Name: visualization of cellular electrical activity in zebrafish early embryos and tumors
Uploaded: 2018-04-25T14:00:00.000+00:00
Duration: 8 min 55 s
Description: Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

이 간행물에 보고 된 연구 작업에 의해 국립 연구소의 일반 의료 과학 수상 번호 R35GM124913, 퍼듀 대학 PI4D 인센티브 프로그램, 그리고 PVM 내부 경쟁에서 국립 보건원의 지원 기초 연구 자금 프로그램입니다. 내용은 전적으로 저자의 책임 이며 반드시 자금 에이전트의 공식 의견을 대표 하지 않는다. 우리 Tol2 구문, ASAP1 구문에 대 한 마이클 린 고이치 가와카미를 감사 하 고 레너드 Zon ubi 발기인에 대 한 Addgene를 통해 생성.

Zebrafish는 AAALAC 승인 동물 시설에 보관 되어있습니다 그리고 모든 실험 프로토콜 퍼듀 동물 관리 및 사용 위원회 (PACUC)에 의해 승인에 따라 실시 했다.
1. Tol2 Transposon 플라스 미드 구조 준비
참고: Tol2, 메 다카 물고기에서 발견 되었다 transposon zebrafish 연구 커뮤니티8,9사용 널리 있다. 그것은 되었습니다 성공적으로 게이트웨이 사이트 재결합 기반 복제 시스템에 채택 및 Tol2 키트10로 알려진. Tol2 키트는 또한 transgenesis의 효율성을 증가 하는 동안 사용자 지정된 식 구문을 만드는의 더 편리한 방법에 대 한 수 있습니다. 따라서,이 시스템을 활용 하 고 검증된 유비퀴틴 발기인 ASAP111를 사용 하 여 유비 쿼터 스 ASAP1 식 제 브라 라인 만들기 쉬운 결정 이었다.
<ol><li>중간 항목 ASAP1 구조를 만들기: pDONR221 ASAP1<ol>
<li>Addgene에서 pcDNA3.1/순수 하지 않아-CAG-ASAP1 (플라스 미드 #52519), 유전으로 인코딩된 전압 센서 ASAP1 구조를 취득 합니다. ASAP1 코딩 영역 증폭 PCR 뇌관 (그림 1)의 5' 끝에 attB 시퀀스 형벌 사용자 지정된 뇌관 (attB1-ASAP1F와 attB2-ASAP1R)를 사용 하 여 설정 합니다. Phusion DNA 중 합 효소의 높은 효율을 위해 선택 되었다 그리고 PCR 조건12이전 게시 된 프로토콜 따라 최적화 된 했다.</li>
		<li>태 젤 200 µ L 팁, 일반 피 펫을 사용 하 여 1%로 50 µ L PCR 제품을 로드 하 고 약 30 분 동안 가로 젤 탱크에 160 V에서 전기 영동을 수행.</li>
		<li>UV transilluminator에서 젤 확인 (353 nm), UV transilluminator 아래 블레이드/메스를 사용 하 여 이전에 게시13,14, 원하는 밴드 소비 세 그리고 깨끗 한 1.5 mL microcentrifuge로 DNA 포함 하 젤 샘플을 넣어 튜브입니다.</li>
		<li>ASAP1 PCR 제품 젤 정화를 수행 합니다. 제조업체의 지시에 따라 상업 DNA 젤 정화 키트를 사용 하 여 삭제 젤에서 DNA를 복구 하 고 물 20 µ L로 DNA을 elute. 샘플으로 1 µ L를가지고 고는 분 광 광도 계를 사용 하 여 DNA 농도 측정. 빈 컨트롤15로 물을 사용 하 여 소프트웨어 지침 흐름.</li>
		<li>받아 100 ng의 PCR 제품을 정화 하 고 150 믹스 테의 10 µ L 플라스 미드 pDONR221의 ng 버퍼 (10 mM Tris, 1 mM EDTA pH 8.0)16. 반응으로 혈압 Clonase II의 2 µ L을 추가 하 고 품 어 하룻밤 실 온에서 반응.</li>
