저자 편집 지원 Gráinne Tierney를 감사 하 고 싶습니다.

프로토콜은 IRST 인간의 연구 윤리 위원회의 지침을 따릅니다.
참고:이 절차는 신선한 냉동 인간의 조직에 cDNA 분자의 낮은 수의 탐지를 위해 특별히 설계 되었습니다. 조직 섹션 동안 여전히 동결, 이전 검증된 환자 파생 위 종양 또는 정상적인 조직 샘플에서 드라이 아이스에 잘라 왔다.
1. RNA 분리 및 정화
<ol><li>
RNA 추출 참고: 특정 제품을 사용 하 여 후드 RNA 격리 수행 ( 재료의 표참조). 그러나, 격리 키트의 다양 한 상업적으로 사용할 수 있습니다.<ol>
<li>균질 RNA 격리 시 약 및 소용돌이의 1 mL와 함께 1.5 mL 튜브에 잘게 잘린된 신선한 냉동 조직 샘플의 50-100 mg 적극적으로 15 미 품에 대 한 튜브-80 ° C에서 하룻밤.</li>
		<li>15 vortexing에 의해 5 분 및 혼합에 대 한 실 온에서 샘플을 포함 하는 튜브를 품 어 s.</li>
		<li>얼음에 튜브를 유지, 클로 프롬, 및 15에 대 한 적극적으로 소용돌이의 200 µ L 추가 s.</li>
		<li>60 s에 대 한 실 온에서 튜브와 4 ° c.에 15 분 동안 12000 x g에서 원심 분리기를 품 어</li>
		<li>1.5 mL 튜브에 수성 단계를 전송 하 고 glycogen의 20 µ g을 추가 합니다. 참고: 그것은 신중 하 게 오염을 줄이기 위해 interphase 또는 유기 층을 전송 하지 않도록 하는 것이 중요입니다.</li>
		<li>소 프로 파 놀, 혼합, 및 10 분 동안 얼음에 품 어 튜브 반전의 500 µ L를 추가 합니다.</li>
		<li>12000 x g RNA 침전 하 4 ° C에서 15 분 동안에 튜브 원심 참고: RNA 사이드와 원심 분리 후 자주 보이지 않는 튜브의 하단에 젤 같은 펠 릿에 표시 됩니다.</li>
		<li>침전을 방해 하지 않고는 상쾌한을 제거 하 고 pipetting으로 75% 에탄올의 1 mL와 함께 그것을 씻어.</li>
		<li>4 ° C에서 5 분 동안 7500 x g에서 튜브 원심 고는 펠 렛을 방해 하지 않고는 상쾌한을 제거 합니다.</li>
		<li>펠 릿 침전 투명 하 게 될 때까지 건조 하 고 50 µ L RNase 무료 물에 용 해 보자.</li>
		<li>부 량 전에 적어도 하룻밤-80 ° C에서 샘플을 동결.</li>
	</ol>
</li>
	<li>
게놈 DNA 제거 및 RNA 정화 참고: 열 기반 RNA 정화 뒤 DNase 소화 단계는 오염 DNA를 소화 하기 위해 낮은 풍부 목표의 분석에 대 한 권장.<ol>
<li>동결 건조 된 DNase (1500 Kunitz 단위) RNase 무료의 550 µ L에 주사기, 유리병, 반전으로 부드럽게 혼합을 사용 하 여 물 어 aliquots로 재구성된 재고 솔루션 분할 해산.</li>
		<li>15 µ g의 RNA 샘플의 계산된 볼륨 1.5 mL 튜브에 전송, DNase 소화의 10 µ L 버퍼 키트 ( 재료의 테이블에나열 된), DNase의 2.5 µ L에서에서 나 재고 솔루션 및 100 µ L. 물 RNase 무료 10 분 동안 실 온에서 품 어.</li>
		<li>조직 세포의 용 해 버퍼의 350 µ L 추가 (장비, 재료의 표참조) pipetting으로 혼합.</li>
		<li>Pipetting으로 100% 에탄올과 혼합의 250 µ L를 추가 합니다.</li>
		<li>새로운 스핀 열 및 15 12000 x g에서 원심 분리기로 전체 볼륨 (700 µ L) 전송 s.</li>
