본 연구는 한국 연구 재단에서 보조금 (2013R1A1A3005669)와 한국 보건 기술의 R &amp; D 사업, 보건 복지부의 허가 (HI13C0016)에 의해 지원되었다.

1. 프로브 준비 <ol><li> 프로브의 PCR 증폭 <ol><li> 피하십시오 gingivalis에 특이적인 프로브는, P.의 343 bp의 DNA 단편을 증폭 P.의 게놈 DNA를 사용하여 PCR에 의해 16S rRNA를 진지 발리 진지 발리 다음 프라이머 : 5&#39;-TGC AAC TTG CCT TAC AGA GG-3 &#39;과 5&#39;-ACT GCC CGT CGT ATC TAT TC-3&#39;10. 다음 사이클 조건 증폭을 수행 35주기를 95 ℃에서 30 초, 30 초, 60 ° C, 72 °에서 5 분 연장 한 다음 1 분 20 초 72 ° C C (10, 11)에 대해. </li><li> 70 bp의 DNA 절편 (5&#39;-CAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAG를 사용하여 프로브를 증폭 eubacterial TCCCGCAACGAGCGCAACCC-3 &#39;올리고 뉴클레오티드 프라이머를 다음과 같이 합성) : 5&#39;-CAG CTG GTR GGY CMT-3&#39;11 5&#39;-AGG GCG GTT GTT CTC-3. 다음 사이클 조건을 증폭를 수행 : 40주기를30 초 30 초 9 4 ℃, 60 ℃, 1 분 72 ℃에서 11, 12에서 5 분 연장 한 다음 20 초 동안 72 ° C에서. </li><li> 2 시간 동안 -20 ° C에서 배양 한 3 M 아세트산 나트륨 (PH 5.2) 및 (: 1의 비율이 10에서) 100 % 에탄올을 첨가하여 PCR 제품 (≥500 μL)을 침전. </li><li> 원심 혼합물을 15 분 동안 14,000 XG에, TE 완충액 100 ㎕에 펠렛을 재현 탁하고 260 nm에서 흡광도에 의해 DNA 농도를 측정한다. </li></ol></li><li> DIG DNA 표지 및 검출 키트를 사용하여 DIG는-라벨 <ol><li> 15 μL의 최종 부피 물로 프로브 3㎍을 섞는다. </li><li> 10 분 동안 95 ° C에서 DNA 변성 빨리 얼음에 진정. </li><li> 10 배 hexanucleotide 믹스 2 μL,의 dNTP - 라벨 믹스 2 μL 및 변성 된 DNA의 15 μL에 클레 나우 효소 1 μl를 추가합니다. </li><li> 혼합하고 48 시간에 24 시간 동안 37 ℃에서 배양하고 65 ℃에서 가열하여 반응을 중지합니다. </li></ol></li><li> DIG DNA 라벨링 및 검출 키트를 사용하여 DIG 표지 된 프로브의 민감도를 확인 <ol><li> 수동 RT에서 5 분간 키트에 양성 대조군 프로브의 희석액 1 μL 및 나일론 막에 DIG 표지 된 프로브의 1 NG 건조로드. </li><li> 간단히 배 SSC 버퍼 (0.3 M의 NaCl, 30 mM의 시트르산 나트륨, pH를 7.0)에 담가 멤브레인 DNA 고정화, 1 시간 동안 80 ° C에서 배양 한 멤브레인. </li><li> 간단히 말레 산 버퍼 (MAB, 0.1 M 말레 산, 0.15 M의 NaCl, pH를 7.5)를 막 담가 및 안티 DIG 알칼리 포스 파타 아제 컨쥬 게이트 항체를 희석 (AP)와 함께 품어 : 제공된 차단 솔루션의 6 ml의 (1 5,000) 실온에서 30 분 동안 키트. </li><li> MABT (MAB 1 % 트윈 20을 포함)와 멤브레인을 씻고 상에 2 ml의 검출 버퍼 (0.1 M 트리스 - 염산, 0.1 M의 NaCl, 0.05 M의 MgCl 2, pH를 9.5)와 혼합 NBT / BCIP 용액 40 μl를 적용 1 분 동안 막. 