하기 위해 마이크로 유체 채널을 이용한다. 마이크로 유체는 마이크로 웰 플레이트 판독기 또는 전기 영동 겔 쉬프트 분석 같은 종래의 임상 진단 도구에 비해 많은 장점을 제공한다. 유사한 분석을 수행하기 위해 더 적은 시약 (㎕의 반대로 나노 리터) 미세 유동 장치는 크기가 2 ~ 3 명령을 필요로한다. 또한, 이러한 장치는 어떤 이벤트가 생물학적 5,6 채널 내의 종의 작은 한정으로 인해 발생할 수있는 속도를 증가시킬 수있다. 셋째, 센서는 라벨없는 detectio를 제공 할 수 리소그래피 및 에칭 기술을 이용하여 미세 유동 장치 내에 통합 될 수있다명. 마지막으로, 이러한 장치는 생산 및 7-10를 작동 할 수있는 기술자의 입장에서 약간의 작업을 필요로 저렴하다. 라벨없는 검출은 일반적으로 광학 또는 전기 변환기를 사용하여 수행됩니다. 광학 장치에 의한 샘플 분석 물과 저급 간섭 나은 감지 성능을 제공 할 수있다. 그럼에도 불구하고, 그 성능은 샘플의 배경 센서 (11)와 동일한 공진 파장을 갖는 경우에 노출된다. 마이크로 유체 시스템에서 생물학적 및 화학적 검출을 수행하는 전기적인 신호를 이용하여 여러 가지 장점이있다. 이러한 센서는 일반적으로 만 작동 전극 패턴을 필요로하기 때문에 제조는 본질적으로 덜 복잡하다. 다른 양상 신호가 신호 12-15 변환 변환기를 동시에 요구할 수있다 또한, 전기 신호는 대부분 직접 측정 장비와 인터페이스 될 수있다. 전기 센서는 일반적으로 impedanc 변화를 측정전자 (16, 17), 용량 (18), 또는 산화 환원 활동 19. 이러한 시스템의 소형화 아르 그러나 새로운 도전이되게됩니다. 극복하는 가장 중요한 과제는 포함한다 : 샘플 준비 및 (인해 낮은 샘플 볼륨과 레이놀즈 수에) 유체의 혼합, 물리적 및 화학적 효과 (모세관 력을 포함하여, 표면 거칠기, 건축 자재 및 분석 간의 화학적 상호 작용), 낮은 신호 대를 복잡한 생물학적 시료 (예, 혈액 및 타액)에서 전기 활성 분석에서 20-23, 및 잠재적 인 간섭 (감소 된 표면적과 체적에 의해 제조) 잡음비. 이러한 효과의 추가 조사는 전반적인 성능을 개선 할 재현 방식으로이 장치의 정확한 제조 및 운영 가이드 라인에서 발생합니다. DNA 혼성화 검출 유전 질환과 24,25 canc 다양한 형태를 진단하기 위해 광범위하게 사용된다어 26. 매년 독감의 여러 균주 DNA 하이브리드 기술 (27)의 결과를 사용하는 환자에서 식별됩니다. 인플루엔자 바이러스는 미국에서만 28에서 36,000 사망자 매년를 차지한다. 이러한 예는 민감도 나 특이도를 희생하지 않고 낮은 샘플 볼륨 플레이트 리더 또는 젤 시프트 분석으로하고 적은 비용으로 동일한 분석 기법을 수행 할 수있는 벤치 탑 미세 유체 장치에서 혜택을 누릴 수 있습니다. 인해 라벨없는 전기 화학 센싱 많은 장점으로이를 DNA 혼성화 29,30 이벤트의 검출을 위해 광범위하게 사용되고있다. (mm 범위에서) 매크로 스케일 전극 관심 커 용액에 침지되어 설치 그들의 상보 서열과 일치하는 단일 가닥 DNA 서열의 결합 동력학에 대하여 매우 중요한 데이터를 제공하는데 사용될 수있다. 최근 MICR에서 전기 화학적 감지 기능을 통합의 몇 가지 발전이 있었다DNA 혼성화 용 ofluidics. 연구는 혼성화 반응 속도 (31)과 미세 유체 채널에서 검출 (15)에 대한 센서의 통합에 대해 수행되었다. 그러나, 여전히 복잡한 샘플 준비 단계없이 병렬 DNA 혼성화 이벤트를 분석 할 수있는 빠른 처리량 미세 유체 소자에 대한 요구가 존재한다. 본 연구에 제시된 장치는 다수의 상호 작용이 평행 복잡한 샘플 준비 단계없이 상영 할 수있는 플랫폼을 제공한다. 우리 프로토콜은 전기 화학적 바이오 칩은 미세 전자 기계 시스템 (MEMS) 기술 (32, 33)와 마이크로 제조되는 방법 마이크로 유체 기반 나타낸다. 우리는 전극 어레이로 구성 (PDMS), 폴리 디메틸 실록산으로 만들어진 마이크로 유체 칩, 및 전기 화학 칩 모두의 제조 공정을 설명한다. ssDNA의 프로브와 바이오 칩의 화학 작용도 해결됩니다. 마지막으로, ABIL구체적 ssDNA를 타겟을 검출하고 분석하는 바이오 센서의 성만이 설명된다. 전반적으로, 마이크로 유체 기반 전기 화학적 바이오 칩은 신속하고 높은 처리량 분석 기술이다. 이는 생물학적 분자와 전도성 센서 사이의 상호 작용을 조사하기 위해 사용될 수 있고, 랩 온어 칩 다양한 애플리케이션에 이용 될 수있다.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:155px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Material</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4&#39;&#39; Silicon wafer</td>
			<td style="width:155px;">Ultrasil</td>
			<td style="width:227px;">4-5664</td>
			<td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Shipley 1813 photoresist (&#34;PR1&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">AZ5214 photoresist (&#34;PR2&#34;)</td>
			<td style="width:155px;">Hoechst Celanse</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SU-8 50 photoresist (&#34;PR3&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">negative photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">TFA</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chromium etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">1020AC</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS elastomer</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097366 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS curing agent</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097358 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Biopsy punching tool</td>
			<td style="width:155px;">Healthlink</td>
			<td style="width:227px;">BP20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible tubing</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">R 3603</td>
			<td>.015&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible adapter</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">06417-41</td>
			<td>.0625&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">1 mL syringe</td>
			<td style="width:155px;">Beckton-Dickenson</td>
			<td align="right" style="width:227px;">301025</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monobasic potassium phosphate</td>
			<td style="width:155px;">Fluka</td>
			<td align="right" style="width:227px;">1551139</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium phosphate dibasic anhydrous</td>
			<td style="width:155px;">Sigma</td>
			<td style="width:227px;">RES20765-A7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium chloride</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:227px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">tris(2-carboxyethyl)phosphine</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">C4706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">6-mercapto-1-hexanol</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">451088</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">20x concentrated saline-sodium citrate buffer</td>
			<td style="width:155px;">Sigma</td>
			<td align="right" style="width:227px;">93017</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium hexacyanoferrate(III)</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">455946</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium ferrocyanide</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">CDS001589</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG 
			TGGACGTCCC-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-GGGACGTCCACGGAGCGCTA 
			TCGGAGCTTT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA 
			ATCGATGAGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-ACTCATCGATTCGTCAATGA 
			CCTGACCCGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA 
			CCCATGATGA-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-TCATCATGGGTCTAACTACT 
			GGATCTAGGT-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Instrument</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Plasma Enhanced Chemical Vapor Deposition (PECVD)</td>
			<td style="width:155px;">Oxford Instruments</td>
			<td style="width:227px;">PlasmaLab System 100</td>
			<td>Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DC sputtering unit</td>
			<td style="width:155px;">AJA International</td>
			<td style="width:227px;">ATC 1800-V</td>
			<td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">E-beam evaporation system</td>
			<td style="width:155px;">Denton</td>
			<td style="width:227px;">Custom-built</td>
			<td>For Titanium: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Potentiostat</td>
			<td style="width:155px;">CH Instruments</td>
			<td style="width:227px;">660D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Syringe pump</td>
			<td style="width:155px;">KD Scientific</td>
			<td style="width:227px;">KDS230</td>
			<td></td>
		</tr>
	</tbody>
</table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