		<li>새로운 컬렉션 튜브로 필터를 전송, 열 및 2 분 12000 x g에서 원심 분리기를 80% 에탄올 500 µ L를 추가 합니다.</li>
		<li>새로운 컬렉션 튜브 필터; 건조 스핀 열 및 5 분 동안 12000 x g에서 원심 분리기의 뚜껑을 열으십시오 다음 1.5 mL 튜브에 필터를 전송.</li>
		<li>필터 십 분 12000 x g에서 원심 분리기에 직접 RNase 무료 물 14 µ L를 추가 합니다.</li>
		<li>얼음에 샘플을 계속 벤치 정상 분 광 광도 계에는 샘플의 2 µ L를 사용 하 여 정량화를 진행 하거나 사용까지-80 ° C에서 RNA를 저장할.</li>
	</ol>
</li>
</ol>2입니다. cDNA 합성
<ol><li>RNA, 믹스 마스터의 4 µ L, 역전사, 및 살 균 PCR 튜브에서 20 µ L의 최종 볼륨을 RNase 무료 물 1 µ L의 장소 1000 ng. 부드럽게 혼합 하 고 아래로 회전.</li>
	<li>다음과 같은 조건 적용 열 cycler에 반응 혼합 품 어: 25 ° C, 42 ° C, 85 ° c.에 5 분에서 30 분에서 5 분</li>
	<li>튜브를 짧게 원심 dPCR 분석을 진행 하거나 필요할 때까지-20 ° C에서 저장.</li>
</ol>3. 디지털 PCR 반응 설정
<ol><li>
dPCR 반응 혼합 및 준비 샘플
	<ol>
<li>적어도 20 분 동안 실 온에서 시험 하 고 마스터 믹스 해 동.</li>
		<li>300의 농도에 cDNA 샘플 희석 물 6 µ L에서 ng.</li>
		<li>부드럽게 소용돌이 마스터 믹스와 믹스 마스터 믹스의 8.7 µ L, CDH1a 사용자 정의 설계 분석 결과 뇌관의 0.87 µ L과 nuclease 무료 물 1.83 µ L 무 균 튜브에 11.4 µ L의 최종 볼륨에 대 한 준비. 주: CDH1a 사용자 정의 설계 분석 결과 뇌관 세부 정보에 대 한 테이블의 자료를 참조 하십시오.</li>
		<li>준비 된 믹스의 11.4 µ L 희석된 cDNA 샘플을 전송, 부드럽게, 혼합 하 고 짧게 원심. 참고: 볼륨 20% 초과를 pipetting 볼륨 손실에 대 한 보상을 포함 됩니다. 모든 샘플 및 아무 템플릿 컨트롤 (NTC)에 대 한 믹스를 준비 합니다.</li>
	</ol>
</li>
	<li>
칩 준비 참고: 최적의 결과 대 한 로드 칩 최대한 빨리.<ol>
<li>칩 로더에 연결 하 고는 표시등이 녹색 밝혀 졌 때까지 기다립니다.</li>
		<li>살짝 다시 플런저를 당겨 침수 액체 주사기의 뚜껑을 제거 1-2 mm이 고이 단계를 촉진 하 고 팁을 공개.</li>
		<li>새로운 칩을 받아 고 샘플 연관 뚜껑에 작성 된 코드의 숙지 합니다.</li>
		<li>뚜껑 신중 하 게 그것의 측면에 의해, 보호 필름 벗 겨 누른 올바른 방향에서 위로 끈 적 얼굴 뚜껑을 배치.</li>
		<li>신중 하 게 칩을 내부 부분을 건드리지 않도록 돌을 선택 하 고 열 클램프 레버를 눌러 올바른 위치에 있는 칩 둥지에 그것을 로드.</li>
		<li>로더에 새로운 로드 블레이드를 로드 하 고 부드럽게 되도록 그것 확고 하 게 자리에 밀어.</li>
		<li>기포 없이 로드 블레이드에 dPCR 반응 혼합의 14.5 µ L을 전송 배포는 칩에 볼륨 버튼을 로드 블랙은 보도 후 블레이드, 왜곡 또는.</li>
		<li>침수 액체 주사기를 사용 하 여 전송 팁과 표면 접촉 하지 않도록 주의 복용 칩 표면에 약 20 방울. 참고: 그것은 가장자리에 액체를 흘리 고 하지 않고 전체 표면을 커버 하는 것이 중요입니다.</li>
		<li>칩을 접촉 하 고 15 눌러 뚜껑을 로더 팔 회전 s.</li>
		<li>칩을 놓고 팔의 위치에 반환을 뚜껑 단추를 누릅니다.</li>