표지 된 프로브의 감도이면만족하지, 1.1.3에서 1.3.4로 단계를 반복합니다. </li><li> 표지 프로브 (OD260)의 DNA 농도를 측정 ng를 100 μL의 농도를 조정 -1. </li></ol></li><li> DIG 표지 프로브의 특이성을 확인 <ol><li> 게놈 DNA 샘플을 변성 10 분 동안 95 ° C에서, 특정 프로브의 대상이 박테리아 등 다양한 박테리아 종에서 (25 세 μL -1 각 샘플 당을 ng를) 빠르게 얼음에 진정. </li><li> 수동으로 실온에서 20 분 동안 변성 나일론 막에 DNA와 건조를로드합니다. </li><li> 간단히 배 SSC 버퍼 막을 담가 DNA 고정화 2 시간 동안 80 ° C에서 배양 한 멤브레인. </li><li> 1 시간 동안 실온에서 차단 용액으로 차단 막. </li><li> 혼성화 완충액에 희석 된 프로브를 변성하고, 막에 적용 μL -1 1 NG에 프로브를 희석. </li><li> 1 시간 동안 45 ° C에서 막을 인큐베이션. </li><li> 멤브레인을 씻으 세배 SSC 버퍼와 시간. </li><li> 간단히 MAB에 담가 멤브레인. </li><li> 1 시간 동안 실온에서 차단 용액 6 ㎖에 (000 1) 희석 항 DIG AP 공역 항체와 인큐베이션. </li><li> MABT으로 막을 세척하고 2 ml의 검출 버퍼와 혼합 NBT / BCIP 용액 40 μl를 적용합니다. </li><li> 프로브는 특이성을 달성 할 것으로 예상되지 않을 때 특이성이 관찰 될 때까지, 혼성화 온도를 증가시킨다. </li></ol></li></ol> 현장 하이브리드 2. 참고 : 시료 및 시약의 건조를 방지 젖은 종이 타월로 줄 지어 가습 실에있는 모든 배양을 수행 할 수 있습니다. <ol><li> 탈 paraffinization와 조직 절편의 재수 <ol><li> 파라핀 블록에서 4 μm의 두께 조직 섹션을 준비합니다. 포르말린, 파라 포름 알데히드, 아연 기반의 정착이 프로토콜과 호환됩니다. </li><li> DEPC 처리 된 물을 사용하는 모든 시약을 준비합니다. </li><li> 30 분 동안 60 ° C에서 건조 오븐에서 열 슬라이드와 30 분 동안 RT에서 슬라이드를 배양. </li><li> 5 분 3 회 100 % 크실렌 슬라이드 담가; 신선한 크실렌 때마다 사용합니다. 참고 : 화학 물질 흄 후드이 드 왁싱 절차를 수행합니다. </li><li> 회 5 분 동안 100 % 에탄올에 담가 슬라이드마다 신선한 에탄올을 사용하고, 5 분마다 90 %에서 일련의 시편, 80 % 및 70 % 에탄올 용액을 재수. </li><li> 1 분 동안 DEPC 처리 된 물에 슬라이드를 담그고 6 분 동안 DEPC 처리 된 PBS (PH 7.4)에 슬라이드를 씻으십시오. </li></ol></li><li> 조직 절편의 전처리 <ol><li> 20 분 동안 0.1 N 염산에 슬라이드를 담그고 30 초 동안 DEPC 처리 된 물에 슬라이드를 씻으십시오. </li><li> 왁스 펜을 사용하여 표본을 둘러싼 소수성 장벽을 그립니다. 참고 : 소수성 장벽의 크기는 표본의 크기에 따라 달라집니다. 