마이크로 규모로 분석 벤치 탑 절차의 소형화는, 반응 시간, 비용, 및 사전 처리 단계의 통합에 관해서 상당한 이점을 제공한다. 그것은 치료 시점에서 각종 질병에 대한 바이오 마커의 실시간 평가를위한 기술을 제공하기 때문에 DNA 혼성화 사건의 분석으로 이들 장치를 이용하는 것이 중요하다. 그러나, 디바이스 풋 프린트는 다양한 물리적 현상 증가의 지배력을 감소시킨다. 이러한 현상은 가공 정밀도 및 장치의 작동 안정성에 영향을 미친다. 따라서, 정확하게 전반적인 성능을 개선하기 위해 재생 가능한 방식으로 이러한 장치를 제작하고 운영하는 중대한 필요성이 존재한다. 여기서, 우리는 프로토콜과 제조 및 DNA 혼성화 사건의 정확한 분석 용 미세 유체 기반 전기 화학적 바이오 칩의 동작에 사용되는 방법을 설명한다. 바이오 칩은 두 부분으로 구성되어있다 : 미세 유체 칩세 폴리 디메틸 실록산 (PDMS)로 이루어지는 병렬 마이크로 채널, 3 × 3 배열 된 전기 마이크로 칩. DNA 혼성화 이벤트는 전기 화학 임피던스 분광법 (EIS) 분석을 이용하여 검출된다. EIS 분석이 길이 규모에서 지배적 인 전기 시스템의 특성의 모니터링 변화를 가능하게한다. 바이오 센서와 양 전하 전송 및 diffusional 저항의 변화를 모니터링 할 수있는 능력으로, 우리는 20 분 다음 상보 ssDNA를 대상으로 선택성, 3.8 ㎚의 계산 된 검출 한계, 및 다른 비 - 상보 ssDNA를 가진 13 % 교차 반응성을 보여 배양. 이 방법론은 마이크로 스케일 레짐에서 확산 동작에 의해 해명 및 DNA 혼성화 사건의 조사를 가능하게하여 소형화 된 장치의 성능을 향상시킬 수있다.

