이 작품은 NoroCORE 프로젝트를 통해 농업 및 식품 연구 주도권 경쟁 부여 번호 2011-68003-30395 미국 농 무부, 식품 및 농업에 의해 지원 되었다. 오픈 액세스 비용 자금 미국 농 무부에 의해 제공 했다. 우리는 로버트 Atmar (베일 러 대학의과 대학, 휴스턴, TX) 친절 하 게 우리가 제공 하 고 순화 capsids 발레리 라 팜 가장 이미지와 함께 그녀의 지원에 대 한 감사 하 고 싶습니다. 우리는 또한 제시 하는 실험을 시작 하는 데 도움에 대 한 프랭크 N. 배리 감사 하 고 싶습니다.

1. 구조에 대 한 평가 손실의 더 높은 순서 노로바이러스 Capsid 바인딩 분석 결과 플레이트 기반 참고: 여기에 매우 비슷한 ELASA 프로토콜 게시 29 되었습니다 그리고 유사한 ELASA 분석 이전 연구의 일부 기사 17 , , 18 22 다른 곳으로 보고 되었습니다.
<ol><li>인간의 노로바이러스 GII.4 시드니 capsids의 열 처리 <ol><li>얻을 순화 인간의 노로바이러스 GII.4 시드니의 주요 capsid 단백질 (VP1) (가입: JX459908) 조립 capsids. 
		참고: 연구에서 Capsids R. Atmar (베일 러 대학의과 대학, 휴스턴, 텍사스)의 입수 했다.</li>
		<li>Dilute capsids 인산 염 버퍼 식 염 수 (PBS, pH 7.2) 개인 15 µ L의 최대 볼륨을 x 1에 50 µ g/mL를 PCR 튜브 출장. 적어도 600 튜브에 포함 되어 있는지 확인 capsid의 ng. 600는 확인 치료 ligand 조합 당 capsid의 ng.</li>
		<li>예 열 원하는 열 처리에 열 cycler. 
		참고:이 프로토콜을 서로 다른 시간에 대 한 68 ° C에서 치료의 목적을 위해 (0-25 분) 선정 되었다.</li>
		<li>즉시 냉각 4 ° C에 추가 열 cycler 예 열. 원하는 시간에 대 한 열 cycler에 capsid 솔루션 튜브를 추가 합니다. 가 열 후 5 분에 대 한 사전 냉각된 4 ° C cycler 즉시 전송.
		변성된 capsid 컨트롤로 <ol><li>포함 95 ° C 5 분에 대 한 치료. 긍정적인 통제로 치료 (23 ° C) capsid 솔루션을 포함 합니다. 추가 부정적인 컨트롤로 아무 capsid PBS 포함.</li>
		</ol></li> <li>짧게 스핀 다운 튜브의 하단에 모든 방울 고 3 µ g/ml PBS에 치료 capsid 솔루션을 희석을 원심 분리기에서. 희석, 대우 capsid (100 µ L/잘)의 적어도 200 µ L 확인 하십시오.</li>
	</ol></li> <li>적용 100 µ L 처리 당 적어도 2 개의 우물 보장 각 잘 capsid 솔루션의. 또한, 각 ligand;에 대 한 100 µ L PBS 가진 2 제어 우물을 포함 이 분석 결과의 배경 흡 광도를 제공 한다. 커버 뚜껑 접시, 4 ° C에서 또는 실내 온도에서 2 h 떨고 인큐베이터에 인감 파라핀으로 가장자리를 줄이기 위해 증발, 영화와 떠나 하룻밤.</li>
	<li>블로킹 버퍼 PBS에 0.05%와 5% 탈지 우유 고체 (w/v)를 함으로써 준비 트윈 20 (PBST).</li>
	<li>접시에서 치료 capsid 솔루션을 제거합니다. 블로킹 버퍼의 200 µ L/잘 추가 합니다. 실 온에서 2 h에 대 한 품 어 또는 하룻밤, 4에서 봉인 ° c.</li>
	<li>준비는 ligand 바인딩 biotinylated aptamer M6-2 18 , 29에 대 한 솔루션 및 biotinylated 합성 HBGA 혈액형 A 또는 biotinylated 유형 헤
	<li>Dilute nuclease 무료 물에서 1 µ m biotinylated aptamer <ol>. 각 치료에 대 한 총 200 µ L에 대 한 충분 한 솔루션 인지 확인 합니다. 선택한 biotinylated HBGA 블로킹 버퍼에서 30 µ g/mL를 희석. 각 치료에 대 한 200 µ L 전체 볼륨에 대 한 충분 한 솔루션 인지 확인. 
		참고: 사용 하려면 적은 HBGA, 10 µ g/mL HBGA의 0.25% 탈지 우유-PBST에 교체하실 수 있습니다. Biotinylated M6 2를 HBGA 농도 이전 최적화 되었고 보고.</li>
	</ol></li> <li>블로킹 버퍼를 제거 하 고 3 번으로 200 µ L/잘 PBST 접시를 세척. 잔류 수 분을 건조 살 균 종이 타 올에 거꾸로 접시를 두 드려.</li>
	<li>추가 100 µ L/잘은 ligand의 바인딩 솔루션, 열 처리-ligand 조합 당 2 웰 스는 확인. 품 어 실 온에서 1 시간에 약 60 rpm에서 궤도 통에 뚜껑으로 덮여 접시. 
	참고: 각각 2 웰 스 각 치료 capsids 그리고 각 리간드에 대 한 완전 하 게 변성된 capsids의 긍정적이 고 부정적인 컨트롤 포함 해야 합니다. 또한, 2는 &#34; 아무 capsid &#34; 웰 스는 격판덮개로 각 리간드에 대 한 배경 컨트롤.</li>
	<li>는 Ligand 솔루션을 제거 하 고 세척 3 번 200 µ L/잘 PBST와 우물. 잔여 수 분을 건조 살 균 종이 타 올에 접시를 거꾸로 팻.</li>
	<li>추가 100 µ L/잘 0.2의 해결책의 µ g/mL streptavidin-와 사비 PBS에 과산화 효소. 궤도 셰이 커에 부드러운 진동으로 실 온에서 15 분 동안 품 어. 
	참고: 다른 streptavidin 양 고추냉이 과산화 효소 어원이 같은 말 다른 농도 있을 것 이다. 사용자 문의 &#39; 효소의 ELISA 응용 프로그램에 대 한 농도의 이상적인 범위에 대 한 s 설명서 그리고 그것은 최적의.</li>