따라서, 다음 단계에 사용되는 시약의 양을 시료의 크기에 의존하지만 HY을 작성할 필요가 달라drophobic 장벽 (작은 시편 50 μL 큰 시편 400 μL). </li><li> 30 분 동안 37 ℃에서 건조 오븐에서 단백질 분해 효소 K (1 ~ 10 μg의 ml의 -1 DEPC 처리 된 PBS에)의 50-400 μL로 표본을 치료하고 1 분 동안 DEPC 처리 1X PBS에서 슬라이드를 씻으십시오. </li><li> 10 분 동안 DEPC 처리 된 PBS에 4 % 파라 포름 알데히드에 슬라이드를 만끽 한 후 1 분 동안 DEPC 처리 된 PBS에 슬라이드를 씻으십시오. </li><li> 0.1 M 트리에탄올 아민 염산 20 분 동안 0.5 % 무수 초산을 포함하는 (PH 8.0)에 슬라이드를 담가 30 초 동안 DEPC 처리 된 물에 슬라이드를 씻으십시오. </li></ol></li><li> 프로브 및 세척과 교잡 <ol><li> 20 분 동안 2 배 SSC 버퍼에 슬라이드를 담가. </li><li> 혼성화 완충액 μL -1 1 NG (4X SSC에서 프로브 희석 50 % [의 부피 / 부피] 포름 아미드, 1X 덴 하르트 용액, 10 % [중량 / 부피] 황산 덱스 트란, 0.1 % [중량 / 부피 나트륨 도데 실 설페이트, 0.4 mg을 ml의 -1 연어 정자 DNA). 음성 대조군의 경우와 표지 프로브를 혼합비 표지 프로브의 10 배 과량. </li><li> 희석 된 프로브를 변성 및 조직 섹션에 50-400 μl를 적용합니다. 슬라이드 커버 슬립을 놓고 매니큐어로 밀봉. </li><li> 45 ° C 또는 최적의 온도에서 가습 실 O / N에서 10 분 동안 90 ° C에서 PCR 기계에 열 슬라이드와 부화 슬라이드 단계 1.4.11에서 결정. </li><li> 30 분 동안 4 ℃에서 슬라이드 쿨 커버 슬립을 제거하고, 다음과 같은 일련 SSC 버퍼에 슬라이드 젖어 : 4X SSC를 10 분, 예열 된 (45 ℃) 2 × SSC를 위해 20 분 동안 2 배 SSC를 10 분 및 10 분 동안 0.2X SSC. </li></ol></li><li> 안티 DIG AP-복합 항체 검출 <ol><li> 5 분 동안 MABT에 슬라이드를 씻으십시오. </li><li> 20 분 동안 1 % 트윈 20 용액으로 블로킹 50~400 μL하는 블록. </li><li> 솔루션 (1 : 1,000) 차단에 희석 방지 DIG-AP 항체의 50-400 μl를 추가 anld 90 분 동안 37 ° C에서 품어. </li><li> 10 분 동안 MABT에 슬라이드를 씻으십시오. </li> &lt;리&gt; 5 분 동안 1 % 트윈 20을 함유하는 검출 버퍼에 슬라이드를 담근다. </li><li> μ 1 밀리미터의 levamisole의 내인성 알칼리 포스파타제를 실활 5 분간 (1 % 트윈 20을 함유하는 검출 버퍼) 50~400로 처리. </li><li> (1 검출 완충액에 희석 : 100) 예 혼합 NBT / BCIP 용액 50~400 μL 분배 각 시험편 상 및 개발 신호가 만족 될 때까지 2 내지 3 시간 동안 실온에서 습윤 챔버에서 슬라이드를 배양한다. </li><li> 시각화를 중지하고 10 분 동안 37 ° C에서 0.05 % 카운터 스테인 같이 중량 / 부피] 메틸 녹색의 50~400 μL를 적용하는 탈 이온수로 슬라이드를 씻어. </li><li> 100 % 에탄올 탈수, 탈 이온수와 슬라이드를 씻어, 자일 렌에 몰입. </li><li> 각각의 슬라이드에 장착 솔루션의 80 μl를 적용하고 커버 슬립 커버. </li></ol></li></ol>