실험 장치의 제어 및 정확한 제조 공정이 연구에서 중요하다. 이 연구원은 재현성 및 높은 처리량 실험을 얻을 수 있습니다. 여기에서 우리는 마이크로 유체 기반의 전기 화학적 바이오 칩 (그림 1)의 높은 수율, 높은 재현성의 미세 공정을 증명하고있다. 낮은 실패율로, 몇몇 디바이스는 액 유출로 이어질 접합 문제를 보였다. 바이오칩의 전기 화학적 활성을 검증하기 위해, 순환 전압...

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

우리는 DNA 혼성화 검출을위한 미세 유체 기반 전기 바이오칩을 제시한다. ssDNA를 프로브 작용에 따라, 특이도, 민감도 및 검출 한계 보완 및 비 보완 ssDNA를 목표로 공부하고 있습니다. 결과는 3.8 nm의 검출 한계와 함께, 전기 화학적 시스템의 DNA 혼성화 이벤트의 영향을 예시한다.

라벨없는 DNA의 혼성화 분석 용 미세 유체 기반 전기 바이오칩

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

a-microfluidic-based-electrochemical-biochip-for-label-free-dna

Research

JoVE Journal

Bioengineering

17.0K 조회수.  University of Maryland.  우리는 DNA 혼성화 검출을위한 미세 유체 기반 전기 바이오칩을 제시한다. ssDNA를 프로브 작용에 따라, 특이도, 민감도 및 검출 한계 보완 및 비 보완 ssDNA를 목표로 공부하고 있습니다. 결과는 3.8 nm의 검출 한계와 함께, 전기 화학적 시스템의 DNA 혼성화 이벤트의 영향을 예시한다. 