	<li>어원이 솔루션을 제거합니다. 200 µ L/잘 PBST 3 번 씻어. 잔여 수 분을 건조 살 균 종이 타 올에 접시를 거꾸로 팻.</li>
	<li>추가 100 µ L/잘 3, 3 &#39;, 5, 5 &#39;-tetramethylbenzidine (TMB) 기판 색을 개발 하는 5-15 분 관찰 부정적인 제어 웰 스에 대 한 색상 및 복제 판 사이의 같은 시간 동안 지속적으로 개발 해야 하 고. 뿐만 아니라 사용 하는 플레이트 리더의 흡 광도 범위에 유의. 
	참고: 개발 시간 ligands/시 약 사용의 품질에 따라 달라질 수 있습니다.</li>
	<li>100 µ L/잘 1 M 인산에 대 한 반응의 개발을 중지합니다. 즉시 450에서 격판덮개를 읽을 nm. 데이터를 저장. 
	참고: 산의 소개 일반적으로 크게 반응 속도가 느려집니다 하지만 완전히 그것을 중지 하지 않습니다. 흡수도 읽기 전에 시간의 연장된 금액에 대 한 중지 접시를 두지 마십시오.</li>
</ol> 2. 플레이트 기반 분석 결과의 분석 <ol><li>스프레드시트 프로그램에서 원시 흡 광도 데이터 저장. 특정 치료와 리간드 잘 각 쌍에 대 한 평균 absorbances를 생성 합니다. 이 평균을 사용 하 여 모든 후속 분석. 
	참고: 비교 아무 쌍 우물의 크게 이질적인 값은 다는 것을 반드시 하 두 잘 absorbances.</li>
	<li>의 원시 흡 광도, 절대 capsid 무결성 (모든 바인딩)을 분석 하는 &#34; 아무 capsid &#34; 다른 모든 샘플 흡 광도 값에서 제어. 
	참고: 또는, 더 높은 순서 (2 차, 3 차, 4 급) 구조의 손실로 인해 바인딩의 손실 직접 분석할 수 있습니다. 네거티브 (capsid) 제어의 흡 광도 빼기 대신 완전히 변성된 capsid 컨트롤의 값을 뺍니다. 모든 바인딩 일반적인 장치에 바인딩 수 있으므로 capsid 시퀀스 인해 바인딩 신호이 제거 합니다. HBGA 및 aptamer M6 2 비슷한 결과 생성 하는 방법 중 하나 그래서 완전히 변성된 capsid 작은 바인딩을 표시 합니다. 일반적인 aptamer 바인딩에 거짓 긍정적인 신호는 분석 사용을 선택할 때 고려해 야 합니다.</li>
	<li>는 음수 또는 변성 제어 조정 absorbances, 함께 나누어 그들의 각각 긍정적인 (치료)에 의해 absorbances absorbances 제어 및 증식 치료 100. 이 치료 컨트롤에 상대적인 치료 capsid의 신호 비율을 제공 합니다.</li>
	<li>Capsid 시퀀스에 기인 각 ligand 바인딩 신호의 정도 예측 하려면 빼기는 &#34; 아무 capsid &#34; 초기 absorbances에서 제어를 제외 하 고 변성된 capsid의 조정된 흡 광도. 긍정적인 제어 신호의 조정된 흡 광도 의해 이것을 분할 하 고 100을 곱하십시오. 이 때문에 변성된 capsid/capsid 시퀀스에 ligand 바인딩 신호의 명백한 비율 제공.</li>
</ol> 3. 열 처리 후 바이러스 집계 감지에 대 한 DL 참고: 다음 단계는 소프트웨어와 관련 있을 수 있습니다 및 악기 사용, 하지만 적응 하 고 수 유사한 장치에 적용.
<ol><li>만들기는 DL에 새로운 크기 SOP 악기 소프트웨어 사용: 자료 = 단백질, Dispersant PBS, 온도 = = 25 ° C, 평형 시간 = 0 초, 셀 일회용 베트 (작은 볼륨, ZEN0040), 측정 각도 = = 173 ° 후방 산란 측정 기간 = 자동 측정의 수 = 3, 측정 간격 = 0 초, 데이터 처리: 분석 모델 = 범용 (일반 해상도). 다른 모든 매개 변수에 대 한 기본 설정을 사용 하 여.</li>
	<li>소프트웨어, 녹색 실행된 화살표를 선택 하 고 이름을 샘플.</li>
	<li>단계 VLPs의 열 처리에 대 한 1.1.4 통해 1.1.1.</li>
	<li>Dilute 열 처리 VLPs 1시 10분 5 µ g/mL의 최종 농도 대 한 1 x PBS. (선택 사항) 먼지 입자;를 제거 하는 1 µ m 기 공 크기와 샘플 필터링 DL은 매우 민감한 먼지, 큰 입자는 작은 입자 보다 훨씬 더 많은 빛을 흩어.</li>
	<li>일회용 작은 볼륨으로 희석된 VLPs의 전송 50 µ L 베트. 악기의 샘플 챔버에는 멧 삽입.</li>
	<li>실행을 시작 하 고 사용는 &#39; Correlogram &#39;, &#39; Cumulants 맞춤 &#39;, 및 &#39; 전문가 조언을 &#39; 데이터 품질 평가를 탭.
	<ol><li>실행 하는 동안 확인 증가할수록 인덱스 값이 0.3, 대표는 품질 측정.에서 보다는 &#8216; 분할 &#8217; 탭, 상관 계수는 상수와 가까이, 그러나 이상의 1, 짧은 시간에 다는 것을 확인 그리고 나중에, 입자 크기의 특성 0 급격히 떨어져 상품. 사용은 &#8216; 전문가 조언을 &#8217;를 측정 하는 동안 데이터 품질에 대 한 피드백에 대 한 탭.</li>
		<li>측정 완료 후 증가할수록 인덱스 값이 0.3 보다 작은 다시 확인 합니다. cumulants 라인 다음과 데이터 포인트에 밀접 하 게 맞는 다는 것을 확인은 &#8216; Cumulants에 맞는 &#8217; 탭</li>
	</ol></li> <li>걸릴 각 샘플의 입자 크기 각 측정에 대 한 Z-평균 입자 직경의 평균 보고. ° C.에에서 온도 대 nm의 직경을 플롯</li>
</ol> 4. 실시간에서 감지 바이러스 집계에 대 한 DL 참고: 다음 단계는 소프트웨어와 관련 있을 수 있습니다 및 악기 사용, 하지만 적응 하 고 수 유사한 장치에 적용.
