이 작품은 대상 과제의 탐험의 이니셔티브를 통해, 그리고 보조금 GM062958 - 01과 2R01EB002046 통해 NIH에 의해 빌 앤드 멜린다 게이츠 재단의 그랜트 (OPP1015402)에 의해 재정 지원되었다. 이 작품은 계약 DE - AC52 - 07NA27344 아래의 로렌스 리버 모어 국립 연구소에 의해 에너지의 미 교육부의 후원 아래 부분에 수행되었다.

1. 무대 설정 <ol><li> 이러한 Biosearch 기술 (노바토, CA) 또는 미들랜드 공인 (미들랜드, TX)와 같은 사용자 정의 oligonucleotide 합성 회사 관련, 화학적으로 바뀌었 프로브 DNA를 구입합니다. 프로브는 3&#39; - 끝에 C6 thiol의 추가 및 5&#39; - 끝에 산화 환원 활성 메틸렌 블루에 의해 합성하는 동안 수정됩니다. </li><li> 인산염의 프로브 DNA를 디졸브 200 μm의의 농도 호수 산도 7.4 버퍼와 분광 광도계를 사용하여 260 nm의 흡광도에서 자사를 측정하여 농도를 확인합니다. DNA 프로브의 메틸렌 블루 잔기로 인해 솔루션이 보이는 파란색 색조가 있어야합니다. </li><li> 갓 증류수, 탈이온수 (DI - 물)에 트리스 (2 - carboxyethyl) phosphine TCEP의 10 MM 솔루션 1 ML을 준비합니다. 4 ° C.에 어둠에 저장하면 경험에서 이러한 TCEP 솔루션은 일주일 동안 신선한 유지 </li><li> 프로브 DNA 용액에 존재 수있는 이황화 채권을 줄이기 위해 TCEP 솔루션 2 μL와 프로브 DNA 주식 솔루션 1 μL를 결합하고 피펫과 함께 부드럽게 섞는다. 어두운, 냉장 컨​​테이너 한 시간 동안 혼합물을 품어. TCEP가 reversibly 메틸렌 블루를 감소 등 초기 푸른 솔루션은 분명이 될 것입니다. 솔루션 취소가되지 않는 경우, 상온에서, 아마도, 새로운 TCEP 솔루션을 사용하여 절차를 반복하거나. </li><li> 일시간 후 버퍼 1 ML로 감소 DNA 프로브 솔루션을 희석,이 200nM의 농도로 희석합니다. 나중에,이 희석된 프로브 솔루션을 200 μL 부분에 골드 디스크 전극 세트를 품어 것입니다. </li><li> 갓 인산염에 2mM mercaptohexanol 중 최소한 2 ML을 준비하는 것은 살린 버퍼. </li></ol> 2. 센서 준비 <ol><li> 잘 연마 헝겊에 물을 0.05 미크론 알루미나 분말을 결합합니다. 전극 약 3 분 여덟 패턴을 젖은 천으로에 단단히 금 표면을 누르면, 그리고 그림을 이동하여 골드 디스크 전극 (CH 인 스트 루먼트, 오스틴, TX)의 집합을 폴란드어. </li><li> DI - 물로 광택 전극을 씻어 같은 가득한 Eppendorf 튜브에 그들을 담가. 잔여 알루미나 분말을 제거하는 5 분 동안 Sonicate. </li><li> 0.5 M 황산 용액에 전극을 장소, 플래티넘 카운터와 은색 / 실버 염화물 참조 전극과 함께 potentiostat로 첨부하고, 산화 감소 및 electrochemically 그들의 표면을 청소 voltammograms 일련의 실행합니다. 이것은 0.1 M 황산에 0.01 M KCl의 솔루션에 두 번째 전기 청소를 수행합니다 다음. 이러한 청소 절차의 세밀한 부분은 우리의 자연 프로토콜 용지 1,이 동영상에 대한 보완에서 찾을 수 있습니다. </li><li> 선반 2 ML Eppendorf 튜브의 집합을 정렬하고 프로브 DNA 용액 200 μL와 각각 입력합니다. 이 솔루션의 프로브 DNA의 농도는 어떤 프로브 DNAs 팩이 센서 표면 밀도를 정의합니다. 센서의 성능은 한개의 센서 아키텍처에서 다음 각기 최적의 밀도와 프로브 밀도에 강하게 의존한다. 이 단계에서 사용되는 프로브 농도 따라서 센서 2 개 중 각각의 새로운 유형의 최적화해야합니다. 우리가 현재까지 조사가 프로브 사용하지 않는 아키텍처의 경우, 프로브 DNA의 농도 우리는 전형적인 가치가되는 200 nm의와, 15 NM에서 2 μm의이 단계 범위에서 사용합니다. </li><li> DI - 물로 골드 디스크 전극을 씻어 후 한 시간 만이라도 Eppendorf 튜브에 해당 프로브 DNA 솔루션에 젖어. 이 시점에서, 프로브 DNA가 thiol - 온 - 금 자체 조립 monolayer의 형성을 통해 금 전극 표면에 연결합니다. </li><li> DI - 물로 전극을 린스, Eppendorf 튜브에 2mM mercaptohexanol에 젖어 및 자기 조립 monolayer의 완전한 형성을 보장하기 위해 실온에서 하룻밤 3 시간 동안 어두운 장소에 저장합니다. 이 단계는 안정 monolayer의 형성을 보장하기 위해 혼합 monolayer의 일부로 mercaptohexanol이 통합되어 있습니다. 증발을 방지하기 위해 당신은 parafilm과 Eppendorf 튜브에 전극을 밀봉하는 것이 좋습니다. 센서가 필요한 경우 며칠이 솔루션에 저장할 수 있습니다. </li><li> 당신이 센서를 사용 준비가되면, DI - 물로 그것을 씻어 후 적어도 10 분 동안 버퍼에 그것을 만끽해보세요. 항체 검출하기위한 센서는 또한 버퍼와 린스 매우 빠르고 다음에 사용하기 전에 관련 인식 스트랜드의 100 nm의 솔루션에 열중해야합니다. </li></ol> 3. 센서 테스트, DNA 탐지 <ol><li> 이 프로토콜에서 17 뉴클레오 티드 프로브 가닥은 금 전극에 부착된입니다. 그것은 3&#39; - 끝에 메틸렌 블루 산화 환원 기자 (그림 1)을하고 있습니다. 프로브 분자가 캡처 가닥과 hybridizes 경우, 센서 회로를 통해 전류가 줄어 듭니다. </li><li> DI - 물과 신선한 센서를 씻어 빈에 젖어샘플은 생산 배경 신호를 기록하기 위해 목표를 부족. potentiostat의 작업 전극 리드에 센서를 부착합니다. 플래티넘 카운터 전극과 솔루션에 은색 / 실버 염화물 참조 전극을 배치합니다. </li><li> 0에서 25 MV의 진폭과 1mV의 스텝 크기 -0.6 V로 사각형 웨이브 측정을 실행합니다. 최적의 사각 파의 주파수는 프로브 아키텍처 2,3의 세부 사항에 따라 달라집니다, 프로브 아키텍처에 우리는 600 Hz로 범위 60 일반적으로하는 최적의 가치를 고용했습니다. 당신은 약 -0.35 V, 메틸렌 블루의 산화 환원 전위 (최대 잠재력이 테스트 솔루션의 정확한 산도에 따라 약간 변화 수)에 둥근 피크가 나타납니다. 이 피크 전류를 기준에서 높이 메틸렌 블루와 골드 전극 (Figure2) 사이의 효율성 전자 전달에 비례합니다. 이 배경 측정을 저장합니다. </li><li> 관심의 대상 DNA 분자를 포함하는 솔루션에 전극을 이동 평형 (5-120 분 target4 5의 크기, 구조와 농도에 따라)와 두 번째 사각형 파도 voltammagram를 수집합니다. -0.35 V에서 피크의 높이가 초기, 배경 측정에서 변경됩니다. 이러한 변화의 크기는 analyte의 농도에 관련되어 있습니다. 그것은이 센서의 주요 출력 데이터 (그림 3)입니다. </li><li> 상대 신호의 변화, 비율 감소 또는 배경 피크에 상대적으로 신호 증가를 측정하면 전극의 표면적 변화에 대해이 해결로 종종 현재의 절대 변화를 측정하는 것보다 더 재현할 수 있습니다. 