<ol>
	<li>Takarada, H., Cattoni, M., Sugimoto, A., Rose, G. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+studies+of+human+gingiva.+II.+The+lower+part+of+the+pocket+epithelium+in+chronic+periodontitis.">Ultrastructural studies of human gingiva. II. The lower part of the pocket epithelium in chronic periodontitis.</a> J. Periodontol. 45 (3), 155-169 (1974).</li><li>Allenspach-Petrzilka, G. E., Guggenheim, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+invasion+of+the+periodontium;+an+important+factor+in+the+pathogenesis+of+periodontitis.">Bacterial invasion of the periodontium; an important factor in the pathogenesis of periodontitis.</a> J. Clin. Periodontol. 10 (6), 609-617 (1983).</li><li>Saglie, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+bacteria+in+the+oral+epithelium+in+periodontal+disease.+II.+Immunohistochemical+identification+of+bacteria.">The presence of bacteria in the oral epithelium in periodontal disease. II. Immunohistochemical identification of bacteria.</a> J. Periodontol. 57 (8), 492-500 (1986).</li><li>Christersson, L. A., Albini, B., Zambon, J. J., Wikesj&#246;, U. M., Genco, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+localization+of+Actinobacillus+actinomycetemcomitans.+in+human+periodontitis.+I.+Light,+immunofluorescence+and+electron+microscopic+studies.">Tissue localization of Actinobacillus actinomycetemcomitans. in human periodontitis. I. Light, immunofluorescence and electron microscopic studies.</a> J. Periodontol. 58 (8), 529-539 (1987).</li><li>Saglie, F. R., Pertuiset, J., Rezende, M. T., Nestor, M., Marfany, A., Cheng, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+correlative+immuno-identification+of+mononuclear+infiltrates+and+invasive+bacteria+in+diseased+gingiva.">In situ. correlative immuno-identification of mononuclear infiltrates and invasive bacteria in diseased gingiva.</a> J. Periodontol. 59 (10), 688-696 (1988).</li><li>Rautemaa, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Porphyromonas+gingivalis.+thiol+proteinase+in+periodontal+tissues+of+chronic+periodontitis+patients.">Intracellular localization of Porphyromonas gingivalis. thiol proteinase in periodontal tissues of chronic periodontitis patients.</a> Oral Dis. 10 (5), 298-305 (2004).</li><li>Marttila, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Treponema+denticola.+chymotrypsin-like+proteinase+in+chronic+periodontitis.">Intracellular localization of Treponema denticola. chymotrypsin-like proteinase in chronic periodontitis.</a> J. Oral Microbiol. 6, (2014).</li><li>Colombo, A. V., da Silva, C. M., Haffajee, A., Colombo, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+oral+species+within+human+crevicular+epithelial+cells+from+subjects+with+chronic+periodontitis+by+fluorescence+in+situ.+hybridization.">Identification of intracellular oral species within human crevicular epithelial cells from subjects with chronic periodontitis by fluorescence in situ. hybridization.</a> J. Periodontal Res. 42 (3), 236-243 (2007).</li><li>Abrams, K., Caton, J., Polson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histologic+comparisons+of+interproximal+gingival+tissues+related+to+the+presence+or+absence+of+bleeding.">Histologic comparisons of interproximal gingival tissues related to the presence or absence of bleeding.</a> J. Periodontol. 55 (11), 629-632 (1984).</li><li>Kim, Y. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presence+of+Porphyromonas+gingivalis.+and+plasma+cell+dominance+in+gingival+tissues+with+periodontitis.">Presence of Porphyromonas gingivalis. and plasma cell dominance in gingival tissues with periodontitis.</a> Oral Dis. 16 (4), 375-381 (2010).</li><li>Choi, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Porphyromonas+gingivalis.+and+dextran+sodium+sulfate+induce+periodontitis+through+the+disruption+of+physical+barriers.">Porphyromonas gingivalis. and dextran sodium sulfate induce periodontitis through the disruption of physical barriers.</a> Eur. J. Inflammation. 10, 419-431 (2013).</li><li>Choi, Y. S., Kim, Y. C., Ji, S., Choi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increased+bacterial+invasion+and+differential+expression+of+tight+junction+proteins,+growth+factors,+and+growth+factor+receptors+in+periodontal+lesions.">Increased bacterial invasion and differential expression of tight junction proteins, growth factors, and growth factor receptors in periodontal lesions.</a> J. Periodontol. 85 (8), e313-e322 (2014).</li><li>Baker, G. C., Smith, J. J., Cowan, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+and+re-analysis+of+domain-specific+16S+primers.">Review and re-analysis of domain-specific 16S primers.</a> J. Microbiol. Methods. 55 (3), 541-555 (2003).</li><li>Hajishengallis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Low-abundance+biofilm+species+orchestrates+inflammatory+periodontal+disease+through+the+commensal+microbiota+and+the+complement.">A Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and the complement.</a> Cell Host Microbe. 10 (5), 497-506 (2011).</li><li>Axon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastric+cancer+and+Helicobacter+pylori.">Gastric cancer and Helicobacter pylori.</a> Aliment. Pharmacol. Ther. 16 (suppl. 4), 83-88 (2002).</li><li>Fenhalls, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+detection+of+Mycobacterium+tuberculosis+transcripts+in+human+lung+granulomas+reveals+differential+gene+expression+in+necrotic+lesions.">In situ. detection of Mycobacterium tuberculosis transcripts in human lung granulomas reveals differential gene expression in necrotic lesions.</a> Infect. Immun. 70 (11), 6330-6338 (2002).</li></ol>