비디오: A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

A Microfluidic-based Hydrodynamic Trap for Single Particles

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science. Methods for particle trapping based on optical, magnetic, electrokinetic, and acoustic techniques have led to major advancements in physics and biology ranging from the molecular to cellular level. In this article, we introduce a new microfluidic-based technique for particle trapping and manipulation based solely on hydrodynamic fluid flow. Using this method, we demonstrate trapping of micro- and nano-scale particles in aqueous solutions for long time scales. The hydrodynamic trap consists of an integrated microfluidic device with a cross-slot channel geometry where two opposing laminar streams converge, thereby generating a planar extensional flow with a fluid stagnation point (zero-velocity point). In this device, particles are confined at the trap center by active control of the flow field to maintain particle position at the fluid stagnation point. In this manner, particles are effectively trapped in free solution using a feedback control algorithm implemented with a custom-built LabVIEW code. The control algorithm consists of image acquisition for a particle in the microfluidic device, followed by particle tracking, determination of particle centroid position, and active adjustment of fluid flow by regulating the pressure applied to an on-chip pneumatic valve using a pressure regulator. In this way, the on-chip dynamic metering valve functions to regulate the relative flow rates in the outlet channels, thereby enabling fine-scale control of stagnation point position and particle trapping. The microfluidic-based hydrodynamic trap exhibits several advantages as a method for particle trapping. Hydrodynamic trapping is possible for any arbitrary particle without specific requirements on the physical or chemical properties of the trapped object. In addition, hydrodynamic trapping enables confinement of a "single" target object in concentrated or crowded particle suspensions, which is difficult using alternative force field-based trapping methods. The hydrodynamic trap is user-friendly, straightforward to implement and may be added to existing microfluidic devices to facilitate trapping and long-time analysis of particles. Overall, the hydrodynamic trap is a new platform for confinement, micromanipulation, and observation of particles without surface immobilization and eliminates the need for potentially perturbative optical, magnetic, and electric fields in the free-solution trapping of small particles.

In this article, we present a microfluidic-based method for particle confinement based on hydrodynamic flow. We demonstrate stable particle trapping at a fluid stagnation point using a feedback control mechanism, thereby enabling confinement and micromanipulation of arbitrary particles in an integrated microdevice.

단일 입자 Microfluidic 기반 유체 트랩

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

연구

생체공학

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

핵산, 단백질과 작은 분자의 Reagentless 감지를위한 전기 -의 DNA Biosensors의 제작

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Non-contact, Label-free Monitoring of Cells and Extracellular Matrix using Raman Spectroscopy

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, currently available routine methods require processing steps and alter sample integrity. Raman spectroscopy is a fast method that enables the measurement of biological samples without the need for further processing steps. This laser-based technology detects the inelastic scattering of monochromatic light.6 As every chemical vibration is assigned to a specific Raman band (wavenumber in cm-1), each biological sample features a typical spectral pattern due to their inherent biochemical composition.7-9 Within Raman spectra, the peak intensities correlate with the amount of the present molecular bonds.1 Similarities and differences of the spectral data sets can be detected by employing a multivariate analysis (e.g. principal component analysis (PCA)).10
Here, we perform Raman spectroscopy of living cells and native tissues. Cells are either seeded on glass bottom dishes or kept in suspension under normal cell culture conditions (37 &deg;C, 5% CO2) before measurement. Native tissues are dissected and stored in phosphate buffered saline (PBS) at 4 &deg;C prior measurements. Depending on our experimental set up, we then either focused on the cell nucleus or extracellular matrix (ECM) proteins such as elastin and collagen. For all studies, a minimum of 30 cells or 30 random points of interest within the ECM are measured. Data processing steps included background subtraction and normalization.

Raman spectroscopy is a suitable technique for the non-contact, label-free analysis of living cells, tissue-engineered constructs and native tissues. Source-specific spectral fingerprints can be generated and analyzed using multivariate analysis.

라만 분광학을 사용하여 세포와 세포외 기질의 비 접촉, 레이블이없는 모니터링

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals suffering from chronic medical conditions facile assessment of their immediate physiological state. Furthermore, it could serve as a research tool for analysis of complex, multifactorial medical conditions. In order for such a multianalyte sensor to be realized, it must be minimally invasive, sampling of interstitial fluid must occur without pain or harm to the user, and analysis must be rapid as well as selective.
Initially developed for pain-free drug delivery, microneedles have been used to deliver vaccines and pharmacologic agents (e.g., insulin) through the skin.1-2 Since these devices access the interstitial space, microneedles that are integrated with microelectrodes can be used as transdermal electrochemical sensors. Selective detection of glucose, glutamate, lactate, hydrogen peroxide, and ascorbic acid has been demonstrated using integrated microneedle-electrode devices with carbon fibers, modified carbon pastes, and platinum-coated polymer microneedles serving as transducing elements.3-7,8
This microneedle sensor technology has enabled a novel and sophisticated analytical approach for in situ and simultaneous detection of multiple analytes. Multiplexing offers the possibility of monitoring complex microenvironments, which are otherwise difficult to characterize in a rapid and minimally invasive manner. For example, this technology could be utilized for simultaneous monitoring of extracellular levels of, glucose, lactate and pH,9 which are important metabolic indicators of disease states7,10-14 (e.g., cancer proliferation) and exercise-induced acidosis.15