이렇게하려면 정상 현재와 배경 피크 전류 사이의 차이는 현재의 배경 피크로 나누어집니다. </li></ol> 4. 센서 리제 <ol><li> 당신의 측정이 완료되면, 30 S.위한 DI - 물의 꾸준한로 30 s에 대한 DI - 물이 채워진 용기에 센서를 이동하거나, 애송이 신선한 탈이온수이 두 번 더 반복합니다. 참고 : 일부 analytes이 방법에 강한되며 이들 6 M 구아니딘 염산염 또는 70 % 에탄올에 rinsing 공격을 시도하십시오. </li><li> 측정이 이루어집니다 솔루션에 다시 센서를 넣어. 분 내에 정상 높이가 원래 값으로 반환해야한다. 그것은이 센서는 종종 자신의 첫 번째 테스트와 재생주기 동안 약간 큰 신호 변경하고 이후 6주기 동안 높은 일관된 결과를 전시 협조할 것입니다. </li></ol> 5. 센서 테스트, 항체 탐지 <ol><li> 이 프로토콜에서는,이 센서에 사용되는 메틸렌 블루와 thiol - 수정된 DNA 프로브는 &quot;앵커&quot;스트랜드 7 역할을합니다. 이것은 금 전극에 직접 연결되어 있습니다. 이것은 다음 관련 항원 (그림 4) covalently 복합되어 두 번째, &quot;인식&quot;의 DNA 가닥과 함께 hybridized입니다. 우리는 필요한 DNA - 항원 chimeras의 합성에 대한 이러한 Biosearch 기술 및 Panagene 같은 상업 합성 가옥과 행운을 있었다. 하이브 리다이 제이션 단계는 1 시간 동안 PBS에서 관련 인식의 DNA 가닥의 100 nm의를 포함 Eppendorf 튜브에 미리 가공 센서를 전송하여 수행됩니다. </li><li> 관련 빈 솔루션에 센서를 놓습니다. potentiostat의 작업 전극 리드에 첨부 및 솔루션으로 플래티넘 카운터 전극과 은색 / 실버 염화물 참조 전극을 배치. </li><li> 위에서 설명한대로 평방 웨이브 voltammetry를 수행합니다. 특정 프로브 아키텍처를 위해 우리는 최적의 사각형 웨이브 주파수 60 Hz에서입니다 여기에 고용했습니다. 당신은 -0.35 주위에 둥근 피크를 볼 V.이 배경 측정을 저장해야합니다. </li><li> 대상 analyte를 포함하는 솔루션에 전극을 전송, 5 60 분에 대한 부화하고, 두 번째 사각형 파도 voltammagram를 수집합니다. 대상 항체가 존재하는 경우 -0.35 V에서 피크가 줄어 듭니다. 이러한 변화의 크기는 항체 농도와 관련되어 있습니다. </li></ol> 6. 센서 테스트, 소형 분자 탐지 <ol><li> 이 경우 센서 표면에 프로브 분자는 (그 대상 analyte 8,9에 바인딩시 (주름)의 구조를 변경하는 특정 분자 analyte를 바인딩하는 체외로 선정되었습니다 DNA 또는 RNA 분자 aptamer입니다 그림 5). 여기서 우리는 Stojanovic 10,11 연구실에서 개발한 코카인 - 구속력의 DNA aptamer를 사용합니다. </li><li> DI - 물과 신선한 센서를 씻어하고 생산 배경 신호를 기록하기 위해 목표를 부족한 빈 샘플에 젖어. potentiostat의 작업 전극 리드에 센서를 부착합니다. 플래티넘 카운터 및 솔루션에 은색 / 실버 염화물 참조를 놓습니다. </li><li> 위에서 설명한대로 평방 웨이브 voltammetry를 수행합니다. 우리가 여기에 사용한 특정 프로브 아키텍처를위한 최적의 광장 웨이브 주파수 (200Hz입니다그러나 60 Hz에서도) 작동합니다. 당신은 -0.35 주위에 둥근 피크를 볼 V.이 배경 측정을 저장해야합니다. </li><li> 대상 analyte를 포함하는 솔루션에 전극을 전송, ~ 5 분 부화하고, 두 번째 사각형 파도 voltammagram를 수집합니다. -0.35 V에서 피크의 높이가 변경됩니다. 이러한 변화의 크기는 대상 analyte의 농도에 관련되어 있습니다. 당신이 마약 샘플, procaine를 얻을 수 없다면, 관계가없는 어떤의 사용은 대신으로 사용할 수 있습니다. </li></ol> 7. 대표 결과 : 첫 번째 아키텍처를 사용하여 DNA를 감지하는 데 사용하면 신호는 적어도 60 % 감소해야 할 때 200 nm의 대상에서 equilibrated. 탈이온수 세 짧은 rinses 후, 그 신호가 원래 값으로 (0.1-5 % 이내) 매우 가까운 반환해야합니다. 항체 검출 센서은 40 80 % 신호 감소를 받아야한다. 코카인의 검출을위한 Aptamer 기반 센서가 그들이 작동되는 빈도 및 표면 범위에 따라 2백%까지 신호 증가를 나타냅니다. 코카인 센서 들어, 낮은 표면 범위는 최고 3. <img src="/files/ftp_upload/2922/2922fig1.jpg" alt="그림 1" /> 그림 1. 전기의 DNA 바이오 센서와 DNA의 탐지. <img src="/files/ftp_upload/2922/2922fig2.jpg" alt="그림 2" /> 광장 파도 voltammetry 동안 E - DNA의 바이오 센서에 의해 생산되는 신호를 보여주는 그림 2. 스크린 샷. <img src="/files/ftp_upload/2922/2922fig3.jpg" alt="그림 3" /> analyte와 하이브리드화 전후, 스퀘어 웨이브 voltammetry 동안 E - DNA의 바이오 센서에 의해 생산되는 신호를 보여주는 그림 3. 스크린샷. <img src="/files/ftp_upload/2922/2922fig4.jpg" alt="그림 4" /> 그림 4. 비계의 바이오 센서와 항체의 탐지. <img src="/files/ftp_upload/2922/2922fig5.jpg" alt="그림 5" /> 그림 5. 전기 aptamer의 바이오 센서와 코카인이나 procaine의 감지. <table border="1"><tbody><tr><td> 사용자 Oligo </td><td> 순서 </td><td> 댓글 </td></tr><tr><td> 선형 프로브 DNA (LP17) </td><td> 5&#39; - HS - (CH2) 6 - TGGATCGGCGTTTTATT - (CH2) 7 - NH - MB - 3 &#39; </td><td> HPLC 정제는 SS와 함께 주문할 수 있습니다 </td></tr><tr><td> 대상 Analyte의 DNA </td><td> AATAAAACGCCGATCCA </td><td> 수정되지 않은 </td></tr><tr><td> 인정 스트랜드 </td><td> 5&#39; - 항원 TEG - CAGTGGCGTTTTATTCTTGTTACTG - 3 &#39; </td><td></td></tr><tr><td> 스캐폴드 앵커 </td><td> 5&#39; - HS - (CH 2) 6 - GCAGTAACAAGAATAAAACGC CACTGC - (CH 2) 7 - MB </td><td> HPLC 정제는 SS와 함께 주문할 수 있습니다 </td></tr><tr><td> A4 코카인 Aptamer </td><td> 5&#39; - HS - AGACAAGGAAAATCCTTCAATGAAGTGGGTCG - MethyleneBlue - 3 &#39; </td><td> HPLC 정제는 SS와 함께 주문할 수 있습니다 </td></tr></tbody></table> 표 1. 프로브 및 대상의 DNA 시퀀스.