저자가 공개하는 게 없다.

여기서 프로토콜 설명 하였다 DIG 표지 된 DNA 프로브를 사용하는 파라핀 포매 조직 내의 박테리아를 지역화. 프로브는 세균 16S rRNA 유전자의 DNA 또는 RNA 분자를 표적으로하고, 16S rRNA의 타겟팅 프로브는 어느 종 특이 또는 범용으로 설계 될 수있다. (P)의 구체적인 하이브리드 경찰에 진지 발리 - 특정 프로브 진지 발리 아니라 다른 구강 박테리아는 이전에 (10)를 보였다. ...

박테리아는 치주염, 치수염, pericoronitis, 봉와직염, 골수염과 같은 다양한 구강 질환의 병인에 중요한 역할을한다. 질병의 발병 기전에서 세균의 역할을 이해하고 치료의 효과를 모니터링하기 위하여, 조직 내의 박테리아의 현지화 중요하다. 치주염 환자의 치은 조직 내의 박테리아의 존재는 fluorescence-를 사용하여 계내 혼성화 (FISH) 8 전자 현미경 1,2, 면역 조직 화학 및 면역 이용한 박테리아 특이 항체 3-7 및 형광체를 포함하여, 다양한 방법을 이용하여 도시 한 16S rRNA의 타겟팅 된 표지 된 올리고 뉴클레오티드 프로브. 그럼에도 불구하고, 이러한 방법은 널리 기술적 한계 나 어려움에 사용되지 않습니다. 항체와 비교하는 16s rRNA를 타겟팅 프로브 생산 종 특이성을 달성하기 쉽다. 물고기는 BACT의 시각화를위한 훌륭한 도구가 될 입증되었습니다이러한 플라크 바이오 필름 등의 자연 환경에서 eria. 그러나, 조직 샘플에 대한 FISH의 적용으로 인해 다양한 조직 성분의자가 형광에 한정된다. 그들은 9 출혈 것을 포함 할 때, 예를 들어, 적혈구의 강한 형광도는 종종 염증 조직으로 형광 기술의 적용을 방해. 염증 잇몸 조직 내의 박테리아를 지역화하기 위해, 따라서, 디곡 시게 닌을 사용하여 동일계에서 혼성화 방법 (DIG) 표지 된 DNA 프로브를 개발되었으며 10,11 성공적으로 적용 하였다. 피를 사용하여 파라핀 조직 내에서 박테리아의 현지화에 대한 다음은 상세한 프로토콜 진지 발리 - 특정 보편적 eubacterial 프로브는 설명 하였다. 이것은 특히 유사한 결과가 다른 실험실에서 재현 될 수 있도록하는 방법의 표준화에 집중된다. 이 프로토콜은 자신의 조직 학적 상황과 resu 내 박테리아의 현지화를 할 수 있습니다LTS는 높은 재현성 있습니다. 설명 프로토콜은 어느 다양한 조직에서 종 특이 또는 범용 방식 박테리아 지역화하는데 사용될 수있다. 범용 프로브는 polymicrobial 질환 박테리아를 검출하고 특정 박테리아의 역할을 알 수없는 경우 질병에 박테리아의 잠재적 인 역할을 연구하는 데 특히 유용합니다.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Acetic anhydride</td>
			<td>Sigma</td>
			<td>6404</td>
			<td></td>
		</tr>
		<tr>
			<td>50% Dextran sulfate solution</td>
			<td>Millipore</td>
			<td>S4030</td>
			<td></td>
		</tr>
		<tr>
			<td>50X Denhardt&#8217;s solution</td>
			<td>Sigma</td>
			<td>D2532</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC</td>
			<td>Sigma</td>
			<td>P159220</td>
			<td></td>
		</tr>
		<tr>
			<td>DIG DNA labeling and detection kit</td>
			<td>Roche</td>
			<td>11 093 657 910</td>
			<td></td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Sigma</td>
			<td>F9037</td>
			<td></td>
		</tr>
		<tr>
			<td>ImmEdge&#8482; Pen</td>
			<td>Dako</td>
			<td>H-400</td>
			<td></td>
		</tr>
		<tr>
			<td>Levamisole</td>
			<td>Vector</td>
			<td>SP-5000</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Sigma</td>
			<td>246964</td>
			<td></td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Sigma</td>
			<td>M0375</td>
			<td></td>
		</tr>
		<tr>
			<td>Methyl green</td>
			<td>Sigma</td>
			<td>M6776</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma</td>
			<td>P1648</td>
			<td></td>
		</tr>
		<tr>
			<td>Permount</td>
			<td>Fisher</td>
			<td>SP15-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Salmon sperm DNA solution</td>
			<td>Invitrogen</td>
			<td>#15632-011</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma</td>
			<td>S9625</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium citrate</td>
			<td>Duksan</td>
			<td>D1420</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate</td>
			<td>Amresco</td>
			<td>227</td>
			<td></td>
		</tr>
		<tr>
			<td>Triethanolamine-HCl</td>
			<td>Sigma</td>
			<td>90279</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Research organics</td>
			<td>3098T</td>
			<td></td>
		</tr>
	</tbody>
</table>

in situ detection of bacteria within paraffin-embedded tissues using a digoxin-labeled dna probe targeting 16s rrna