		<li>둘째 날에는 반응으로 가수분해 K의 1 µ L을 추가 하 고 품 어 30 분 동안 37 ° C에서 반응.</li>
		<li>변환을 수행 합니다. 반응 전송 및 Top10 유능한 대장균 세포 및 품 어 30 분 동안 얼음에 셀의 50 µ L 함께 섞는다. 다음 전송 1 분에 42 ° C 물 목욕으로 반응 관은 즉시 튜브를 제거 하 고 2 분 동안 얼음에 품 어. 다음, 튜브 37 ° C 통에 넣고 1 시간을 위해 그것을 품 어.</li>
		<li>튜브를 꺼내와 대 파운드 플레이트에 셀 접시. 다음, 접시 하룻밤 (16-18 h) 37 ° c.에 품 어</li>
		<li>단일과 잘 분리 된 식민지를 선택 하 고 14 mL 셀 문화 튜브 파운드 매체의 3 mL에 접종. 하룻밤 250 rpm (분당 회전)의 회전 속도 함께 통에 37 ° C에서 문화 그들.</li>
		<li>Miniprep의 명령 수동17다음 상업 miniprep 키트를 사용 하 여 수행 합니다.</li>
		<li>3-4 플라스 미드를 시퀀스 생어 시퀀싱 식별 긍정적인 pDONR221-ASAP1 M13F 및 M13R 시퀀싱 뇌관을 사용 하 여 복제.</li>
	</ol>
</li>
	<li>Microinjection에 대 한 Tol2 구조를 만들기: pDestTol2-유비-ASAP1<ol>
<li>시퀀싱 확인 pDONR221 ASAP1 복제 및 측정의 DNA 농도 분 광 광도 계 다음 빈 제어15물을 사용 하 여 소프트웨어 명령을 사용 하 여 선택 합니다.</li>
		<li>PDONR221-ASAP1의 100 µ g을 100 µ g Tol2 키트 5-엔드 플라스 미드의 혼합 (pENTR5'_ubi, Addgene #27320), 100 µ g (Tol2 키트 #302) p3E-polyA의 및 pDestTol2pA2의 150 µ g (Tol2 키트 #394). 8 µ L 총 볼륨 조정 튜브 1.5 mL microcentrifuge TE 버퍼 (10 mM Tris, 1 mM EDTA, pH 8.0)를 사용 하 고 2-5 s 간단한 소용돌이 의해 잘 혼합. 그런 다음 LR Clonase 2 플러스, 2 µ L을 추가 하 고 품 어 하룻밤 실 온에서 반응.</li>
		<li>두 번째 날, 10 µ L 피 펫을 사용 하 여 반응에 가수분해 K의 1 µ L을 추가 하 고 품 어 30 분 동안 37 ° C에서 반응.</li>
		<li>변환을 수행 하 고 (단계 1.1.7-11) 위에서 설명한 대로 긍정적인 클론을 식별 합니다.</li>
		<li>시퀀싱의 DNA 농도 측정 pDestTol2-유비-ASAP1 복제 (그림 1B)15분 광 광도 계 사용 하 여 확인 합니다. 일반적으로 농도 200ng / µ L입니다.</li>
	</ol>
</li>
</ol>2. Tol2 Transposase mRNA와 주입 솔루션 준비
<ol><li>행진 대장균 글리세롤 주식에 있는 파운드 판 (100 µ g/mL 암 피 실린) pCS2FA transposase 플라스 미드 (Tol2 키트 #396)의 멸 균된 접종 루프를 사용 하 여. 인큐베이터에서 37 ° C에서 접시를 밤새 품 어. 다음 날, 단일 식민지를 선택 하 고 멸 균된 10 µ L 피 펫 팁을 사용 하 여 그것의 파운드 (100 µ g/mL 암 피 실린) 3 mL에 접종. 하룻밤 250 rpm의 회전 속도 함께 통에 37 ° C에서 문화.</li>