This article details the construction of a multiplexed microneedle-based sensor. The device is being developed for in situ sampling and electrochemical analysis of multiple analytes in a rapid and selective manner. We envision clinical medicine and biomedical research uses for these microneedle-based sensors.

다중 Transdermal 전기 감지를위한 빈 Microneedle 기반 센서

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

전기 화학 센서를 사용하여 세균의 검출 및 식별

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Multi-analyte Biochip (MAB) Based on All-solid-state Ion-selective Electrodes (ASSISE) for Physiological Research

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) that can withstand prolonged storage in complex biological media 1-4. An all-solid-state ion-selective-electrode (ASSISE) is especially attractive for the aforementioned applications. The electrode should have the following favorable characteristics: easy construction, low maintenance, and (potential for) miniaturization, allowing for batch processing. A microfabricated ASSISE intended for quantifying H+, Ca2+, and CO32- ions was constructed. It consists of a noble-metal electrode layer (i.e. Pt), a transduction layer, and an ion-selective membrane (ISM) layer. The transduction layer functions to transduce the concentration-dependent chemical potential of the ion-selective membrane into a measurable electrical signal.
The lifetime of an ASSISE is found to depend on maintaining the potential at the conductive layer/membrane interface 5-7. To extend the ASSISE working lifetime and thereby maintain stable potentials at the interfacial layers, we utilized the conductive polymer (CP) poly(3,4-ethylenedioxythiophene) (PEDOT) 7-9 in place of silver/silver chloride (Ag/AgCl) as the transducer layer. We constructed the ASSISE in a lab-on-a-chip format, which we called the multi-analyte biochip (MAB) (Figure 1).
Calibrations in test solutions demonstrated that the MAB can monitor pH (operational range pH 4-9), CO32- (measured range 0.01 mM - 1 mM), and Ca2+ (log-linear range 0.01 mM to 1 mM). The MAB for pH provides a near-Nernstian slope response after almost one month storage in algal medium. The carbonate biochips show a potentiometric profile similar to that of a conventional ion-selective electrode. Physiological measurements were employed to monitor biological activity of the model system, the microalga Chlorella vulgaris.
The MAB conveys an advantage in size, versatility, and multiplexed analyte sensing capability, making it applicable to many confined monitoring situations, on Earth or in space.
Biochip Design and Experimental Methods
The biochip is 10 x 11 mm in dimension and has 9 ASSISEs designated as working electrodes (WEs) and 5 Ag/AgCl reference electrodes (REs). Each working electrode (WE) is 240 &mu;m in diameter and is equally spaced at 1.4 mm from the REs, which are 480 &mu;m in diameter. These electrodes are connected to electrical contact pads with a dimension of 0.5 mm x 0.5 mm. The schematic is shown in Figure 2.
Cyclic voltammetry (CV) and galvanostatic deposition methods are used to electropolymerize the PEDOT films using a Bioanalytical Systems Inc. (BASI) C3 cell stand (Figure 3). The counter-ion for the PEDOT film is tailored to suit the analyte ion of interest. A PEDOT with poly(styrenesulfonate) counter ion (PEDOT/PSS) is utilized for H+ and CO32-, while one with sulphate (added to the solution as CaSO4) is utilized for Ca2+. The electrochemical properties of the PEDOT-coated WE is analyzed using CVs in redox-active solution (i.e. 2 mM potassium ferricyanide (K3Fe(CN)6)). Based on the CV profile, Randles-Sevcik analysis was used to determine the effective surface area 10. Spin-coating at 1,500 rpm is used to cast ~2 &mu;m thick ion-selective membranes (ISMs) on the MAB working electrodes (WEs).
The MAB is contained in a microfluidic flow-cell chamber filled with a 150 &mu;l volume of algal medium; the contact pads are electrically connected to the BASI system (Figure 4). The photosynthetic activity of Chlorella vulgaris is monitored in ambient light and dark conditions.