<ol>
	<li>Xiao, Y., Lai, R. Y., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+electrode-immobilized,+redox-modified+oligonucleotides+for+electrochemical+DNA+and+aptamer-based+sensing.">Preparation of electrode-immobilized, redox-modified oligonucleotides for electrochemical DNA and aptamer-based sensing.</a> Nat. Protocols. 2, 2875-2880 (2007).</li><li>Ricci, F., Lai, R. Y., Heeger, A. J., Plaxco, K. W., Sumner, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+Molecular+Crowding+on+the+Response+of+an+Electrochemical+DNA+Sensor.">Effect of Molecular Crowding on the Response of an Electrochemical DNA Sensor.</a> Langmuir. 23, 6827-6834 (2007).</li><li>White, R. J., Phares, N., Lubin, A. A., Xiao, Y., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+Electrochemical+Aptamer-Based+Sensors+via+Optimization+of+Probe+Packing+Density+and+Surface+Chemistry.">Optimization of Electrochemical Aptamer-Based Sensors via Optimization of Probe Packing Density and Surface Chemistry.</a> Langmuir. 24, 10513-10518 (2008).</li><li>Lubin, A. A., Vander Stoep Hunt, B., White, R. J., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Probe+Length,+Probe+Geometry,+and+Redox-Tag+Placement+on+the+Performance+of+the+Electrochemical+E-DNA+Sensor.">Effects of Probe Length, Probe Geometry, and Redox-Tag Placement on the Performance of the Electrochemical E-DNA Sensor.</a> Analytical Chemistry. 81, 2150-2158 (2009).</li><li>Lubin, A. A., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Folding-Based+Electrochemical+Biosensors:+The+Case+for+Responsive+Nucleic+Acid+Architectures.">Folding-Based Electrochemical Biosensors: The Case for Responsive Nucleic Acid Architectures.</a> Accounts of Chemical Research. 43, 496-505 (2010).</li><li>Lubin, A. A., Lai, R. Y., Baker, B. R., Heeger, A. J., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence-Specific,+Electronic+Detection+of+Oligonucleotides+in+Blood,+Soil,+and+Foodstuffs+with+the+Reagentless,+Reusable+E-DNA+Sensor.">Sequence-Specific, Electronic Detection of Oligonucleotides in Blood, Soil, and Foodstuffs with the Reagentless, Reusable E-DNA Sensor.</a> Analytical Chemistry. 78, 5671-5677 (2006).</li><li>Cash, K. J., Ricci, F., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Electrochemical+Sensor+for+the+Detection+of+Protein?Small+Molecule+Interactions+Directly+in+Serum+and+Other+Complex+Matrices.">An Electrochemical Sensor for the Detection of Protein?Small Molecule Interactions Directly in Serum and Other Complex Matrices.</a> Journal of the American Chemical Society. 131, 6955-6957 (2009).</li><li>Baker, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Electronic,+Aptamer-Based+Small-Molecule+Sensor+for+the+Rapid,+Label-Free+Detection+of+Cocaine+in+Adulterated+Samples+and+Biological+Fluids.">An Electronic, Aptamer-Based Small-Molecule Sensor for the Rapid, Label-Free Detection of Cocaine in Adulterated Samples and Biological Fluids.</a> Journal of the American Chemical Society. 128, 3138-3139 (2006).</li><li>Ferapontova, E. E., Olsen, E. M., Gothelf, K. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA+Aptamer-Based+Electrochemical+Biosensor+for+Detection+of+Theophylline+in+Serum.">An RNA Aptamer-Based Electrochemical Biosensor for Detection of Theophylline in Serum.</a> Journal of the American Chemical Society. 130, 4256-4258 (2008).</li><li>Stojanovic, M. N., Landry, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Colorimetric+Probe+for+Cocaine.">Aptamer-Based Colorimetric Probe for Cocaine.</a> Journal of the American Chemical Society. 124, 9678-9679 (2002).</li><li>Stojanovic, M. N., Prada, P. d. e., Landry, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Folding+Fluorescent+Sensor+for+Cocaine.">Aptamer-Based Folding Fluorescent Sensor for Cocaine.</a> Journal of the American Chemical Society. 123, 4928-4931 (2001).</li><li>Cash, K. J., Heeger, A. J., Plaxco, K. W., Xiao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+a+Reusable,+DNA+Pseudoknot-Based+Electrochemical+Sensor+for+Sequence-Specific+DNA+Detection+in+Blood+Serum.">Optimization of a Reusable, DNA Pseudoknot-Based Electrochemical Sensor for Sequence-Specific DNA Detection in Blood Serum.</a> Analytical Chemistry. 81, 656-661 (2009).</li><li>Xiao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Electrochemical+Sensor+for+Single+Nucleotide+Polymorphism+Detection+in+Serum+Based+on+a+Triple-Stem+DNA+Probe.">An Electrochemical Sensor for Single Nucleotide Polymorphism Detection in Serum Based on a Triple-Stem DNA Probe.</a> Journal of the American Chemical Society. 131, 15311-15316 (2009).</li><li>Zuo, X., Xiao, Y., Plaxco, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Specificity,+Electrochemical+Sandwich+Assays+Based+on+Single+Aptamer+Sequences+and+Suitable+for+the+Direct+Detection+of+Small-Molecule+Targets+in+Blood+and+Other+Complex+Matrices.">High Specificity, Electrochemical Sandwich Assays Based on Single Aptamer Sequences and Suitable for the Direct Detection of Small-Molecule Targets in Blood and Other Complex Matrices.</a> Journal of the American Chemical Society. 131, 6944-6945 (2009).</li><li>Xia, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Electrochemical+Supersandwich+Assay+for+Sensitive+and+Selective+DNA+Detection+in+Complex+Matrices.">An Electrochemical Supersandwich Assay for Sensitive and Selective DNA Detection in Complex Matrices.</a> Journal of the American Chemical Society. 132, 14346-14348 (2010).</li><li>Patterson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+Triplex-Forming+Oligonucleotide+Probes+for+the+Reagentless,+Electrochemical+Detection+of+Double-Stranded+DNA.">Using Triplex-Forming Oligonucleotide Probes for the Reagentless, Electrochemical Detection of Double-Stranded DNA.</a> Analytical Chemistry. 82, 9109-9115 (2010).</li><li>Ferguson, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+Microfluidic+Electrochemical+DNA+Sensor.">Integrated Microfluidic Electrochemical DNA Sensor.</a> Analytical Chemistry. 81, 6503-6508 (2009).</li><li>Swensen, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous,+Real-Time+Monitoring+of+Cocaine+in+Undiluted+Blood+Serum+via+a+Microfluidic,+Electrochemical+Aptamer-Based+Sensor.">Continuous, Real-Time Monitoring of Cocaine in Undiluted Blood Serum via a Microfluidic, Electrochemical Aptamer-Based Sensor.</a> Journal of the American Chemical Society. 131, 4262-4266 (2009).</li></ol>