<ol><li>만들기는 DL에 새로운 크기 SOP 악기 소프트웨어 사용 하 여: 소재 단백질, Dispersant = = PBS, 온도, 평형 시간 = = 0 초, 셀 석 영 cuvette, 측정 각도 = = 173 ° 후방 산란 측정 기간 자동, = 측정의 수 = 50 (증가 또는 감소에 따라 집계 속도 수 있습니다), 측정 간격 = 0 초, 데이터 처리: 분석 모델 = 여러 좁은 모드 (높은 해상도). 다른 모든 매개 변수에 대 한 기본 설정을 사용 하 여.</li>
	<li>이름을 새로운 샘플을 열고 소프트웨어 실행된 화살표를 선택 하 고 허용 온도 평형에 도달 하는 악기.</li>
	<li>사이 200-500 µ L. 볼륨과 5 µ g/mL의 농도에서 microcentrifuge 튜브에 1 X PBS에는 VLPs를 중단 소용돌이 정지.</li>
	<li>드 가스 탁상 원심 분리기에 5-10 s VLP 정지 아래로 회전 합니다. 이 크기 측정을 방해 하는 열 처리 중 거품 형성을 방지 하는 데 도움이.</li>
	<li>전송은 VLP 서 스 펜 션 작은 볼륨 석 영 cuvette 방지 거품 하 고는 베트의 벽에 천천히 플라스틱. 악기 온도 평형에 도달 하면, 샘플 챔버에는 베트를 삽입.</li>
	<li>기다려 10 s equilibrate, 샘플 온도 대 한 실행을 시작 합니다. 실행의 시작에 타이머를 시작 합니다. 첫 번째 측정의 끝에 타이머를 중지 합니다. 첫 번째 시간으로이 시간이 걸릴. 소프트웨어에 의해 기록 측정 시간에서 후속 시간 포인트 얻기.</li>
	<li>실행을 시작 하 고 correlogram, 맞는, 배포 및 데이터 품질을 평가 하기 위해 전문가 조언을 모니터링. 
	참고:는 PDI 반드시 되지 않습니다 이러한 측정 샘플으로 0.3 보다는 더 적은 polydisperse 집계 될 것으로 예상 된다.
	<ol><li>상관 계수 상수와 가까이, 하지만 짧은 시간에, 이상의 1 하 고 하나 이상의 최신 시간, 입자 크기의 특성에서 크게 떨어져 상품.</li>
		<li>분포 선 다음과 같이 데이터 포인트 밀접 하 게 맞는 있는지 확인 하십시오.</li>
	</ol></li> <li>크기 데이터를 분석.
	각 측정 및 초기 시간 포인트 사이의 시간 차이에서 <ol><li>결정 때마다 포인트. 측정 기간 모두 정확 하 게 동일 않습니다.</li>
		<li>강도 분포를 사용 하 여 각 측정/시간 지점에 대 한 가장 큰 지역으로 봉우리의 크기 기록.</li>
		<li>대 분에 시간 nm에서 최대 직경 플롯</li>
	</ol></li></ol> 5. TEM 샘플 준비 가장을 위한 <ol><li>얻기 탄소 지원 영화 (니켈) 격자. 
	참고: 시설 현미경으로 권장된 시 약 및 사용에 대 한 그들의 처리에 핵심 시설 문의. 방 습 제 나 습기에 노출을 최소화 하기 위해 진공 챔버를 포함 하는 상자에서 격자를 저장 하십시오.</li>
	<li>필터 종이 약 5 c m x 5 cm 조각 눈물. 유리 접시를 가져오고 핀셋 현미경 검사 법에 사용 하기 위해 설계 된 반전 적절 한 자기-폐쇄.</li>
	<li>는 파라핀 필름의 약 2.5 c m x 5 cm 조각 잘라. 벤치탑에.</li>
	<li>노로바이러스 GII.4 시드니 capsids의 열 처리 <ol><li>단계 1.1.1-1.1.5 제외 하 고 위에서 설명한 대로 정확 하 게 열 처리 절차에 따라: PBS 대신 치료를 위해 10 mM HEPES (pH 7.4)을 사용 하 고 더 capsids 희석 하지 않습니다 치료 (50 µ g/mL에서 유지 솔루션) 후. 파라핀 필름에 대우 capsid 솔루션의 전체 ~ 15 µ L 드롭 플라스틱.</li>
	</ol></li> <li>그리드 가장자리는 그리드를 가장자리에를 핀셋으로 잡아 및 치료 솔루션 방울 위에 그리드 탄소-사이드-아래로 놓습니다. Capsid는 격자에 연결할 수 있도록 10 분 동안 품 어 보자.
	<ol><li>Capsid 준비의 순도 따라 추가 10 mM HEPES 솔루션의 세척 처리 capsid 방울 후 라인에 배치 하는 10-15 µ L 방울의 형태로 필요한 경우.</li>
		<li>후 10 분은 물방울과 그리드를 선택 합니다. 장소 필터 종이에 거의 수직 그리드는 물방울을 멀리 심지. 그리드와 10-15 µ L HEPES 버퍼의 방울을 데리, 워시 필터 종이의 또 다른 조각으로 30 s, 다음 심지 멀리 잡아</li>
	</ol></li> <li>빈 영역에서 파라핀 영화에 2 %uranyl 아세테이트 솔루션의 15 µ L 드롭릿 장소.
	<ol><li>그리드와 uranyl 아세테이트의 방울을 데리 누르고 45 s. 윅 거리에 대 한 uranyl 아세테이트, 솔루션의 대부분을 제거 해야 되 고. 필터 종이, 표 하지 않는 주의에 그리드 탄소-측면 장소 &#34; 스틱 &#34; 핀셋에 습기. 오픈 유리 페 트리 접시에에서 그것에 그리드와 필터 종이 놓습니다. 
		참고: 사용 하지 마십시오 플라스틱 접시, 격자 정전 그들에 게 매력 있을 것입니다 하 고 붙어 될 요리.</li>
	</ol></li> <li>모든 치료에 대 한 반복. TEM으로 관찰 하기 전에 건조 하룻밤 desiccator 격자와 페 트리 접시 반쪽 장소.</li>
	<li>상담 각 기관에서 현미경 시설 준비 격자 관찰에 관한. 일부 시설 허용 그들의 시설의 운영에 관한 훈련을 사용자 &#39; s 악기. 설치 및 특정 현미경의 관찰에 대 한 특정 세부 정보는 beyond이이 글의 범위.</li>
</ol>