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been reported using various methods, including electron microscopy, immunohistochemistry or immunofluorescence using bacteria-specific antibodies, and fluorescent in situ hybridization (FISH) using a fluorescence-labeled oligonucleotide probe. Nevertheless, these methods are not widely used due to technical limitation or difficulties. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled DNA probes has been introduced. The paraffin-embedded tissues are the most common form of biopsy tissues available from pathology banks. Bacteria can be detected either in a species-specific or universal manner. Bacterial signals are detected as either discrete forms (coccus, rod, fusiform, and hairy form) of bacteria or dispersed forms. The technique allows other histological information to be obtained: the epithelia, connective tissue, inflammatory infiltrates, and blood vessels are well distinguished. This method can be used to study the role of bacteria in various diseases, such as periodontitis, cancers, and inflammatory immune diseases.

도 1에 도시 한 민감도를 결정하는 키트에 양성 대조군 프로브에 비해 DIG 표지 된 프로브의 도트 블 롯팅. 343 bp의 P. 진지 발리 - 특정 프로브는 70 bp의 eubacterial 프로브보다 25 배 더 민감하다. (P)의 검출을위한 만성 치주염 환자에서 얻은 치은 조직의 현장 하이브리드의 2는 그림 진지 발리과 진정 세균. 바이올렛에 도시 세균 신호는, 외부에있는 ...

Watch this Scientific Journal Video about In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA at JoVE.com

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

16S rRNA의 타겟팅 디곡신 표지 DNA 프로브를 사용하여 파라핀 조직 내에서 박테리아의 제자리 검출

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been ...

in-situ-detection-bacteria-within-paraffin-embedded-tissues-using

Research

JoVE Journal

Immunology and Infection

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

10.9K 조회수.  School of Dentistry and Dental Research Institute, Seoul National University. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

비디오: In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

접착제 테이프 기반의 샘플링 및 형광의 조합 현장에서</em의 신속한 감지를 위해> 하이브 리다이 제이션 살모넬라균 신선한 농산물에 대한

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

연구

면역학 및 감염병학

ampliPHOX Colorimetric Detection on a DNA Microarray for Influenza

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5 For instance, many examples of the ability to type and subtype influenza virus have been demonstrated.6-11 The identification and subtyping of influenza on DNA microarrays has applications in both public health and the clinic for early detection, rapid intervention, and minimizing the impact of an influenza pandemic. Traditional fluorescence is currently the most commonly used microarray detection method. However, as microarray technology progresses towards clinical use,1 replacing expensive instrumentation with low cost detection technology exhibiting similar performance characteristics to fluorescence will make microarray assays more attractive and cost-effective.
The ampliPHOX colorimetric detection technology is intended for research applications, and has a limit of detection within one order of magnitude of traditional fluorescence11, with a main advantage being an approximate ten-fold lower instrument cost compared to the confocal microarray scanners required for fluorescence microarray detection. Another advantage is the compact size of the instrument which allows for portability and flexibility, unlike traditional fluorescence instruments. Because the polymerization technology is not as inherently linear as fluorescence detection, however, it is best suited for lower density microarray applications in which a yes/no answer for the presence of a certain sequence is desired, such as for pathogen detection arrays. Currently the maximum spot density compatible with ampliPHOX detection is &tilde;1800 spots/array. Because of the spot density limitations, higher density microarrays are not suitable for ampliPHOX detection.
Here, we present ampliPHOX colorimetric detection technology as a method of signal amplification on a low density microarray developed for the detection and characterization of influenza viruses (FluChip). Although this protocol uses the FluChip (a DNA microarray) as one specific application of ampliPHOX detection, any microarray incorporating biotinylated target can be labeled and detected in a similar manner. The microarray design and biotinylation of the target to be captured are the responsibility of the user. Once the biotinylated target has been captured on the array, ampliPHOX detection can be performed by first tagging the array with a streptavidin-label conjugate (ampliTAG). Upon light exposure using the ampliPHOX Reader instrument, polymerization of a monomer solution (ampliPHY) occurs only in regions containing ampliTAG-labeled targets. The polymer formed can be subsequently stained with a non-toxic solution to improve visual contrast, followed by imaging and analysis using a simple software package (ampliVIEW). The entire FluChip assay from un-extracted sample to result can be performed in about 6 hours, and the ampliPHOX detection steps described above can be completed in about 30 min.