		<li>조립된 칩 45 ° 각도로 하 고 신중 하 게 채우기 포트를 통해 주사기로 침수 액체 분배, 칩 없는 기포 확인을 약간 회전 누른 살 균 삭제 기능으로 어떤 과잉 액체를 제거.</li>
		<li>부드럽게 필 링 멀리 칩 뚜껑과 보도 위에 레이블 적어도 5에 대 한 채우기 포트를 통해 하 여 칩 케이스를 밀봉 s.</li>
		<li>열 cycler에서 로드할 준비가 될 때까지 어둠 속에 칩을 저장 합니다. 참고: 준비 된 칩 2 시간 이내 사용 해야 합니다.</li>
	</ol>
</li>
	<li>
dPCR 반응
	<ol>
<li>뚜껑 열고 단일 블록을 사용 하는 경우에 두 블록에 어댑터를 설치 합니다.</li>
		<li>올바른 위치에 샘플 블록에 칩을 놓습니다. 참고: 채우기 포트 칩의 윈도우를 방해 하지 않고 상단에 떠 있는 공기 방울을 허용 하는 높은 위치에서 열 cycler의 앞 쪽으로 지향 되어야 합니다. 빈 칩을 사용 하 여 두 개의 블록을 균형.</li>
		<li>칩을 완전히 커버 샘플 블록에 열 패드를 하다.</li>
		<li>뚜껑을 닫고 PCR 실행, 다음과 같은 조건 적용 시작: 10 분; 96 ° C에서 개최 30 60 ° C 2 분 및 98 ° C의 45 주기 s; 2 분;에 대 한 60 ° C에서 개최 4 ° c.에서 개최 열 cycler 끄고 칩 적어도 10 분 동안 실 온에서 해 동. 참고: 칩 분석 1 시간 내에서 수행 되어야 합니다.</li>
	</ol>
</li>
	<li>
칩 분석
	<ol>
<li>악기의 뚜껑을 열고 열 패드를 제거 다음 어댑터에서 칩을 제거 합니다. 참고: 분석까지, 깨끗 한 위치에 칩을 저장 합니다.</li>
		<li>소 프로 파 놀과 살 균 지우기 칩 표면 청소. 참고: 누수 또는 잠재적인 문제에 대 한 각 칩을 검사 합니다.</li>
		<li>데이터를 저장 하는 검출기 시스템에 USB를 삽입 합니다.</li>
		<li>검출기 시스템의 칩 트레이 열고, 올바른 위치에 있는 칩 보여지는 로드 한 다음 트레이 닫습니다.</li>
		<li>30 대기 처리용, s 다음 칩을 제거 하 고 다음 중 하나를 삽입.</li>
		<li>모든 처리 칩에 대 한 완료 후 파일을 전송 하는 컴퓨터에 USB를 삽입 분석을 기다립니다. 참고: 분석에 대 한 총 시간은 약 3 분/칩 2 이다.</li>
	</ol>
</li>
</ol>4. 데이터 분석 및 해석
<ol><li>모든 다운스트림 분석을 수행 하는 데 필요한 클라우드 기반 소프트웨어 플랫폼에 연결 합니다.</li>
	<li>프로젝트를 만들고 관심의 칩의 모든 데이터 파일을 가져올.</li>
	<li>샘플 이름;을 입력합니다 염료 및 분석 결과 "정의 칩" 탭에서 사용을 선택 합니다.</li>
	<li>얼마나 철저 하 게 샘플 칩에 로드 된 및 얼마나 많은 데이터 요소는 evaluable 검사 "검토 데이터" 탭에 그것을 시각화 하 여 칩 허용 인지 확인 합니다. 참고: 보다 13000 evaluable 데이터 요소에 대 한 칩을 거부 합니다.</li>
	<li>화면;의 오른쪽에 선택한 칩의 점도로 이동 모든 칩에 6000 fluorescein amidite (FAM) 기자 염료 신호 (y 축)에 대 한 임계값을 적용 합니다. 참고: 설정 임계값 사용 분석에 근거 하 여 달라질 수 있습니다.</li>
	<li>제거는 분산형에 상대적인 자리를 선택 하 여 거짓 긍정적인 결과 방지 하기 위해 어떤 모호한 긍정적인 신호 플롯 올가미 도구를 사용 하 고 "미정"에서. 모든 나머지 긍정적인 명소 드문 대상 분석의 cDNA 복사본의 존재를 나타냅니다.</li>
</ol>