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

저자는 공개 없다.

프로토콜 및 여기에 설명 된 기술을 인간의 노로바이러스 capsid 무결성/기능을 평가 하는 수단을 제공 합니다. 이러한 방법은 기계적 통찰력 비활성화는 바이러스에 대 한 치료의 효과 얻기 위해 사용할 수 있습니다 그리고 잠재적으로 더 전통적인 비활성화 평가 방법 RT 정량 또는 상 패 분석 결과 등을 보충할 수 있다. 예를 들어, 혼자 패 분석 실험에 의해 화학적 또는 물리적 비활성화의 평가 바?...

인간의 노로바이러스는 상당한 공중 보건 부담에 대 한 세계적으로, 대략 685 백만 질병 및 212,000의 죽음을 일으키는 매년1, 수십억 달러2,3의 비용에. 오늘, 노로바이러스 검출 및 정량화 게놈 증폭 및 리간드 기반 플랫폼 포함 됩니다. 이전은 일반적으로 선호 더 민감한, 양적 정보를 제공 하는 거짓 긍정적인 결과4의 일반적으로 낮은 위험이 있다. 가장 일반적인 노로바이러스 검출 및 정량화 게놈 증폭 기술은 역전사 정량적 중 합 효소 연쇄 반응 (RT-정량) 이다. 때문에 대상 인간의 노로바이러스 게놈의 작은 세그먼트를 증폭, RT-정량 혼자는 감염 사이 차별의 수와 비 전염 성 입자, 무료 게놈 RNA로 손상 capsids 게놈를 포함 하 고와 capsids 치명적 유전자 돌연변이 잘립니다 여전히 실시간 정량 Pcr에 의해 증폭 될 수 있습니다. 두 가지 새로운 체 외에서 재배 방법을 인간 노로바이러스5,6 최근에 보고 되었다, 그러나 둘 다 여전히 바이러스 정량화에 대 한 실시간 정량에 의존 하 고는 아직 일상적인 임상/환경에 대 한 실현 방법 인간의 noroviruses에 대 한 테스트. 따라서, 실시간 정량 임상/환경 테스트에 대 한 황금 표준 남아 있습니다.
다른 시험관에 방법 더 나은 노로바이러스 입자의 infectivity 상태를 추정 하기 위해에서 개발 되었습니다. 이러한 메서드는 일반적으로 노로바이러스 capsid의 무결성 및 게놈 무결성 평가로 분류할 수 있습니다. 전 방식은 더 많은 인기입니다. 일반적으로 사용 되는 방법은 이전 바이러스 성 게놈 RNA의 추출 RNase 전처리 인데이 바이러스 성 입자를 그대로 유지 하지만 호스트 수용 체/공동-요인, 바인딩할 능력 부족 뿐만 아니라가지고 심각 하 게 변이 된 바이러스 성 입자에 대 한 고려 하지 않습니다 또는 잘린 또는 소폭 손상 유전자7. Capsid 무결성 또한 평가 될 수 있습니다 인간의 노로바이러스 공동-receptor/공동-요인, 탄수화물에 바인딩할 바이러스의 능력에 따라 histo 혈액 그룹 항 원 (HBGAs)로 알려진. HBGAs는 glycoproteins 또는 glycolipids (중 여러 다른 조직)의 일환으로 호스트 장 상피 세포에 존재 하 고 타 액 같은 체액에 분 비 될 수 있습니다. 그들의 표면에 HBGA 같은 물질을 포함 하는 장 박테리아도 인간의 노로바이러스8,,910, 바인딩할 표시 되었습니다 그리고 그런 상호 작용 노로바이러스 감염5를 홍보 수 있습니다. HBGA 바인딩을 활용의 기본 개념은 세포를 감염 바이러스 성 입자는 상 상속 수용 체/공동-factor를 바인딩 수만 가능할. 여러 연구 제안 구슬 기반 HBGA 바인딩 선행 하는 핵 산 증폭 infectivity 차별11,12,,1314, 유망한 방법입니다. 15,16. HBGAs에 대 한 주요 도전이 이다 단일 HBGA 형식이 없으므로 모든 인간의 노로바이러스 genotypes을 바인딩할 수 있습니다. 이 해결 하기 위해 돼지 위 mucin, HBGAs를 포함 하는 합성, 일관성, 그리고 비용 절감된의 용이성을 위하여 순화 HBGA 탄수화물 대신 사용 되었습니다.