ampliPHOX colorimetric detection technology is presented as an inexpensive alternative to fluorescence detection for microarrays. Based on photopolymerization, ampliPHOX produces solid polymer spots visible to the naked eye in just a few minutes. Results are then imaged and automatically interpreted with a simple yet powerful software package.

인플루엔자에의 DNA Microarray에 ampliPHOX Colorimetric 검색

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5  For instance, many examples of the ability to type and subtype influenza virus ...

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Oligonucleotide - 결합 형광등 Microspheres를 사용하여 복잡한 임상 및 환경 샘플에서 박테리아의 멀티 플렉스 감지

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

형광 DNAzymes을 사용하여 박테리아의 탐지

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

형광<em&gt; 현장에서</em바이러스 및 식물과 곤충 조직에서 Endosymbiotic 박테리아의 지역화를위한&gt; 혼성화 (FISH)

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Rapid Identification of Gram Negative Bacteria from Blood Culture Broth Using MALDI-TOF Mass Spectrometry

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional identification requires the sub-culture of signaled blood culture broth with identification available only after colonies on solid agar have matured. MALDI-TOF MS is a reliable, rapid method for identification of the majority of clinically relevant bacteria when applied to colonies on solid media. The application of MALDI-TOF MS directly to blood culture broth is an attractive approach as it has potential to accelerate species identification of bacteria and improve clinical management. However, an important problem to overcome is the pre-analysis removal of interfering resins, proteins and hemoglobin&#160;contained in blood culture specimens which, if not removed, interfere with the MS spectra and can result in insufficient or low discrimination identification scores. In addition it is necessary to concentrate bacteria to develop spectra of sufficient quality. The presented method describes the concentration, purification, and extraction of Gram negative bacteria allowing for the early identification of bacteria from a signaled blood culture broth.

The application of matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry (MS) directly to blood culture broth expedites the identification of bacteria. The presented method is a rapid and reliable method for identification of Gram negative bacteria directly from blood culture broth.

MALDI-TOF 질량 분석기를 사용하여 혈액 배양액에서 그람 음성 박테리아의 빠른 확인

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional ...

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin proteolipid protein (PLP) 139-151-induced experimental autoimmune encephalomyelitis (EAE) in SJL mice and cardiac myosin heavy chain-&#945; (Myhc) 334-352-induced experimental autoimmune myocarditis (EAM) in A/J mice. Two sets of cocktails of dextramer reagents were used, where dextramers+ cells were analyzed by laser scanning confocal microscope (LSCM): EAE, IAs/PLP 139-151 dextramers (specific)/anti-CD4 and IAs/Theiler&#8217;s murine encephalomyelitis virus (TMEV) 70-86 dextramers (control)/anti-CD4; and EAM, IAk/Myhc 334-352 dextramers/anti-CD4 and IAk/bovine ribonuclease (RNase) 43-56 dextramers (control)/anti-CD4. LSCM analysis of brain sections obtained from EAE mice showed the presence of cells positive for CD4 and PLP 139-151 dextramers, but not TMEV 70-86 dextramers suggesting that the staining obtained with PLP 139-151 dextramers was specific. Likewise, heart sections prepared from EAM mice also revealed the presence of Myhc 334-352, but not RNase 43-56-dextramer+ cells as expected. Further, a comprehensive method has also been devised to quantitatively analyze the frequencies of antigen-specific CD4 T cells in the &#8216;Z&#8217; serial images.

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

The protocol to detect self-reactive CD4 T cells in brain and heart by direct staining with major histocompatibility complex class II dextramers has been described in this report. For comprehensive analysis, a reliable method to enumerate the frequencies of antigen-specific CD4+ T cells in situ is also devised.

주요 조직 적합성 복잡한 클래스 II Dextramers을 사용하여 뇌와 심장에있는자가 반응 CD4 T 세포의 제자리 탐지에

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin ...