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

저자는이 작품에 대 한 관심의 없습니다 충돌을 보고합니다.

dPCR는 원래 위해 개발 DNA 분자 측정10,11,,1213 시간 microRNAs 및 RNA 사본5의 정량화에이 기술을 적응 했다 , 1415. 이 프로토콜에서 우리는 신선한 냉동 조직 샘플에서 파생 된 희귀 증명서의 탐지를 포함 하는 응용 프로그램의 목록을 확...

CDH1 유전자 세포 접착, 생존, 확산, 및 마이그레이션1의 규제를 통해 정상적인 위 상피의 유지에 관여 하는 핵심 요소 E cadherin 위한 인코딩합니다. 해로운 생식의 결과로 전자 cadherin 단백질의 손실 또는 CDH1 의 체세포 변경 GC2,3의 개발과 관련 된 되었습니다. Intron의 유전자 2에서 발생 하는 비 정식 성적 증명서 또한 위 발암4,5에 역할을 가설 되어 있다. 특히, 이러한 한 사본, CDH1a, GC 셀 라인에 표현 될 표시 되었습니다 하지만 결 석 정상 위4에서. 우리는 최근 칩 기반 dPCR5를 사용 하 여 GC 환자에서 GC 조직 샘플에서 CDH1a 를 감지. dPCR CDH1a 유전자 사본 장 GC에 정상 조직에의 존재를 처음으로 평가 하는 데 사용 되었다.
유전자 발현을 확인 하기 위해 표준 방법은 실시간 양이 많은 PCR (정량)입니다. 그러나, 결과 데이터 때로는 변수 수 이며 가난한 품질, 특히 때 샘플에는 대상의 수준 낮은. 이 변화는 일반적인 증폭 및 경쟁 측 반응6뇌관 어 닐 링, 및 중 합 효소 활동을 억제 하는 오염 물질에 의해 발생할 수 있습니다.
DPCR의 기본적인 생 화 확 적인 원리는 정량의 그들과 유사 하, dPCR genomic DNA (gDNA)의 매우 정확한 측정을 위해 수 있도록 하는 몇 가지 장점을 보여줍니다 / 보완 DNA (cDNA) 분자. 실제로, dPCR 각각 잘 0 또는 단일 대상 분자 포함 되도록 수천 웰 스, 샘플의 보정 분할에 의존 하는 끝점 반응입니다. 증폭 대상의 복사본을 포함 하는 우물에만 발생 합니다 그리고 형광 신호에 의해 표시 됩니다. 원래 샘플에서 대상 분자의 절대 수 다음 이항 포아송 통계7를 사용 하 여 전체 파티션을 긍정적인의 비율을 결정 하 여 계산할 수 있습니다.
DPCR 기술 표준 곡선을 실행 하기 위한 필요성을 제거 하는 또한, 및, 따라서, 연결 된 바이어스 및 다양성, 대상8,9;의 직접 정량화에 대 한 허용 그것은 오염 물질과 효율성 억제제10; 높은 관용 때문에 독립적으로 더 정확 하 고 재현 가능한 결과 생산 하 그것 더 과민 하 고 정량, 보다 구체적 이며 따라서 드문 대상의 검출에 대 한 신뢰할 수 있는 방법입니다. 마지막으로, 여러 반응으로 샘플의 분할 배경 분자와 경쟁 줄어들고 대상 검출, 증폭을 가능 하 게 하 고 gDNA/cDNA6의 단일 분자의 검출 한계 향상 . 검색 및 칩 기반 dPCR에 의해 핵 산의 정량화 점점에 적용 된 복사 번호 유사, DNA의 정량화는 파편, 그리고 돌연변이 분석11,,1213, 주어진는 정밀도 낮은 자료 입력 방법의 요구 사항. 또한, dPCR는 최근 두 microRNAs14 그리고 유전자 사본5,15의 분석에 통합 되었습니다.