Multi-analyte Biochip MAB Based on All-solid-state Ion-selective Electrodes ASSISE for Physiological Research

All-solid-state ion-selective electrodes (ASSISEs) constructed from a conductive polymer (CP) transducer provide several months of functional lifetime in liquid media. Here, we describe the fabrication and calibration process of ASSISEs in a lab-on-a-chip format. The ASSISE is demonstrated to have maintained a near-Nernstian slope profile after prolonged storage in complex biological media.

생리 연구를위한 모든 고체 이온 선택성 전극 (ASSISE)를 기반으로 다중 분석 바이오칩 (MAB)

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) ...

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans' Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and pathways as well as its ease of cultivation. Several C. elegans disease models have been reported, including neurodegenerative disorders such as Parkinson's disease (PD), which involves the degeneration of dopaminergic (DA) neurons 1. Both transgenes and neurotoxic chemicals have been used to induce DA neurodegeneration and consequent movement defects in worms, allowing for investigations into the basis of neurodegeneration and screens for neuroprotective genes and compounds 2,3.
Screens in lower eukaryotes like C. elegans provide an efficient and economical means to identify compounds and genes affecting neuronal signaling. Conventional screens are typically performed manually and scored by visual inspection; consequently, they are time-consuming and prone to human errors. Additionally, most focus on cellular level analysis while ignoring locomotion, which is an especially important parameter for movement disorders.
We have developed a novel microfluidic screening system (Figure 1) that controls and quantifies C. elegans' locomotion using electric field stimuli inside microchannels. We have shown that a Direct Current (DC) field can robustly induce on-demand locomotion towards the cathode ("electrotaxis") 4. Reversing the field's polarity causes the worm to quickly reverse its direction as well. We have also shown that defects in dopaminergic and other sensory neurons alter the swimming response 5. Therefore, abnormalities in neuronal signaling can be determined using locomotion as a read-out. The movement response can be accurately quantified using a range of parameters such as swimming speed, body bending frequency and reversal time.
Our work has revealed that the electrotactic response varies with age. Specifically, young adults respond to a lower range of electric fields and move faster compared to larvae 4. These findings led us to design a new microfluidic device to passively sort worms by age and phenotype 6.
We have also tested the response of worms to pulsed DC and Alternating Current (AC) electric fields. Pulsed DC fields of various duty cycles effectively generated electrotaxis in both C. elegans and its cousin C. briggsae 7. In another experiment, symmetrical AC fields with frequencies ranging from 1 Hz to 3 KHz immobilized worms inside the channel 8.
Implementation of the electric field in a microfluidic environment enables rapid and automated execution of the electrotaxis assay. This approach promises to facilitate high-throughput genetic and chemical screens for factors affecting neuronal function and viability.

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans&#039; Locomotion

A semi-automated micro-electro-fluidic method to induce on-demand locomotion in Caenorhabditis elegans is described. This method is based on the neurophysiologic phenomenon of worms responding to mild electric fields (&#x201C;electrotaxis&#x201D;) inside microfluidic channels. Microfluidic electrotaxis serves as a rapid, sensitive, low-cost, and scalable technique to screen for factors affecting neuronal health.

의 주문형 정량 분석​​을위한 미세 유체 기반 Electrotaxis<em&gt; Caenorhabditis의 엘레</em&gt; &#39;로코

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and ...