중요 사항은 전극이 제대로 청소되지 않는 한 위에서 설명한 실험 중 누구도 제대로 작동하지 않습니다이다. 다음은 전기 청소 절차에 대한 안내입니다. CH 인스 트루먼 트의 potentiostats 작업을하면, 우리는 세 가지 매크로 프로그램의 집합을 사용하여 이러한 청소 단계를 실행합니다. 차 제로 (E - 깨끗한 O) 0.5MH 2 SO 4에 전극을 담가와 potentiostat의 작업 전극에 연결합니다. 또한 자세 / AgCl 기준 및 플래티넘 카운터 전극을 부착하고 몰두. 다음 산화 단계 (5 S 2 V)와 감소 단계 (10 s에 대한 0.35 V)로 시작합니다. 페이즈 원 (E - 깨끗한 1) 0.35-1.5 V (스캔 속도에서 4 스캔 다음 20 V / S 4의 스캔 속도로 스캔과 0.01 V의 샘플 간격에서 같은 산성 조건 (0.5MH 2 SO 4) 아래의 산화 및 환원 검사를 개시 0.1 V / s와 0.01 V의 샘플 간격). 페이즈 투 (E - 깨끗한 2) 네 가지 잠재적인 범위 (모든 0.1 V S 1 스캔 속도와 0.01 V의 샘플 간격 10 세그먼트에 대한 수행을 통해 산성 조건 (0.01 M KCl/0.1 MH 2 SO 4) 아래의 전기 산화와 환원 스캔의 다른 세트를 실시 ) : 0.2에서 0.75 V로 (I) 잠재적인 범위, 0.2에서 1.0 V로 (2) 잠재적인 범위, 0.2에서 1.25 V로 (3) 잠재적인 범위, 0.2에서 1.5 (4) 잠재적인 범위 V. 금 전극의 많은 종류의 이러한 실험을 수행하는 데 사용할 수 있습니다. 이러한 여기에 사용된 것과 같은 골드 디스크 전극 이외에도, 우리는 microfabricated 금 표면, 골드 와이어, 및 인쇄 회로 기판에 금을 성공을 있었다. 이 문서에서 설명하는 센서와 함께 다른 많은 전기의 DNA 바이오 센서 구조가보고되었습니다. 이것은 pseudoknot 12 센서, 트리플 좌초 13, 샌드위치 14, 슈퍼 샌드위치 15, 또는 트리플 16 아키텍처를 포함하고 있습니다. 앞으로 우리는 이러한 센서는 의료 의료 진단 시점에 사용될 것으로 기대합니다. 그들은 성공적으로 여러 microfluidic 장치 17,18 통합, 광학 analyte 검출 시스템에 비해 많은 장점을 제공하고 있습니다. 특히,이 센서는 광학 밀도와 높은 자동 형광 샘플, 흐린에서 기능하실 수 있습니다.