<table><tbody><tr><td>TRIazol Reagent</td><td>Thermo Fisher Scientific</td><td>15596018</td><td></td></tr><tr><td>Glycogen 20 mg/ml</td><td>ROCHE</td><td>10901393001</td><td></td></tr><tr><td>RNeasy MinElute Cleanup kit</td><td>QIAGEN</td><td>74204</td><td></td></tr><tr><td>iScript cDNA Synthesis kit</td><td>BioRad</td><td>1708891</td><td></td></tr><tr><td>QuantStudio 3D Digital PCR Master Mix v2</td><td>Thermo Fisher Scientific</td><td>A26358</td><td></td></tr><tr><td>CDH1a IDT custom designed assay</td><td>Integrated DNA Technologies (IDT)</td><td>NA</td><td>F) GCTGCAGTTTCACTTTTAGTG&lt;br/&gt; (R) ACTTTGAATCGGGTGTCGAG&lt;br/&gt; (P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/&lt;br/&gt; [dPCR optimized assay concentrations: 900 nM (F),&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; 900 nM (R), 250 nM (P)]</td></tr><tr><td>QuantStudio 3D Digital PCR 20K Chip Kit v2</td><td>Thermo Fisher Scientific</td><td>A26316</td><td></td></tr><tr><td>Heraeus Biofuge Fresco</td><td>Thermo&amp;nbsp; Scientific</td><td>75002402</td><td></td></tr><tr><td>Thermocycler (Labcycler)</td><td>Sensoquest</td><td>011-103</td><td></td></tr><tr><td>GeneAmp PCR System 9700</td><td>Thermo Fisher Scientific</td><td>N805-0200</td><td></td></tr><tr><td>Dual Flat Block Sample Module</td><td>Thermo Fisher Scientific</td><td>4425757</td><td></td></tr><tr><td>QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td><td>Thermo Fisher Scientific</td><td>4486414</td><td></td></tr><tr><td>QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td><td>Thermo Fisher Scientific</td><td>4485513</td><td></td></tr><tr><td>QuantStudio 3D Digital PCR Chip Loader</td><td>Thermo Fisher Scientific</td><td>4482592</td><td></td></tr><tr><td>QuantStudio 3D Digital PCR Instrument with power cord</td><td>Thermo Fisher Scientific</td><td>4489084</td><td></td></tr></tbody></table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

반면 결 석 CDH1a, CDH1 유전자의 정식이 아닌 대 본 일부 위 암 (GC) 셀 라인에 표현 될 발견 되었습니다 정상 위 점 막에서. 최근에, 우리는 GC 가진 환자에서 얻은 신선한 냉동 종양 조직에 CDH1a 사본 이체를 감지. 조직 샘플에서이 이체의 식 칩 기반 디지털 PCR (dPCR) 접근 방식에 의해 여기에 제시 된 조사 했다. dPCR 핵 산의 정확한, 강력한, 그리고 매우 중요 한 측정에 대 한 잠재력을 제공 하 고 점점 더 다양 한 분야에 많은 응용 프로그램에 대 한 활용. dPCR는 감지 드문 목표; 또한, dPCR는 교정기 및 표준 곡선에 대 한 필요 없이 핵 산의 완전 하 고 정확한 정량화에 대 한 가능성을 제공합니다. 사실, 증폭 효율과 억제제에 내성 향상 배경에서 대상을 풍요롭게 반응 분할. 이러한 특성 dPCR CDH1a 희소 한 대 본의 검출을 위한 최적의 도구를 확인합니다.

여기에 제시 된 절차를 사용 하 여, 우리는 위 신선한 냉동 조직에 드문 사본 이체 CDH1a 의 표현에 대 한 확인 합니다. DPCR에 의해 분석 및 11 추가 종양 샘플 21 쌍 정상 및 암 조직 샘플에서 수행 되었다. 아니 정상적인 조직 샘플 보여이 희소 한 대 본5의 존재 하는 반면 CDH1a 15 중 32 (47%) 종양에서 감지 했다. 우리의 분석으로 비 균질 로드 칩 미...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

칩 기반 디지털 PCR에 의해 신선한 냉동 위 암 조직에서 CDH1 드문 사본 이체의 탐지

원고는 칩 기반 디지털 PCR 분석 결과를 신선한 냉동 정상에 드문 CDH1 사본 이체 (CDH1a) 및 위 암 환자에서 얻은 종양 조직 검출을 설명 합니다.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

detection-cdh1-rare-transcript-variant-fresh-frozen-gastric-cancer

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

6.1K 조회수.  Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS. 원고는 칩 기반 디지털 PCR 분석 결과를 신선한 냉동 정상에 드문 CDH1 사본 이체 (CDH1a) 및 위 암 환자에서 얻은 종양 조직 검출을 설명 합니다.