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most common microdissection technique used today. In this technique, a laser is used to focally melt a thermoplastic membrane that overlies a dehydrated tissue section1. The tissue section composite is then lifted and separated from the membrane. Although this technique can be used successfully for tissue examination, it is time consuming and expensive. Furthermore, the successful completion of procedures using this technique requires the use of a laser, thus limiting its use. A new more affordable and practical microdissection approach called mesodissection is a possible solution to the pitfalls of LCM. This technique employs the MESO-1/MeSectr system to mill the desired tissue from a slide mounted tissue sample while concurrently dispensing and aspirating fluid to recover the desired tissue sample into a consumable mill bit. Before the dissection process begins, the user aligns the formalin fixed paraffin embedded (FFPE) slide with a hematoxylin and eosin stained (H&#38;E) reference slide. Thereafter, the operator annotates the desired dissection area and proceeds to dissect the appropriate segment. The program generates an archived image of the dissection. The main advantage of mesodissection is the short duration needed to dissect a slide, taking an average of ten minutes from set up to sample generation in this experiment. Additionally, the system is significantly more cost effective and user friendly. A slight disadvantage is that it is not as precise as laser capture microscopy. In this article we demonstrate how mesodissection can be used to extract RNA from slides from FFPE granulomas caused by Mycobacterium tuberculosis (Mtb).

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been extensively employed for the examination of DNA, RNA, and protein within tissue. Laser capture microscopy (LCM) is the most commonly used method, but a new milling technique, mesodissection, is recently available. We demonstrate RNA extraction from mesodissected formalin fixed paraffin embedded tissue slides of Mycobacterium tuberculosis granulomas.

복구하는 새로운 미세 절제 접근<em&gt; 결핵균</em폐 육아종 임베디드 포르말린 고정 파라핀에서&gt; 특정 성적 증명서

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most ...

Identification of Rare Bacterial Pathogens by 16S rRNA Gene Sequencing and MALDI-TOF MS

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in immunocompromised patients. In most cases only few data, mostly published as case reports, are available which investigate the role of such pathogens as an infectious agent. Therefore, in order to clarify the pathogenic character of such microorganisms, it is necessary to conduct epidemiologic studies which include large numbers of these bacteria. The methods used in such a surveillance study have to meet the following criteria: the identification of the strains has to be accurate according to the valid nomenclature, they should be easy to handle (robustness), economical in routine diagnostics and they have to generate comparable results among different laboratories. Generally, there are three strategies for identifying bacterial strains in a routine setting: 1) phenotypic identification characterizing the biochemical and metabolic properties of the bacteria, 2) molecular techniques such as 16S rRNA gene sequencing and 3) mass spectrometry as a novel proteome based approach. Since mass spectrometry and molecular approaches are the most promising tools for identifying a large variety of bacterial species, these two methods are described. Advances, limitations and potential problems when using these techniques are discussed.

Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) and molecular techniques (16S rRNA gene sequencing) permit the identification of rare bacterial pathogens in routine diagnostics. The goal of this protocol lies in the combination of both techniques which leads to more accurate and reliable data.

16S rRNA의 유전자 시퀀싱과 MALDI-TOF MS에 의해 희귀 세균성 병원체의 식별

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in ...

A Method for Targeted 16S Sequencing of Human Milk Samples

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as with all these technologies, reproducible results depend on a laboratory workflow that incorporates appropriate precautions and controls. This is particularly important with low-biomass samples where contaminating bacterial DNA can generate misleading results. This article details a semi-automated workflow to identify microbes from human breast milk samples using targeted sequencing of the 16S ribosomal RNA (rRNA) V4 region on a low- to mid-throughput scale. The protocol describes sample preparation from whole milk including: sample lysis, nucleic acid extraction, amplification of the V4 region of the 16S rRNA gene, and library preparation with quality control measures. Importantly, the protocol and discussion consider issues that are salient to the preparation and analysis of low-biomass samples including appropriate positive and negative controls, PCR inhibitor removal, sample contamination by environmental, reagent, or experimental sources, and experimental best practices designed to ensure reproducibility. While the protocol as described is specific to human milk samples, it is adaptable to numerous low- and high-biomass sample types, including samples collected on swabs, frozen neat, or stabilized in a preservation buffer.

A semi-automated workflow is presented for targeted sequencing of 16S rRNA from human milk and other low-biomass sample types.

인간의 우유 샘플의 타겟된 16S 시퀀싱 하는 방법

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as ...