무어 그 외 여러분 에 의해 최근 간행물 17 인간 노로바이러스 capsid 무결성을 추정 하기 위한 새로운 기술 세트를 소개 했다. HBGAs, 무어 외. 대신 17 광범위 하 게 반응 핵 산 aptamer (M6-2)18 및 열 처리 GII.4 시드니 노로바이러스 capsids 바이러스 같은 입자 (VLPs)를 광범위 하 게 반응 단일 클론 항 체 (NS14)19 바인딩을 조사 하 고이 비교 합성 HBGAs binding입니다. 핵 산 aptamers는 짧은 (20 ~ 80 nt) 단일 좌초 핵 산 (ssDNA 또는 RNA) 순서 결과로 고유한 3 차원 구조로 이동 하 고 바인딩 대상. 왜냐하면 그들은 핵 산, 그들은 더 적은 비용; 쉽게 화학적 합성, 정제, 수정; 고 열에 안정. Aptamers noroviruses에 대 한 생성의 몇 가지 보고서 존재, 그들 중 일부와 함께 다양 한 변종18,20,,2122광범위 한 반응성을 보여주는. 예를 들어, 무어 외. 17 그 aptamer M6 2 순화, 조립 인간의 노로바이러스 capsids (VLPs)에 바인딩된와 마찬가지로 HBGA에 대 한 더 높은 순서 (예를 들어, 2 차 및 3 차) 단백질 구조를 유지 하기 위해 바이러스 성 capsid에 대 한 의존도에 행동 시연 발생 하는 바인딩. 다른 한편으로, 노로바이러스 VLP 바인딩 항 체의 상당한 비율이 NS14 후 남아 capsids 변성 완전히 했다. 노로바이러스 바인딩 무어 외에 의해 연구에서의 평가 17 이루어졌다 aptamers 항 체 대신 사용 하는 예외와 유사한 ELISA, 간단 하 고, 플레이트 기반 메서드를 사용 하 (따라서 메서드가 호출 ELASA). 이 높은 처리량 실험적인 방법 노로바이러스 capsid, 물리적 또는 화학적 스트레스에 노출 되 면 바이러스 성 비활성화의 메커니즘을 이해 하기 위한 귀중 한 작품에 다른 처리의 효과 평가 하기 위해 사용 되었다. 그러나,이 방법은 하나의 단점은 낮은 감도 일반적인 바인딩 aptamers에 의해 일으키는 원인이 되는 높은 수준에서 매트릭스 관련 오염 물질에 대 한 참을성의 부족입니다.
무어 외. 17 열 처리에 대 한 응답에서 바이러스 성 입자의 집계 모니터링 하 다른 방법, 동적 빛 산란 (DL)을 사용. DL은 일반적으로 나노 정지의 크기를 평가 하 고 단백질23,24 및 바이러스25,,2627확장 되었습니다. 솔루션에서 입자에 의해 뿌려 진 빛의 강도 확산 계수 그리고 확고 공식을 사용 하 여 입자 직경의 계산을 허용 하는 입자 크기의 기능으로 변동. DLS 기술은 분산 된 바이러스, 개별 capsid 단백질 또는 이합체, 크기27에 따라 바이러스 집계의 검출을 허용 하는 나노 스케일으로 분산 된 입자의 유체역학 직경을 구분할 수 있습니다. 바이러스 집계, 입자 크기의 증가 의해 표시 나타내는 capsid 무결성의 손실입니다. capsid 변성 및 구조 중단, 소수 성 잔류물 노출 되 고 함께 집계를 형성 하는 입자를 일으킬. DL은 지정된 치료 또는 실시간으로17,28집계의 활동 후 입자 크기를 측정 하기 위해 사용할 수 있습니다. 이 방법은 솔루션에서 capsid 행동의 관측을 허용의 이점이 있다 하지만 필요한 정화 capsid의 높은 농도 자연 상태에서 바이러스의 완전히 대표 하지 않을 수 있습니다.
마지막 방법은 무어 외 활용 17 전송 전자 현미경 (TEM) 했다. 이 방법은 감도 부족 하 고 양적 데이터를 생성 하지 않습니다, 하지만 그것은 바이러스 성 capsid 구조에 다른 처리의 효과의 시각화 수 있습니다. 비록 아직 임상/환경 설정에 대 한 좋지 않은, 조합에서 이러한 방법의 사용은 인간의 노로바이러스 비활성화 이해에 중요 합니다. 이 문서의 목적은 플레이트 기반 바인딩 분석 결과 (ELASA), DL에 대 한 깊이 있는 프로토콜을 제공 하 고 가장 준비 방법 하는 데 사용 capsid에 치료 효과의 맥락에서 노로바이러스 capsid에 열 치료의 효과 조사 무결성 무어 외 에 제시 17.