비디오: Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We developed an in vitro fully human preclinical model of a co-culture of breast cancer cells and monocytes undergoing differentiation towards osteoclasts. We optimized a model of osteoclastogenesis starting from a sample of peripheral blood collected from healthy donors. Peripheral blood mononuclear cells (PBMCs) were first separated by density gradient centrifugation, seeded at a high density and induced to differentiate by adding two growth factors (GFs): receptor activator of nuclear factor-&#954;B ligand (RANKL) and macrophage colony-stimulating factor (MCSF). The cells were left in culture for 14 days and then fixed and analyzed by downstream analysis. In osteolytic bone metastases, one of the effects of cancer cell arrival in bone is the induction of osteoclastogenesis. We thus challenged our model with co-cultures of breast cancer cells to study the differentiation power of cancer cells with respect to GFs. A straightforward way of studying cancer cell-osteoclast interaction is to perform indirect co-cultures based on the use of conditioned medium collected from breast cancer cell cultures and mixed with fresh medium. This mixture is then used to induce osteoclast differentiation. We also optimized a method of direct co-culture in which cancer cells and monocytes undergoing differentiation share the medium and exchange secreted factors. This is a significant improvement over the original indirect co-culture method as researchers can observe the reciprocal interactions of the two cell types and perform downstream analyses for both cancer cells and osteoclasts. This method enables us to study the effect of drugs on the metastatic bone microenvironment and to seed cell lines other than those derived from breast cancer. The model can also be used to study other diseases such as osteoporosis or other bone conditions.

This protocol describes development of an in vitro human preclinical model of osteoclastogenesis from peripheral blood monocytes cultured with breast cancer cell lines to mimic the cancer cell-osteoclast interaction. The model could be used to further our understanding of bone metastasis formation and improve therapeutic options.

말 초 혈액 Monocytes 유 방 암 세포 라인 공동 경작에서 Osteoclastogenesis의 인간의 전 임상 모델의 개발

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

연구

암 연구학

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. However, the application of this method is challenging due to its low sensitivity in analyzing the trace amount of ctDNA in the blood. Furthermore, the method may generate false positive and negative results from this sequencing and subsequent analysis. To improve the feasibility and reliability of ctDNA detection in the clinic, here we present a technique which enriches rare mutations for sequencing, Enrich Rare Mutation Sequencing (ER-Seq). ER-Seq can distinguish a single mutation out of 1 x 107 wild-type nucleotides, which makes it a promising tool to detect extremely low frequency genetic alterations and thus will be very useful in studying disease heterogenicity. By virtue of the unique sequencing adapter&#39;s ligation, this method enables an efficient recovery of ctDNA molecules, while at the same time correcting for errors bidirectionally (sense and antisense). Our selection of 1021 kb probes enriches the measurement of target regions that cover over 95% of the tumor-related driver mutations in 12 tumors. This cost-effective and universal method enables a uniquely successful accumulation of genetic data. After efficiently filtering out background error, ER-seq can precisely detect rare mutations. Using a case study, we present a detailed protocol demonstrating probe design, library construction, and target DNA capture methodologies, while also including the data analysis workflow. The process to carry out this method typically takes 1-2 days.

This manuscript describes a technique for detecting mutations of low frequency in ctDNA, ER-Seq. This method is differentiated by its unique use of two-directional error correction, a special background filter, and efficient molecular acquirement.

다음 세대 시퀀싱을 사용 하 여 CtDNA에서 희소 한 변이의 탐지

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, and prediction of treatment resistance. Starting from the hypothesis that androgen receptor (AR) gene copy number (CN) gain is a frequent event in metastatic castration resistance prostate cancer (mCRPC), we propose to analyze this event in cfDNA as a potential predictive biomarker.
We evaluated AR CN in cfDNA using 2 different real-time PCR assays and 2 reference genes (RNaseP and AGO1). DNA amount of 60 ng was used for each assay combination. AR CN gain was confirmed using Digital PCR as a more accurate method. CN variation analysis has already been demonstrated to be informative for the prediction of treatment resistance in the setting of mCRPC, but it could be useful also for other purposes in different patient settings. CN analysis on cfDNA has several advantages: it is non-invasive, rapid and easy to perform, and it starts from a small volume of serum or plasma material.

This manuscript describes the copy number variation analysis performed in serum or plasma DNA using real-time PCR approach. This method is suitable for the prediction of drug resistance in castration resistant prostate cancer patients, but it could be informative also for other diseases.