<table border="1"><tbody><tr><th> 시약의 이름 </th><th> 회사 </th><th> 카탈로그 번호 </th><th> 댓글 (옵션) </th></tr><tr><td> 골드 디스크 전극 </td><td> CH 인 스트 루먼트 </td><td> CHI101 </td><td> 다시 사용할 수 있습니다 </td></tr><tr><td> 합성 프로브 DNA </td><td> Biosearch 기술 </td><td> 사용자 정의 </td><td></td></tr><tr><td> 합성 타겟 DNA </td><td> 시그마 Genosys </td><td> 사용자 정의 </td><td></td></tr><tr><td> Mercaptohexanol </td><td> 시그마 알드리치 </td><td> 725226 - 1G </td><td> 시원하고 어두운 장소에 저장 </td></tr><tr><td> 플래티넘 전극 </td><td> BASi </td><td> MW - 1032 </td><td> 다시 사용할 수 있습니다 </td></tr><tr><td> AG / AgCl 참조 </td><td> BASi </td><td> MF - 2052 </td><td> 다시 사용할 수 있습니다 </td></tr><tr><td> 천을 연마 </td><td> 뷸러 </td><td> 40-7212 </td><td></td></tr><tr><td> 알루미나 폴란드어 </td><td> 뷸러 </td><td> 40-6325-016 </td><td></td></tr><tr><td> 인산은 생리 버퍼, pH를 7.4 버퍼 </td><td> 시그마 알드리치 </td><td> P7059 - 1L </td><td></td></tr><tr><td> CH 악기 605A </td><td> CH 인 스트 루먼트 </td><td> 605A </td><td> 모든 potentiostat를 사용하여 </td></tr><tr><td> 신생아 카프 세럼 </td><td> 시그마 알드리치 </td><td> N4637 - 500ML </td><td> 냉동 저장 </td></tr><tr><td> NanoDrop </td><td> 피셔 사이 언티픽 </td><td> ND - 2000 </td><td> 모든 UV - 비스를 사용하여 </td></tr><tr><td> PCR 믹스 </td><td> 바이오 래드 </td><td> 170-8862 </td><td> 냉동 저장 </td></tr><tr><td> 코카인 </td><td> 시그마 알드리치 </td><td> C5776 </td><td> DEA 라이센스가 필요합니다 </td></tr><tr><td> Procaine </td><td> 시그마 알드리치 </td><td> P9879 </td><td> 코카인에 대한 대체 </td></tr><tr><td> 안티 플라그 항체 </td><td> 시그마 알드리치 </td><td> F1804 - 1mg </td><td></td></tr></tbody></table>

fabrication of electrochemical-dna biosensors for the reagentless detection of nucleic acids, proteins and small molecules

의약품 현재 연습이기 때문에, 의사는 테스트를 위해 중앙 실험실 표본을 보내 따라서 결과를받을 수 시간 또는 일 기다려야합니다. 많은 환자가 더 빠른, 머리맡 검사에 의해 제공됩니다. 이를 위해 우리 실험실과 다른 핵산 (DNA, RNA), 단백질 (항체 포함) 및 직접 처리되지 않은 임상 및 환경 시료의 작은 분자의 analytes의 양적, reagentless, 전기 감지를 지원하는 다재 다능한, reagentless 바이오 센서 플랫폼을 개발했습니다. 이 비디오에서는, 우리는이 &quot;E - DNA&quot;수업 시간에 여러 biosensors의 준비와 사용을 보여줍니다. 특히, 우리는 조작 및 중합 효소의 연쇄 반응 혼합물, HIV - 특정 항체와 마약 코카인의 목표 DNA 시퀀스의 감지를위한 센서를 보여줍니다. 준비 절차는 -에 손을 하룻밤 배양 뒤에 노력의 단지 세 시간이 필요하고, 그들의 사용은 분이 필요합니다.