<table><tbody><tr><td>&lt;strong&gt;Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>96-well, medium-binding polystyrene EIA plate</td><td>Fisher (Costar)</td><td>07-200-36</td><td></td></tr><tr><td>Lid for 96-well plate</td><td>Thermo Fisher</td><td>3098</td><td></td></tr><tr><td>Paraffin film (Parafilm)</td><td>Thermo Fisher</td><td>PM999</td><td></td></tr><tr><td>1x PBS (pH 7.2)</td><td>Life Technologies</td><td>20012-050</td><td></td></tr><tr><td>Polysorbate 20</td><td>Sigma-Aldrich</td><td>P9416</td><td></td></tr><tr><td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Purified, assembled human norovirus GII.4 capsids</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Individual 0.2 ml PCR tubes</td><td>Genesee Scientific</td><td>22-154G</td><td></td></tr><tr><td>2 thermocyclers</td><td>Bio-Rad</td><td>1861096</td><td></td></tr><tr><td>Tabletop mini centrifuge</td><td>Fisher Scientific</td><td>12-006-901</td><td></td></tr><tr><td>Skim milk solids</td><td>Thermo Fisher</td><td>LP0031B</td><td></td></tr><tr><td>Synthetic histo-blood group type A disaccharide, biotinylated</td><td>Glycotech</td><td>01-017</td><td></td></tr><tr><td>Biotinylated aptamer M6-2 (stock concentration 100 &amp;micro;M in nuclease-free water): 5&#039;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td><td>Life Technologies</td><td>SNN2004</td><td></td></tr><tr><td>3,3&amp;rsquo;,5,5&amp;rsquo;-tetramethylbenzidine (TMB) substrate, room temperature</td><td>Thermo Fisher</td><td>50-76-00</td><td></td></tr><tr><td>1 M phosphoric acid</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Microplate reader capable of reading 450 nm</td><td>Tecan</td><td>Infinite m200 Pro</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Analysis of Plate-Based Assay Results&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Microsoft Excel or similar program</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Dynamic Light Scattering Experiments&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Zetasizer ZSP, or similar particle size analysis instrument</td><td>Malvern Instruments</td><td>N/A</td><td></td></tr><tr><td>Vortex</td><td>Fisher Scientifc</td><td>02-215-365</td><td></td></tr><tr><td>Quartz cuvette</td><td>Hellma</td><td>104-002-10-40</td><td></td></tr><tr><td>Small volume disposable cuvette (to reduce VLP use)</td><td>Malvern Instruments</td><td>ZEN0040</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Transmission Electron Microscopy Sample Preparation&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Nickel electron microscopy grids with carbon support film</td><td>Ladd Research</td><td>10880-100</td><td></td></tr><tr><td>Self-closing reverse electron microscopy tweezers</td><td>Ted Pella</td><td>5372-NM</td><td></td></tr><tr><td>Qualitative filter paper</td><td>Sigma-Aldrich (Whatman)</td><td>WHA1002055</td><td></td></tr><tr><td>Glass petri dishes</td><td>Sigma-Aldrich</td><td>BR455743</td><td></td></tr><tr><td>100 mM stock HEPES solution (pH 7.2)</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>2% uranyl acetate</td><td>N/A</td><td>N/A</td><td></td></tr></tbody></table>

alternative in vitro methods for the determination of viral capsid structural integrity

인간의 노로바이러스 exacts 상당한 공중 보건 및 경제적 손실을 전세계. 생체 외에서 신흥 재배 발전 적용 되지 않습니다 아직 일상적인 바이러스의 검출에 대 한. 현재 탐지 및 정량화 기술, 핵 산 증폭에 주로 의존 하는 비 전염 성 바이러스 성 입자에서 전염 성 차별을 하지 않습니다. 이 문서의 목적은 최근 바이러스 성 입자의 infectivity 상태에 대 한 정보를 더 얻기 위해서는 함께 사용 되는 기술 발전에 구체적인 내용을 제시 하. 1 개의 기술은 capsids에 노로바이러스 ssDNA aptamer의 바인딩을 평가 포함 됩니다. Aptamers 쉽게 합성 하 고, 수정 되 고의 이점이 있고 저렴 하 고 안정적 이다. 또 다른 기술, 동적 빛 산란 (DL) 솔루션에서 capsid 행동 관찰의 이점이 있다. 전자 현미경 검사 법은 바이러스 성 capsids의 구조적 무결성의 시각화에 대 한 수 있습니다. 비록 유망한, 각 기술, 일반적인 aptamer 바인딩 같은 긍정적으로 위탁 한 분자를 샘플 행렬에서 DL에 대 한 정화 capsid의 요구와 가난한 감도 전자 현미경 검사 법에 대 한 몇 가지 단점이 있다. 그럼에도 불구 하 고, 조합에서 이러한 기술을 사용 하는 생산 데이터의 본문 보다 포괄적인 정보를를 제공 합니다 노로바이러스 capsid 무결성 infectivity의 정확한 평가 위해 필수적인 정보를 유추 하는 데 사용할 수 있습니다. 비활성화 방법 또는 바이러스 탐지의 해석입니다. 이 문서는 이러한 방법을 사용 하 여 인간의 노로바이러스 감염 입자를 차별에 대 한 프로토콜을 제공 합니다.