혈 청 및 혈장 복사 번호 검출 실시간 PCR를 사용 하 여

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as tumors. Because digital polymerase chain reactions (PCR) enable the precise quantification of DNA copy number variants, they are becoming an essential tool for detecting rare genetic variations, such as drug-resistant mutations. It is expected that molecular diagnoses using digital PCR (dPCR) will be available in clinical practice in the near future; thus, how to efficiently conduct dPCR with human genetic material is a hot topic. Here, we introduce a method to detect Adenomatous polyposis coli (APC) somatic mosaicism using dPCR with the chip-in-a-tube format, which allows eight dPCR reactions to be simultaneously conducted. Care should be taken when filling and sealing the reaction mixture on the chips. This article demonstrates how to avoid the over- and underestimation of positive partitions. Furthermore, we present a simple procedure for collecting the dPCR product from the partitions on the chips, which can then be used to confirm the specific amplification. We hope that this methods report will help promote the dPCR with the chip-in-a-tube method in genetic research.

Digital polymerase chain reaction (PCR) is a useful tool for the high-sensitivity detection of single nucleotide variants and DNA copy number variants. Here, we demonstrate key considerations for measuring rare variants in the human genome using digital PCR with the chip-in-a-tube format.

튜브에 칩 형식을 사용 하 여 산발적 인 가족 용 대 환자에 있는 유전 변이 대 한 디지털 중 합 효소 연쇄 반응 분석 결과

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and eosin (H&amp;E) staining but can be visualized through elastic staining. One of the important benefits of elastic staining is that it makes it easy to determine whether tumor cells have invaded beyond the elastic lamina. This helps in examining the extent of peritoneal surface invasion, thereby distinguishing the pT3 and pT4 stages in gastrointestinal cancer. In this study, we present a protocol to identify elastic fibers in the formalin-fixed, paraffin-embedded pT3N0M0 gastric cancer tissue sections. We prepare 5-&#181;m paraffin sections fixed on slides, and then all the slides are deparaffinated and rehydrated during the staining procedure. Subsequently, all the sections are oxidized by potassium permanganate, bleached by oxalic acid, stained by elastic staining, and counterstained by Van Gieson's. Finally, we examine the effect of staining; elastic lamina is stained blue-black and collagen fibers are stained red, while the cancer cells are stained in varying shades of yellow. We also describe in detail the methods used for determining the positional relationship between cancer cells and elastic lamina. This method is simple, low-cost, and widely applicable in the identification of peritoneal surface invasion in gastrointestinal cancer because of its outstanding selectivity for elastic fibers and authentic results.

Here, we present a protocol of elastic staining to identify elastic fibers in pT3N0M0 gastric cancer tissues on formalin-fixed, paraffin-embedded sections. Subsequently, we describe a method to determine whether tumor cells invade beyond the elastic lamina.

pT3N0M0 위암 조직의 파라핀 내장 슬라이드에 탄성 염색

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Detection and Monitoring of Tumor Associated Circulating DNA in Patient Biofluids

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular sub-classification and temporal monitoring of tumor response to therapy. Here, we describe our dPCR-based method for the detection of tumor somatic mutations in cell free DNA (cfDNA), readily available in&#160;patient biofluids. Although limited in the number of mutations that can be tested for in each assay, this method provides a high level of sensitivity and specificity. Monitoring of mutation abundance, as calculated by MAF, allows for the evaluation of tumor response to therapy, thereby providing a much-needed supplement to radiographic imaging.

Here, we present a protocol to detect tumor somatic mutations in circulating DNA present in patient biological fluids (biofluids). Our droplet digital polymerase chain reaction (dPCR)-based method enables quantification of the tumor mutation allelic frequency (MAF), facilitating a minimally invasive complement to diagnosis and temporal monitoring of tumor response.

환자 생체 유체에서 종양 관련 순환 DNA의 검출 및 모니터링

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular ...

Genome-Wide Analysis of DNA Methylation in Gastrointestinal Cancer

DNA methylation is an important epigenetic change that is biologically meaningful and a frequent focus of cancer research. Genome-wide DNA methylation is a useful measure to provide an accurate analysis of the methylation status of gastrointestinal (GI) malignancies. Given the multiple potential translational uses of DNA methylation analysis, practicing clinicians and others new to DNA methylation studies need to be able to understand step by step how these genome-wide analyses are performed. The goal of this protocol is to provide a detailed description of how this method is used for the biomarker identification in GI malignancies. Importantly, we describe three critical steps that are needed to obtain accurate results during genome-wide analysis. Clearly and concisely written, these three methods are often lacking and not noticeable to those new to epigenetic studies. We used 48 samples of a GI malignancy (gastric cancer) to highlight practically how genome-wide DNA methylation analysis can be performed for GI malignancies.