Watch this Scientific Journal Video about Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules at JoVE.com

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

&quot;E - DNA&quot;센서는 reagentless, 혈액 및 기타 복잡한 매트릭스에서 직접 도전 경우에도 실적이 전기 biosensors은 핵산, 단백질과 작은 분자 analytes 다양한 범위의 감지 적응되었습니다. 여기에는 센서의 제조 및 사용에 대한 일반적인 절차를 제시한다.

핵산, 단백질과 작은 분자의 Reagentless 감지를위한 전기 -의 DNA Biosensors의 제작

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

fabrication-electrochemical-dna-biosensors-for-reagentless-detection

Research

JoVE Journal

Bioengineering

33.2K 조회수.  University Of California Santa Barbara. "E - DNA"센서는 reagentless, 혈액 및 기타 복잡한 매트릭스에서 직접 도전 경우에도 실적이 전기 biosensors은 핵산, 단백질과 작은 분자 analytes 다양한 범위의 감지 적응되었습니다. 여기에는 센서의 제조 및 사용에 대한 일반적인 절차를 제시한다.

비디오: Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

On-chip Isotachophoresis for Separation of Ions and Purification of Nucleic Acids

Electrokinetic techniques are a staple of microscale applications because of their unique ability to perform a variety of fluidic and electrophoretic processes in simple, compact systems with no moving parts. Isotachophoresis (ITP) is a simple and very robust electrokinetic technique that can achieve million-fold preconcentration1,2 and efficient separation and extraction based on ionic mobility.3 For example, we have demonstrated the application of ITP to separation and sensitive detection of unlabeled ionic molecules (e.g. toxins, DNA, rRNA, miRNA) with little or no sample preparation4-8 and to extraction and purification of nucleic acids from complex matrices including cell culture, urine, and blood.9-12
ITP achieves focusing and separation using an applied electric field and two buffers within a fluidic channel system. For anionic analytes, the leading electrolyte (LE) buffer is chosen such that its anions have higher effective electrophoretic mobility than the anions of the trailing electrolyte (TE) buffer (Effective mobility describes the observable drift velocity of an ion and takes into account the ionization state of the ion, as described in detail by Persat et al.13). After establishing an interface between the TE and LE, an electric field is applied such that LE ions move away from the region occupied by TE ions. Sample ions of intermediate effective mobility race ahead of TE ions but cannot overtake LE ions, and so they focus at the LE-TE interface (hereafter called the "ITP interface"). Further, the TE and LE form regions of respectively low and high conductivity, which establish a steep electric field gradient at the ITP interface. This field gradient preconcentrates sample species as they focus. Proper choice of TE and LE results in focusing and purification of target species from other non-focused species and, eventually, separation and segregation of sample species.
We here review the physical principles underlying ITP and discuss two standard modes of operation: "peak" and "plateau" modes. In peak mode, relatively dilute sample ions focus together within overlapping narrow peaks at the ITP interface. In plateau mode, more abundant sample ions reach a steady-state concentration and segregate into adjoining plateau-like zones ordered by their effective mobility. Peak and plateau modes arise out of the same underlying physics, but represent distinct regimes differentiated by the initial analyte concentration and/or the amount of time allotted for sample accumulation.
We first describe in detail a model peak mode experiment and then demonstrate a peak mode assay for the extraction of nucleic acids from E. coli cell culture. We conclude by presenting a plateau mode assay, where we use a non-focusing tracer (NFT) species to visualize the separation and perform quantitation of amino acids.

Isotachophoresis (ITP) is a robust electrokinetic separation and preconcentration technique with applications ranging from toxin detection to sample preparation. We review the physical principles of ITP and the methodology of applying this technique to two specific example applications: separation and detection of small molecules and purification of nucleic acids from cell culture lysate.

이온의 분리 및 핵산의 정화를위한 온칩 Isotachophoresis

Electrokinetic techniques are a staple of microscale applications because of their unique ability to perform a variety of fluidic and electrophoretic ...

연구

생체공학

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a model microorganism. The biosensor relies on direct binding of the target bacteria cells onto its surface, while no pretreatment (e.g.&#160;by cell lysis) of the studied sample is required. A mesoporous Si thin film is used as the optical transducer element of the biosensor. Under white light illumination, the porous layer displays well-resolved Fabry-P&#233;rot fringe patterns in its reflectivity spectrum. Applying a fast Fourier transform (FFT) to reflectivity data results in a single peak. Changes in the intensity of the FFT peak are monitored. Thus, target bacteria capture onto the biosensor surface, through antibody-antigen interactions, induces measurable changes in the intensity of the FFT peaks, allowing for a &#39;real time&#39; observation of bacteria attachment.
The mesoporous Si film, fabricated by an electrochemical anodization process, is conjugated with monoclonal antibodies, specific to the target bacteria. The immobilization, immunoactivity and specificity of the antibodies are confirmed by fluorescent labeling experiments. Once the biosensor is exposed to the target bacteria, the cells are directly captured onto the antibody-modified porous Si surface. These specific capturing events result in intensity changes in the thin-film optical interference spectrum of the biosensor. We demonstrate that these biosensors can detect relatively low bacteria concentrations (detection limit of 104 cells/ml) in less than an hour.