	<li>그것의 사용 설명서에 따라 상업 miniprep 키트를 사용 하 여 대장균 문화에 miniprep를 수행 합니다. 1 분 14000 rpm에서 원심 분리기로 TE 버퍼의 30-50 µ L에 플라스 미드 DNA elute 그리고 DNA 농도 분 광 광도 측정.</li>
	<li>내가 가진 플라스 미드의 1-2 µ g endonuclease 선형화 하 고 정화 청소 키트 후 하지의 사용 설명서를 다음 DNA와 DNA 소화. 14000 rpm에서 1 분간 centrifuging 여 물 5 µ L로 DNA를 elute. 에 대 한 예상된 농도 200-300 ng / µ L.</li>
	<li>녹음 방송 생체 외에서 수행 하지 나 상업 SP6 전송 키트를 사용 하 여 DNA 템플렛으로 pCS2FA transposase를 선형화.</li>
	<li>반응이 완료 되 면 Tol2 transposase mRNA 상업적인 RNA 청소를 사용 하 여 제조업체의 지침에 따라 장비를 정화. 마지막으로, 20 µ L RNAase 무료 물으로 mRNA elute 고는 분 광 광도 계에 RNA 농도 측정 한다. 에 대 한 예상된 농도 1-3 µ g / µ L. 견본-80 ° C 냉동 실에 저장할 수 있습니다 필요한 경우.</li>
	<li>20 ng / µ L pDestTol2-유비를 혼합 하 여 microinjection 솔루션 준비-ASAP1 및 Tol2 transposase mRNA (100 ng / µ L) pipetting으로 microcentrifuge 관에서. 반복 해빙과 튜브 당 거, aliquot 6 µ L로 인 한 핵 산 저하를 방지 하려면 나중에 사용-80 ° C 냉동 고에 보관.</li>
</ol>3입니다. microinjection
<ol><li>주입 하기 전에 오후 4-6 번 식 탱크 2 남성 및 2 명의 여성을 설정 합니다. 이 물고기는 오후에 먹여야 하지 해야 합니다. 이 단계 물고기 낭비의 양을 줄일 하 고 다음날 아침 또한 번 식 응답을 유도 하는 동시에 밖으로 그들을 청소 하는 시간을 절약할 것 이다.</li>
	<li>다음 아침, 제거 준비 주입 솔루션 (pDestTol2-유비-ASAP1 구문 및 Tol2 mRNA)-80 ° C 냉동 고에서 얼음에 놓습니다.</li>
	<li>물고기 사육 탱크에에서 디바이 더를 당겨 하 고 물고기 친구를 허용 합니다. 일반적으로, 생선 알을 꺼내 구분선 후 20-30 분 이내. 그렇지 않은 경우 1-2 시간 이상 기다립니다. 일부 물고기 계란을 전혀 놓지 않을 수 있습니다. 이 경우에, 물고기 배아 컬렉션에 대 한이 실험을 반복 합니다.</li>
	<li>기다리는 동안, 거기에 바늘 팁 겸 자, 또는 섬세 한 작업와이 퍼에 침입 하 여 3d 가장자리를 만드는 각도에 깨진 준비 있는지 확인 합니다.<ol>
<li>다음 매개 변수를 사용 하 여 micropipette 끌어당기는 사람에 유리 모 세관에서 바늘을 당겨: 545;가 열 풀 60; 속도 80; 시간 250; 압력 500입니다. 각도 약 45 °에는 집게를 잡고 집게 (직경 추정에 대 한 눈 조각 통치자)와 절 개 범위 아래와 바늘을 휴식. 원하는 바늘 직경 microinjector 설정에 따라 변수가 될 수 있습니다 하지만 작은 직경은 태아 사망률 감소에 대 한 선호.</li>
	</ol>
</li>
	<li>일단 물고기는 계란, 10 cm 직경 페 트리 접시에에서 그들을 수집 하 고 절 개 범위에 그들을. 모든 비정상적인 배아를 제거 하 고 폐기물을 물고기.</li>
	<li>피펫으로 준비 3 %agarose 주입으로 수정 된 배아 금형. 장소에 배아를 유지할 수 있도록 초과 물을 제거 합니다.</li>