Herein, we describe a procedure for genome-wide analysis of DNA methylation in gastrointestinal cancers. The procedure is of relevance to studies that investigate relationships between methylation patterns of genes and factors contributing to carcinogenesis in gastrointestinal cancers.

위장암에서 DNA 메틸화의 게놈 전체 분석

DNA methylation is an important epigenetic change that is biologically meaningful and a frequent focus of cancer research. Genome-wide DNA methylation is ...

Ion Torrent 시퀀싱을 사용한 위암의 SNP 유도 5-FU 요법

Multi-Gene Single Nucleotide Polymorphism Detection in Gastric Cancer Based on Ion Semiconductor Sequencing Platform

Gastric cancer is a common heterogeneous tumor. Most patients have advanced gastric cancer at the time of diagnosis and often need chemotherapy. Although 5-fluorouracil (5-FU) is widely used for treatment, its therapeutic sensitivity and drug tolerance still need to be determined, which emphasizes the importance of individualized administration. Pharmacogenetics can guide the clinical implementation of individualized treatment. Single nucleotide polymorphisms (SNPs), as a genetic marker, contribute to the selection of appropriate chemotherapy regimens and dosages. Some SNPs are associated with folate metabolism, the therapeutic target of 5-FU. Methylenetetrahydrofolate reductase (MTHFR) rs1801131 and rs1801133, dihydrofolate reductase (DHFR) rs1650697 and rs442767, methionine synthase (MTR) rs1805087, gamma-glutamyl hydrolase (GGH) rs11545078 and solute carrier family 19 member 1 (SLC19A1) rs1051298 have been investigated in different kinds of cancers and antifolate antitumor drugs, which have potential forecasting and guiding significance for application of 5-FU. The ion torrent next-generation semiconductor sequencing technology can rapidly detect gastric cancer-related SNPs. Each time a base is extended in a DNA chain, an H+ will be released, causing local pH changes. The ionic sensor detects pH changes and converts chemical signals into digital signals, achieving sequencing by synthesis. This technique has low sample requirement, simple operation, low cost, and fast sequencing speed, which is beneficial for guiding individualized chemotherapy by SNPs.

저자 스포트라이트: 위암에서 플루오로우라실 반응을 위한 유전자 프로파일링

This protocol proposes holistic laboratory procedures required to detect single nucleotide polymorphisms in gastric cancer samples based on an ion semiconductor sequencing platform. The target sequences, ligating adapters, library amplification and purification, and quality control criteria are also described in detail.

Ion Semiconductor Sequencing Platform을 기반으로 한 위암의 Multi-gene Single Nucleotide Polymorphism 검출

Gastric cancer is a common heterogeneous tumor. Most patients have advanced gastric cancer at the time of diagnosis and often need chemotherapy. Although ...

칩 기반 디지털 PCR에 의해 신선한 냉동 위 암 조직에서 CDH1 드문 사본 이체의 탐지

요약

더 많은 비디오 탐색

이 비디오의 챕터

말 초 혈액 Monocytes 유 방 암 세포 라인 공동 경작에서 Osteoclastogenesis의 인간의 전 임상 모델의 개발

다음 세대 시퀀싱을 사용 하 여 CtDNA에서 희소 한 변이의 탐지

혈 청 및 혈장 복사 번호 검출 실시간 PCR를 사용 하 여

튜브에 칩 형식을 사용 하 여 산발적 인 가족 용 대 환자에 있는 유전 변이 대 한 디지털 중 합 효소 연쇄 반응 분석 결과

pT3N0M0 위암 조직의 파라핀 내장 슬라이드에 탄성 염색

환자 생체 유체에서 종양 관련 순환 DNA의 검출 및 모니터링

위장암에서 DNA 메틸화의 게놈 전체 분석

Ion Semiconductor Sequencing Platform을 기반으로 한 위암의 Multi-gene Single Nucleotide Polymorphism 검출

Ion Semiconductor Sequencing Platform을 기반으로 한 위암의 Multi-gene Single Nucleotide Polymorphism 검출

Ion Semiconductor Sequencing Platform을 기반으로 한 위암의 Multi-gene Single Nucleotide Polymorphism 검출