A Label-free Technique for the Spatio-temporal Imaging of Single Cell Secretions

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning of such signaling can lead to many disorders. To understand cell-to-cell signaling, it is essential to study the spatial and temporal nature of the secreted molecules from the cell without disturbing the local environment. Various assays have been developed to study protein secretion, however, these methods are typically based on fluorescent probes which disrupt the relevant signaling pathways. To overcome this limitation, a label-free technique is required.
In this paper, we describe the fabrication and application of a label-free localized surface plasmon resonance imaging (LSPRi) technology capable of detecting protein secretions from a single cell. The plasmonic nanostructures are lithographically patterned onto a standard glass coverslip and can be excited using visible light on commercially available light microscopes. Only a small fraction of the coverslip is covered by the nanostructures and hence this technique is well suited for combining common techniques such as fluorescence and bright-field imaging.
A multidisciplinary approach is used in this protocol which incorporates sensor nanofabrication and subsequent biofunctionalization, binding kinetics characterization of ligand and analyte, the integration of the chip and live cells, and the analysis of the measured signal. As a whole, this technology enables a general label-free approach towards mapping cellular secretions and correlating them with the responses of nearby cells.

Inter-cellular communication is critical for controlling various physiological activities within and outside the cell. This paper describes a protocol for measuring the spatio-temporal nature of single cell secretions. To achieve this, a multidisciplinary approach is used which integrates label-free nanoplasmonic sensing with live cell imaging.

단일 세포 분비물의 공간 - 시간 영상의 레이블이없는 기술

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning ...

Label-free Single Molecule Detection Using Microtoroid Optical Resonators

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental studies on the behavior of molecules. Single molecule detection techniques commonly utilize labels such as fluorescent tags or quantum dots, however, labels are not always available, increase cost and complexity, and can perturb the events being studied. Optical resonators have emerged as a promising means to detect single molecules without the use of labels. Currently the smallest particle detected by a non-plasmonically-enhanced bare optical resonator system in solution is a 25 nm polystyrene sphere1. We have developed a technique known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that can surpass this limit and achieve label-free single molecule detection in aqueous solution2. As signal strength scales with particle volume, our work represents a &#62; 100x improvement in the signal to noise ratio (SNR) over the current state of the art. Here the procedures behind FLOWER are presented in an effort to increase its usage in the field.

We have developed a label-free biosensing system based on optical resonator technology known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that is capable of detecting single molecules in solution. Here the procedures behind this work are described and presented.

Microtoroid 광 공진기를 사용하여 라벨이없는 단일 분자 검출

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental ...

PIP-on-a-chip: A Label-free Study of Protein-phosphoinositide Interactions

Numerous cellular proteins interact with membrane surfaces to affect essential cellular processes. These interactions can be directed towards a specific lipid component within a membrane, as in the case of phosphoinositides (PIPs), to ensure specific subcellular localization and/or activation. PIPs and cellular PIP-binding domains have been studied extensively to better understand their role in cellular physiology. We applied a pH modulation assay on supported lipid bilayers (SLBs) as a tool to study protein-PIP interactions. In these studies, pH sensitive ortho-Sulforhodamine B conjugated phosphatidylethanolamine is used to detect protein-PIP interactions. Upon binding of a protein to a PIP-containing membrane surface, the interfacial potential is modulated (i.e. change in local pH), shifting the protonation state of the probe. A case study of the successful usage of the pH modulation assay is presented by using phospholipase C delta1 Pleckstrin Homology (PLC-&#948;1 PH) domain and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) interaction as an example. The apparent dissociation constant (Kd,app) for this interaction was 0.39 &#177; 0.05 &#181;M, similar to Kd,app values obtained by others. As previously observed, the PLC-&#948;1 PH domain is PI(4,5)P2 specific, shows weaker binding towards phosphatidylinositol 4-phosphate, and no binding to pure phosphatidylcholine SLBs. The PIP-on-a-chip assay is advantageous over traditional PIP-binding assays, including but not limited to low sample volume and no ligand/receptor labeling requirements, the ability to test high- and low-affinity membrane interactions with both small and large molecules, and improved signal to noise ratio. Accordingly, the usage of the PIP-on-a-chip approach will facilitate the elucidation of mechanisms of a wide range of membrane interactions. Furthermore, this method could potentially be used in identifying therapeutics that modulate protein&#39;s capacity to interact with membranes.

Here we present a supported lipid bilayer in the context of a microfluidic platform to study protein-phosphoinositide interactions using a label-free method based on pH modulation.

PIP-on-a-chip : 단백질 - 포스 포이 노시 티드 상호 작용에 대한 라벨없는 연구

Numerous cellular proteins interact with membrane surfaces to affect essential cellular processes. These interactions can be directed towards a specific ...