인간의 노로바이러스 GII.4 시드니 capsids (VLPs)의 구조적 무결성 무어 외 에 의해 발표로 여러 가지 새로운 방법을 사용 하 여 평가 했다 17. 먼저, 실험에서 행 해졌다는 상 상속 수용 체/공동 factor (HBGA) 또는 바인딩 ssDNA aptamer (M6-2)을 그들의 능력의 기능으로는 capsids의 무결성 비교 (그림 1). 표시 되는 결과 이전 무어 외. ?...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

일상적인 탐지 방법 바이러스 성 게놈 증폭을 이용 하는 비 전염 성 입자에서 전염 성 차별을 그들의 무 능력에 의해 제한 됩니다. 이 문서의 목적은 aptamer 바인딩, 동적 산란, 및 전송 전자 현미경 검사 법을 사용 하 여 감염 노로바이러스 입자의 차별에 도움이 다른 방법에 대 한 상세한 프로토콜을 제공 하는 것입니다.

대체 체 외에 바이러스 성 Capsid 구조적 무결성의 결정에 대 한 방법

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

alternative-vitro-methods-for-determination-viral-capsid-structural

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

8.0K 조회수.  North Carolina State University. 일상적인 탐지 방법 바이러스 성 게놈 증폭을 이용 하는 비 전염 성 입자에서 전염 성 차별을 그들의 무 능력에 의해 제한 됩니다. 이 문서의 목적은 aptamer 바인딩, 동적 산란, 및 전송 전자 현미경 검사 법을 사용 하 여 감염 노로바이러스 입자의 차별에 도움이 다른 방법에 대 한 상세한 프로토콜을 제공 하는 것입니다.

비디오: Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Nucleocapsids에서 바이러스성 DNA의 준비

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

연구

면역학 및 감염병학

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

HIV - 1 코어의 시험 관내 Uncoating에서

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

간편하고 강력한 생체내에서과 체외에서</em바이러스 조립 유학을위한> 접근법

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

&#39;단일 바이러스 게놈&#39;을 사용하여 단일 비리의 분리 및 유전체 분석

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Method for Measurement of Viral Fusion Kinetics at the Single Particle Level

Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion events, making it difficult to quantitatively analyze the sequence of the molecular steps involved. We have developed an in vitro, two-color fluorescence assay to monitor kinetics of single virus particles fusing with a target bilayer on an essentially fluid support.
Influenza viral particles are incubated with a green lipophilic fluorophore to stain the membrane and a red hydrophilic fluorophore to stain the viral interior. We deposit a ganglioside-containing lipid bilayer on the dextran-functionilized glass surface of a flow cell, incubate the viral particles on the planar bilayer and image the fluorescence of a 100 x 100 &mu;m2 area, containing several hundreds of particles, on a CCD camera. By imaging both the red and green fluorescence, we can simultaneously monitor the behavior of the membrane dye (green) and the aqueous content (red) of the particles.
Upon lowering the pH to a value below the fusion pH, the particles will fuse with the membrane. Hemifusion, the merging of the outer leaflet of the viral membrane with the outer leaflet of the target membrane, will be visible as a sudden change in the green fluorescence of a particle. Upon the subsequent fusion of the two remaining distal leaflets a pore will be formed and the red-emitting fluorophore in the viral particle will be released under the target membrane. This event will give rise to a decrease of the red fluorescence of individual particles. Finally, the integrated fluorescence from a pH-sensitive fluorophore that is embedded in the target membrane reports on the exact time of the pH drop.
From the three fluorescence-time traces, all the important events (pH drop, lipid mixing upon hemifusion, content mixing upon pore formation) can now be extracted in a straightforward manner and for every particle individually. By collecting the elapsed times for the various transitions for many individual particles in histograms, we can determine the lifetimes of the corresponding intermediates. Even hidden intermediates that do not have a direct fluorescent observable can be visualized directly from these histograms.

We present an in vitro, two-color fluorescence assay to visualize the fusion of single virus particles with a fluid target bilayer. By labeling viral particles with fluorophores that differentially stain the viral membrane and its interior, we are able to monitor the kinetics of hemifusion and pore formation.

단일 입자 수준에서 바이러스성 퓨전 속도론의 측정 방법

Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion ...