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor for rapid bacteria detection is introduced. The biosensor is based on a nanostructured porous Si, which is designed to directly capture the target bacteria cells onto its surface. We use monoclonal antibodies, immobilized onto the porous transducer, as the capture probes. Our studies demonstrate the applicability of these biosensors for the detection of low bacterial concentrations within minutes with no prior sample processing (such as cell lysis).

의 광학 검출<em&gt; E. 대장균</em메조 포러스 실리콘 바이오 센서에 의해&gt; 박테리아

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a ...

Bead Aggregation Assays for the Characterization of Putative Cell Adhesion Molecules

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions for many of these proteins are poorly understood. Here we present a simple, rapid method for characterizing the adhesive properties of putative homophilic cell adhesion molecules. Cultured HEK293 cells are transfected with DNA plasmid encoding a secreted, epitope-tagged ectodomain of a cell surface protein. Using functionalized beads specific for the epitope tag, the soluble, secreted fusion protein is captured from the culture medium. The coated beads can then be used directly in bead aggregation assays or in fluorescent bead sorting assays to test for homophilic adhesion. If desired, mutagenesis can then be used to elucidate the specific amino acids or domains required for adhesion. This assay requires only small amounts of expressed protein, does not require the production of stable cell lines, and can be accomplished in 4 days.

Here we present a simple, rapid method for characterizing the intrinsic adhesive properties of putative cell adhesion molecules. The secreted, epitope-tagged ectodomain of a cell adhesion molecule is captured from the culture medium on small, uniform functionalized beads. These beads can then be used immediately in simple bead aggregation assays.

상상 속의 세포 부착 분자의 특성에 대한 비드 집계 분석 실험

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions ...

Design and Fabrication of an Elastomeric Unit for Soft Modular Robots in Minimally Invasive Surgery

In recent years, soft robotics technologies have aroused increasing interest in the medical field due to their intrinsically safe interaction in unstructured environments. At the same time, new procedures and techniques have been developed to reduce the invasiveness of surgical operations. Minimally Invasive Surgery (MIS) has been successfully employed for abdominal interventions, however standard MIS procedures are mainly based on rigid or semi-rigid tools that limit the dexterity of the clinician. This paper presents a soft and high dexterous manipulator for MIS. The manipulator was inspired by the biological capabilities of the octopus arm, and is designed with a modular approach. Each module presents the same functional characteristics, thus achieving high dexterity and versatility when more modules are integrated. The paper details the design, fabrication process and the materials necessary for the development of a single unit, which is fabricated by casting silicone inside specific molds. The result consists in an elastomeric cylinder including three flexible pneumatic actuators that enable elongation and omni-directional bending of the unit. An external braided sheath improves the motion of the module. In the center of each module a granular jamming-based mechanism varies the stiffness of the structure during the tasks. Tests demonstrate that the module is able to bend up to 120&#176; and to elongate up to 66% of the initial length. The module generates a maximum force of 47 N, and its stiffness can increase up to 36%.

This paper describes the design and fabrication of a soft unit for surgical manipulators. The base module includes three flexible fluidic actuators to achieve omnidirectional bending and elongation, and a granular jamming-based mechanism to enable stiffness control. A complete mechanical characterization is also reported.

디자인과 소프트 모듈 형 로봇의 탄성 장치의 제작 최소 침습 수술

In recent years, soft robotics technologies have aroused increasing interest in the medical field due to their intrinsically safe interaction in ...

Delivery of Proteins, Peptides or Cell-impermeable Small Molecules into Live Cells by Incubation with the Endosomolytic Reagent dfTAT

Macromolecular delivery strategies typically utilize the endocytic pathway as a route of cellular entry. However, endosomal entrapment severely limits the efficiency with which macromolecules penetrate the cytosolic space of cells. Recently, we have circumvented this problem by identifying the reagent dfTAT, a disulfide bond dimer of the peptide TAT labeled with the fluorophore tetramethylrhodamine. We have generated a fluorescently labeled dimer of the prototypical cell-penetrating peptide (CPP) TAT, dfTAT, which penetrates live cells and reaches the cytosolic space of cells with a particularly high efficiency. Cytosolic delivery of dfTAT is achieved in multiple cell lines, including primary cells. Moreover, delivery does not noticeably impact cell viability, proliferation or gene expression. dfTAT can deliver small molecules, peptides, antibodies, biologically active enzymes and a transcription factor. In this report, we describe the protocols involved in dfTAT synthesis and cellular delivery. The manuscript describes how to control the amount of protein delivered to the cytosolic space of cells by varying the amount of protein administered extracellularly. Finally, the current limitations of this new technology and steps involved in validating delivery are discussed. The described protocols should be extremely useful for cell-based assays as well as for the ex vivo manipulation and reprogramming of cells.

We describe how to deliver proteins and cell-impermeable small molecules into cultured mammalian cells by a simple co-incubation protocol with a reagent that causes endocytic organelles to become leaky.

Endosomolytic 시약 dfTAT와 배양 라이브 세포에 단백질, 펩타이드 또는 세포 투과성 작은 ​​분자의 배달

Macromolecular delivery strategies typically utilize the endocytic pathway as a route of cellular entry. However, endosomal entrapment severely limits the ...