	<li>일단 모든 행 가능한 배아 가득 정렬 있도록 모든 단일 셀 약 45 ° 각도 수평으로 바늘을 향해 같은 방향으로 얼굴. 이것을 쉽게 주입 훨씬 나중.</li>
	<li>장갑을 끼고, 동안 20 µ L 로드 피펫으로 사용 팁과 얼음에 튜브에서 준비 된 구문 5 µ L를 제거.</li>
	<li>신중 하 게 그것은 팁에 가까운 시를 얻을로 꼭지를 시작 하는 위치에 있는 모든 방법이 깨진된 모 세관 튜브의 백 엔드에 팁을 삽입 합니다. 경우 여전히 공기 방울, 바늘, 팁을 아프게 하지를 흔들.</li>
	<li>Microinjection 바늘 홀더 연속으로 바늘을 삽입 하 고 바늘 자리에 유지 될 때까지 신중 하 게 강화. 약 45 ° 각도 조정 합니다.</li>
	<li>일단 바늘 준비 하 고 연결, 현미경 및 가스 압력 탱크를 켭니다. 상업 CO2 탱크는이 목적을 위해 일반적으로 좋다. 지주 및 방출 압력에 의해 분사 볼륨 조정: 대략 0.5 psi 지주 및 방출에 대 한 30 psi. 솔루션 때 페달을 누르면 밖으로 나오는 것을 확인 해야 합니다.</li>
	<li>~ 150 µ m 직경에서 솔루션의 흐름과 볼륨 조정 미네랄 오일의 방울으로 무대 마이크로미터를 사용 하 여 (약 2 nL). 백 프레셔 바늘의 똑 작은 금액을 드릴 것입니다 확인 하십시오. 충분히 다시 압력 없는 경우 모 세관 작용 액체 바늘을 입력 하는 mRNA를 파괴 하면 됩니다.</li>
	<li>일단 바늘 보정, 수정 된 배아의 단일 셀에는 구조 주입 시작. 참고:이 연습, 인 내, 그리고 기교, 피어스 하드 되 세포 막 때문에 많은 양의 걸립니다. 그것은 셀, 아니라 노 른 자, 유전자 변형 zebrafish를 생성 하기 위한 솔루션을 주입 하는 것이 중요입니다. 이 morpholino 주입에 다릅니다. 그것은 어느 쪽 바늘 입력 셀 구성 셀에가 하는 만큼 중요 하지 않습니다. 노 른 자는 셀에 주입 하는 경우는 transgenesis 성공의 매우 낮은 속도 할 것 이다. 단일 셀 단계 주입은 또한 중요 하다, 또는 체세포 키메라 물고기를 만들 것입니다. 이 세균 세포에 들어가는 transgene의 가능성을 줄일 것 이다.</li>
	<li>젤 노치의 가장자리를 사용 하 여 제공 하는 장소에서 태아를 유지 및 태아를 이동 하지 않고 압력을 적용 하 니 백업. 일단 바늘의 팁 단일 셀에 원하는 양의 솔루션 출시 페달을 누릅니다. 배아의 모든에 대해이 프로세스를 반복 합니다.</li>
	<li>완료 되 면, 물고기 시스템 물과 일회용 3.4 mL 전송 피 펫 agarose 노치에서 그들을 rinsing 하 여 레이블이 지정 된 그릇에 주입 된 배아를 전송. 그들이 개발 하는 28.5 ° C 인큐베이터에 배아를 저장 합니다. 죽은 물고기 배아를 제거 하는 하루 동안 다시 확인 하 고 0.1% 메 틸 렌 블루 물고기 물에서 물을 바꿉니다.</li>
	<li>주입 후 약 6-8 시간 걸릴 10 개인 주입 배아 물고기 고18인가요 메서드 사용 하 여 그들에서 게놈 DNA를 준비 합니다.</li>
	<li>다음 아침, 비 노 른 자 조직에 GFP를 보여주는 배아 밖으로 정렬 하려면 형광 광원으로 해 부 현미경을 사용 합니다. 이러한 물고기 배아 삽입 된 구문을 포함 해야 합니다.</li>
	<li>Tol2 소비 분석 결과 확인 앞에서 설명한19transposon 활동을 수행 합니다. 삭제 플라스 미드를 감지할 수 있습니다, 유지는 삽입 된 배아를 물고기와 그들을 인상. 아니 삭제 플라스 미드는 검출 될 수 있다, Tol2 소비 분석 결과의 긍정적인 결과 얻을 때까지 Tol2 mRNA 합성 및 microinjection 프로세스를 반복 합니다.</li>