생물학

Nucleocapsid Annealing-Mediated Electrophoresis (NAME) Assay Allows the Rapid Identification of HIV-1 Nucleocapsid Inhibitors

RNA or DNA folded in stable tridimensional folding are interesting targets in the development of antitumor or antiviral drugs. In the case of HIV-1, viral proteins involved in the regulation of the virus activity recognize several nucleic acids. The nucleocapsid protein NCp7 (NC) is a key protein regulating several processes during virus replication. NC is in fact a chaperone destabilizing the secondary structures of RNA and DNA and facilitating their annealing. The inactivation of NC is a new approach and an interesting target for anti-HIV therapy. The Nucleocapsid Annealing-Mediated Electrophoresis (NAME) assay was developed to identify molecules able to inhibit the melting and annealing of RNA and DNA folded in thermodynamically stable tridimensional conformations, such as hairpin structures of TAR and cTAR elements of HIV, by the nucleocapsid protein of HIV-1. The new assay employs either the recombinant or the synthetic protein, and oligonucleotides without the need of their previous labeling. The analysis of the results is achieved by standard polyacrylamide gel electrophoresis (PAGE) followed by conventional nucleic acid staining. The protocol reported in this work describes how to perform the NAME assay with the full-length protein or its truncated version lacking the basic N-terminal domain, both competent as nucleic acids chaperones, and how to assess the inhibition of NC chaperone activity by a threading intercalator. Moreover, NAME can be performed in two different modes, useful to obtain indications on the putative mechanism of action of the identified NC inhibitors.

Nucleocapsid Annealing-Mediated Electrophoresis NAME Assay Allows the Rapid Identification of HIV-1 Nucleocapsid Inhibitors

This protocol describes NAME, an assay that allows the rapid identification of molecules able to inhibit in vitro the chaperone activities of HIV-1 nucleocapsid protein.

뉴 클레오 캡시드 소둔 매개 전기 영동 (NAME) 분석은 HIV-1 뉴 클레오 캡시드 억제제의 신속한 식별을 할 수 있습니다

RNA or DNA folded in stable tridimensional folding are interesting targets in the development of antitumor or antiviral drugs. In the case of HIV-1, viral ...

Highly Sensitive Assay for Measurement of Arenavirus-cell Attachment

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral particles to host cells. While virus-cell attachment can be measured through the use of virions labeled with biotin, radioactive isotopes, or fluorescent dyes, these approaches typically require high multiplicities of infection (MOI) to enable detection of bound virus. We describe a quantitative (q)RT-PCR-based assay that measures Junin virus strain Candid 1 attachment via quantitation of virion-packaged viral genomic RNA. This assay has several advantages including its extreme sensitivity and ability to measure attachment over a large dynamic range of MOIs without the need to purify or label input virus. Importantly, this approach can be easily tailored for use with other viruses through the use of virus-specific qRT-PCR reagents. Further, this assay can be modified to permit measurement of particle endocytosis and genome uncoating. In conclusion, we describe a simple, yet robust assay for highly sensitive measurement of arenavirus-cell attachment.

The first step in the arenavirus life cycle is attachment of viral particles to host cells. We report a quantitative (q)RT-PCR-based assay for ultrasensitive detection and quantitation of arenavirus attachment events.

Arenavirus 셀 첨부 파일의 측정을위한 고감도 분석

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

그라데이션 원심 분리에 의해 인플루엔자 A 바이러스 캡시드의 생체 외 분해에

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Production of Adeno-Associated Virus Vectors in Cell Stacks for Preclinical Studies in Large Animal Models

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. Clinical advancement of novel applications for AAV involves transitioning from small animal models, such as mice, to larger animal models, including dogs, sheep, and nonhuman primates. One of the limitations of administering AAV to larger animals is the requirement for large quantities of high-titer virus. While suspension cell culture is a scalable method for AAV vector production, few research labs have the equipment (e.g., bioreactors) or know how to produce AAV in this manner. Moreover, AAV titers are often significantly lower when produced in suspension HEK 293 cells as compared to adherent HEK293 cells. Described here is a method for producing large quantities of high-titer AAV using cell stacks. A detailed protocol for titering AAV as well as methods for validating vector purity are also described. Finally, representative results of AAV-mediated transgene expression in a sheep model are presented. This optimized protocol for large-scale production of AAV vectors in adherent cells will enable molecular biology laboratories to advance the testing of their novel AAV therapies in larger animal models.

Here we provide a detailed procedure for large-scale production of research-grade AAV vectors using adherent HEK 293 cells grown in cell stacks and affinity chromatography purification. This protocol consistently yields &#62;1 x 1013 vector genomes/mL, providing vector quantities appropriate for large animal studies.

대형 동물 모델의 전임상 연구를 위한 세포 스택에 있는 아데노 관련 바이러스 벡터의 생산

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. ...

Plaquing of Herpes Simplex Viruses

There are numerous published protocols for plaquing viruses, including references within primary literature for methodology. However, plaquing viruses can be difficult to perform, requiring focus on its specifications and refinement. It is an incredibly challenging method for new students to master, mainly because it requires meticulous attention to the most minute details. This demonstration of plaquing herpes simplex viruses should help those who have struggled with visualizing the method, especially its nuances, over the years. While this manuscript is based on the same principles of standard plaquing methodology, it differs in that it contains a detailed description of (1) how best to handle host cells to avoid disruption during the process, (2) a more useful viscous medium than agarose to limit the diffusion of virions, and (3) a simple fixation and staining procedure that produces reliably reproducible results. Furthermore, the accompanying video helps demonstrate the finer distinctions in the process, which are frequently missed when instructing others on conducting plaque assays.

Plaquing is a routine method used to quantify live viruses in a population. Though plaquing is frequently taught in various microbiology curricula with bacteria and bacteriophages, plaquing of mammalian viruses is more complex and time-consuming. This protocol describes the procedures that function reliably for regular work with herpes simplex viruses.

단순 포진 바이러스의 플라쿼싱

There are numerous published protocols for plaquing viruses, including references within primary literature for methodology. However, plaquing viruses can ...

대체 체 외에 바이러스 성 Capsid 구조적 무결성의 결정에 대 한 방법

요약

더 많은 비디오 탐색

이 비디오의 챕터