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, significantly affecting the rate of human mortality and morbidity. Conventional methods for the detection of V. parahaemolyticus such as culture-based methods, immunological assays, and molecular-based methods require complicated sample handling and are time-consuming, tedious, and costly. Recently, biosensors have proven to be a promising and comprehensive detection method with the advantages of fast detection, cost-effectiveness, and practicality. This research focuses on developing a rapid method of detecting V. parahaemolyticus with high selectivity and sensitivity using the principles of DNA hybridization. In the work, characterization of synthesized polylactic acid-stabilized gold nanoparticles (PLA-AuNPs) was achieved using X-ray Diffraction (XRD), Ultraviolet-visible Spectroscopy (UV-Vis), Transmission Electron Microscopy (TEM), Field-emission Scanning Electron Microscopy (FESEM), and Cyclic Voltammetry (CV). We also carried out further testing of stability, sensitivity, and reproducibility of the PLA-AuNPs. We found that the PLA-AuNPs formed a sound structure of stabilized nanoparticles in aqueous solution. We also observed that the sensitivity improved as a result of the smaller charge transfer resistance (Rct) value and an increase of active surface area (0.41 cm2). The development of our DNA biosensor was based on modification of a screen-printed carbon electrode (SPCE) with PLA-AuNPs and using methylene blue (MB) as the redox indicator. We assessed the immobilization and hybridization events by differential pulse voltammetry (DPV). We found that complementary, non-complementary, and mismatched oligonucleotides were specifically distinguished by the fabricated biosensor. It also showed reliably sensitive detection in cross-reactivity studies against various food-borne pathogens and in the identification of V. parahaemolyticus in fresh cockles.

A protocol for the development of an electrochemical DNA biosensor comprising a polylactic acid-stabilized, gold nanoparticles-modified, screen-printed carbon electrode to detect Vibrio parahaemolyticus is presented.

Foodborne 병원 체를 검출 하는 전기 화학 DNA 바이오 센서의 개발

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, ...

Visual Detection of Multiple Nucleic Acids in a Capillary Array

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently needed in disease diagnosis, microbial monitoring, genetically modified organism (GMO) detection, and forensic analysis. We have previously described the platform called CALM (Capillary Array-based Loop-mediated isothermal amplification for Multiplex visual detection of nucleic acids). Herein, we describe improved fabrication and performance processes for this platform. Here, we apply a small, ready-to-use cassette assembled by capillary array for multiplex visual detection of nucleic acids. The capillary array is pre-treated into a hydrophobic and hydrophilic pattern before fixing loop-mediated isothermal amplification (LAMP) primer sets in capillaries. After assembly of the loading adaptor, LAMP reaction mixture is loaded and isolated into each capillary, due to capillary force by a single pipetting step. The LAMP reactions are performed in parallel in the capillaries. The results are visually read out by illumination with a hand-held UV flashlight. Using this platform, we demonstrate monitoring of 8 frequently appearing elements and genes in GMO samples with high specificity and sensitivity. In summary, the platform described herein is intended to facilitate the detection of multiple nucleic acids. We believe it will be widely applicable in fields where high-throughput nucleic acid analysis is required.

This protocol describes the fabrication of a small, ready-to-use cassette that can be applied for visual detection of multiple nucleic acids in a single, test that is easy to operate. In this approach, a capillary array was used for multiplex and highly efficient detection of GMO targets.

모 세관 배열에 여러 개의 핵 산의 비주얼 검색

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently ...

Development of Microfluidic Devices to Study the Elongation Capability of Tip-growing Plant Cells in Extremely Small Spaces

In vivo, tip-growing plant cells need to overcome a series of physical barriers; however, researchers lack the methodology to visualize cellular behavior in such restrictive conditions. To address this issue, we have developed growth chambers for tip-growing plant cells that contain a series of narrow, micro-fabricated gaps (~1 &#181;m) in a poly-dimethylsiloxane (PDMS) substrate. This transparent material allows the user to monitor tip elongation processes in individual cells during microgap penetration by time-lapse imaging. Using this experimental platform, we observed morphological changes in pollen tubes as they penetrated the microgap. We captured the dynamic changes in the shape of a fluorescently labeled vegetative nucleus and sperm cells in a pollen tube during this process. Furthermore, we demonstrated the capability of root hairs and moss protonemata to penetrate the 1 &#181;m gap. This in vitro platform can be used to study how individual cells respond to physically constrained spaces and may provide insights into tip-growth mechanisms.

We describe a method to investigate the capability of tip-growing plant cells, including pollen tubes, root hairs, and moss protonemata, to elongate through extremely narrow gaps (~1 &#181;m) in a microfluidic device.

매우 작은 공간에 팁 성장 하는 식물 세포의 신장 기능 연구를 미세 장치 개발

In vivo, tip-growing plant cells need to overcome a series of physical barriers; however, researchers lack the methodology to visualize cellular behavior ...

Fabrication of Decellularized Cartilage-derived Matrix Scaffolds

Osteochondral defects lack sufficient intrinsic repair capacity to regenerate functionally sound bone and cartilage tissue. To this extent, cartilage research has focused on the development of regenerative scaffolds. This article describes the development of scaffolds that are completely derived from natural cartilage extracellular matrix, coming from an equine donor. Potential applications of the scaffolds include producing allografts for cartilage repair, serving as a scaffold for osteochondral tissue engineering, and providing in vitro models to study tissue formation. By decellularizing the tissue, the donor cells are removed, but many of the natural bioactive cues are thought to be retained. The main advantage of using such a natural scaffold in comparison to a synthetically produced scaffold is that no further functionalization of polymers is required to drive osteochondral tissue regeneration. The cartilage-derived matrix scaffolds can be used for bone and cartilage tissue regeneration in both in vivo and in vitro settings.

Decellularized cartilage-derived scaffolds can be used as a scaffold to guide cartilage repair and as a means to regenerate osteochondral tissue. This paper describes the decellularization process in detail and provides suggestions to use these scaffolds in in vitro settings.

Decellularized 연골 파생 매트릭스 건설 기계 제조

Osteochondral defects lack sufficient intrinsic repair capacity to regenerate functionally sound bone and cartilage tissue. To this extent, cartilage ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

장기간 무세포 유전자 발현의 전도를 위한 다층 미세유체 플랫폼

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...