</ol>4. 유전자 변형 ASAP1 물고기, 안내 설정 (ubi: ASAP1)
<ol><li>앞에서 설명한 zebrafish 책20에서 성인 기에 주입 된 물고기를 (F0 세대)를 올립니다. 이 일반적으로 약 4 개월 걸립니다.</li>
	<li>단일 성인 F0 물고기 고 성별 wildtype 물고기 반대 한 번으로 교차. 나중에 번 식 후 물고기 배아를 수집 합니다. 물고기에서 28.5 ° C 배양 기에서 수집한 물고기 배아 0.1% 메 틸 렌 블루 물 유지.</li>
	<li>제 3의 날에 GFP 필터 형광 해 부 현미경 아래 물고기 배아를 확인 합니다. 있을 경우, 초록 물고기 배아 밖으로 정렬 하 고 F1 세대 유전자 변형 물고기, Tg 성인이 그들을 인상 (ubi: ASAP1). 참고: 이후 부모의 F0 물고기의 대부분은 세균 선 유전자 키메라 Mendelian 비율 예상 하지는.</li>
	<li>크로스 wildtype 물고기와 단일 F1 성인 물고기 고 물고기 배아를 수집 합니다. 초록 물고기 배아 밖으로 정렬 하 고 F2 세대 생선으로 성인 기에 발생. 참고: 녹색과 비 그린 물고기 배아 가까이 있어야 한다 1:1 단일 transgene 인지.</li>
	<li>악성 말 초 신경 칼 집 종양 (MPNST) 같은 종양에서 전기 잠재적인 변화를 보려면 F2 세대 Tg 크로스 (ubi: ASAP1) rpl35hi258/wt 물고기와 물고기. 보이는 종양 6-8 달 오래 된 성인21,22에서 찾을 수 시작을 알려졌다.</li>
</ol>5입니다. 영상
<ol><li>Zebrafish 태아 이미지, 여러 F2 세대 설립자 물고기 고 개별 쌍에서 wildtype 물고기와 그들을 교차 하는 것 하. 준비 가이드23zebrafish에 따르면 다른 원하는 발달 단계에서 물고기 배아를 수집 합니다.</li>
	<li>물고기 배아의 초기 단계에 대 한 껍질 하 고 신중 하 게 집게의 쌍을 사용 하 여 10 cm 직경 물고기 시스템 물으로 페 트리 접시에에서 절 개 범위에서 배아의 chorions를 제거 합니다.</li>
	<li>3.4 mL 처분할 수 있는 이동 피 펫을 사용 하 여 3% 스와 concaved 유리 슬라이드에 몇 가지 물고기 배아를 전송 합니다. 배아는 형광 절 개 범위 아래 바늘을 사용 하 여 셀룰러 GFP 활동을 볼 수 원하는 위치를 조정 합니다.</li>
	<li>물고기의 이동 단계 배아 (12 somite 단계 보다 더 오래 된), 0.05% tricaine mesylate 물고기 배아 슬라이드에 그들을 전송 하기 전에 anesthetize를 사용 합니다. 간단히, 그들은 수영, 손실 신체 균형을 멈출 때까지 물고기 배아 물고기 물에서 0.05% tricaine mesylate에 등장 했다. 또한, 슬라이드에는 스와 0.05% tricaine mesylate 방울을 추가 합니다.</li>
	<li>미만 12 somite 무대 물고기 배아에 대 한 호환 카메라와 소프트웨어 피 형광 화합물 현미경을 사용 하 여 이미징. 12 somite 무대 물고기 배아 보다 오래 된에 대 한 형광 해 부 현미경을 사용 합니다.</li>
	<li>종양 세포 전압 이미지, 먼저 MPNST 종양 물고기를 식별. 그런 다음 anesthetize 0.05% tricaine mesylate와 물고기. 전체 산에 대 한 이미징, 10 cm 직경 페 트리 접시에 생선을 넣어. 종양 세포 전기 활동을 보려면 물고기 종양 수 수 해 부 밖으로 전체 마운트 영상 후.</li>
</ol>

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

저자는 공개 없다.

있지만 세포와 조직 수준의 전기 활동 배아 개발 및 인간 질병 동안 오래 전에 발견 되었다, vivo에서 동적 전기 변화 및 그들의 생물학 역할 여전히 남아 크게 알 수 없는. 주요 과제 중 하나는 시각화 하 고 계량 전기 변화입니다. 단일 셀을 추적 하기 위한 휴식 통해 패치 클램프 기술 이다 하지만 그들은 많은 세포의 구성 되어 있기 때문에 척추 동물 배아의 응용 제한 됩니다. 현재 화학 전?...

전기 이온 채널과1세포 막 있는 펌프에 의해 중재 생 전기 신호를 말합니다. 세포 막과 결합 된 전기 잠재력과 현재 변화, 이온 교환 프로세스 고르기 신경 및 근육 세포의 신호에 대 한 필수적입니다. 또한, 전기 및 이온 기온 변화도 다른 중요 한 생물 학적 기능 에너지 저장, 생 합성, 대사 산물 수송 등의 다양 한이 있다. 생체 전기 신호도 몸 축, 세포 주기, 세포 감 별 법1등 미 발달 패턴 형성의 레 귤 레이 터로 발견 되었다. 따라서, 그것은 이러한 유형의 신호의 미 규제에 기인 하 많은 인간의 선 천 성 질병을 이해 중요 합니다. 패치 클램프 널리 사용 되었습니다 단일 셀 기록, 배아 발달 비보중 여러 셀의 동시 모니터링에 이상적에서 멀리 아직도 이다. 또한, 전압 민감한 작은 분자는 또한 그들의 특이성, 감도, 및 독성 vivo에서 애플리케이션에 적합 하지.
창조의 다양 한 유전자 형광 전압 표시기 (GEVIs) 제공이이 문제를 극복 하기 위해 새로운 메커니즘이 인코딩되고 그들은 원래 신경 모니터링 위한 했다 비록 배아 개발 공부를 쉽게 응용 프로그램에 대 한 허용 2,3세포. 현재 사용할 수 있는 GEVIs 중 하나는 가속 센서의 활동 전위 1 (ASAP1)4입니다. 그것은 전압 과민 한 인산 가수분해 효소와 원형으로 배치 된 녹색 형광 단백질의 전압 감지 도메인의 extracellular 루프의 구성 됩니다. 따라서, ASAP1 세포 전기 잠재적인 변화의 시각화 수 (분극: 밝은 녹색; 도발은: 진한 녹색). ASAP1 속도 론 온 오프 2 ms, 있으며 subthreshold 잠재적인 변경4를 추적할 수 있습니다. 따라서,이 유전 도구 라이브 셀에 실시간 생체 모니터링에 효능의 새로운 수준에 대 한 수 있습니다. 배아 발달에 많은 인간 질병, 암, 등 전기의 역할의 더 이해 것입니다 창 고 기본 메커니즘에 새로운 빛이는 질병 치료 및 예방에 매우 중요.
Zebrafish 강력한 동물 모델 개발 생물학과 암5,6을 포함 하 여 인간의 질병을 입증 되었습니다. 인간, 70 %orthologous 유전자를 공유 하는 그들은 그리고 그들은 유사한 척 추가 있는 생물학7. Zebrafish는 비교적 쉽게 치료, 계란, 온순한 유전학, 쉬운 transgenesis, 그리고 투명 한 외부 배아 발달, 그들에 게 비보에 이미징5,6우수한 시스템의 큰 클러치 크기를 제공 합니다. 이미 존재 하는 돌연변이 물고기 선의 큰 소스와 완전히 시퀀스 게놈, zebrafish는 과학적 발견의 상대적으로 무제한 범위를 제공 합니다.
Vivo에서 실시간 전기 세포의 활동을 조사, 우리 활용 zebrafish 모델 시스템 및 ASAP1. 이 문서에서 우리는 형광 전압 바이오 센서 ASAP1 Tol2 transposon transgenesis를 사용 하 여 zebrafish 게놈으로 통합 하는 방법을 설명 하 고 배아 개발, 물고기 애벌레 움직임, 그리고 라이브 종양에서 세포 전기 활동을 시각화 .

<table><tbody><tr><td>14mL cell culture tubes</td><td>VWR</td><td>60818-725</td><td>E.Coli culture</td></tr><tr><td>Agarose electrophoresis tank</td><td>Thermo Scientific</td><td>Owl B2</td><td>DNA eletrophoresis</td></tr><tr><td>Agarose RA</td><td>Amresco</td><td>N605-500G</td><td>For making the injection gels</td></tr><tr><td>Attb1-ASAP1-F primer</td><td>IDT DNA</td><td>GGGGACAAGTTTGTACAAAAAA&lt;br /&gt;GCAGGCTTCACCATGGAGACGA&lt;br /&gt;CTGTGAGGTATGAACA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Attb2-ASAP1-R primer</td><td>IDT DNA</td><td>GGGGACCACTTTGTACAAGAAA&lt;br /&gt;GCTGGGTCTTAGGTTACCACTTC&lt;br /&gt;AAGTTGTTTCTTCTGTGAAGCCA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Bright field dissection scope</td><td>Nikon</td><td>SMZ 745</td><td>Dechorionation, microinjection, mounting</td></tr><tr><td>Color camera</td><td>Zeiss</td><td>AxioCam MRc</td><td>Fish embryo image recording</td></tr><tr><td>Concave slide</td><td>VWR</td><td>48336-001</td><td>For holding fish embryos during imaging process</td></tr><tr><td>Disposable transfer pipette 3.4 ml</td><td>Thermo Scientific</td><td>13-711-9AM</td><td>Fish embryos and water transfer</td></tr><tr><td>Endonuclease enzyme, Not I</td><td>NEB</td><td>R0189L</td><td>For linearizing plasmid DNA</td></tr><tr><td>Epifuorescent compound scope</td><td>Zeiss</td><td>Axio Imager.A2</td><td>Fish embryo imaging</td></tr><tr><td>Epifuorescent stereo dissection scope</td><td>Zeiss</td><td>Stereo Discovery.V12</td><td>Fish embryo imaging</td></tr><tr><td>Fluorescent light source</td><td>Lumen dynamics</td><td>X-cite seris 120</td><td>Light source for fluorescence microscopes</td></tr><tr><td>Forceps #5</td><td>WPI</td><td>500342</td><td>Dechorionation and needle breaking</td></tr><tr><td>Gateway BP Clonase II Enzyme mix</td><td>Thermo Scientific</td><td>11789020</td><td>Gateway BP recombination cloning</td></tr><tr><td>Gateway LR Clonase II Plus enzyme</td><td>Thermo Scientific</td><td>12538120</td><td>Gateway LR recombination cloning</td></tr><tr><td>Gel DNA Recovery Kit</td><td>Zymo Research</td><td>D4002</td><td>DNA gel purification</td></tr><tr><td>Loading tip</td><td>Eppendorf</td><td>930001007</td><td>For loading injection solution into capilary needles</td></tr><tr><td>Methylcellulose (1600cPs)</td><td>Alfa Aesar</td><td>43146</td><td>Fish embryo mounting</td></tr><tr><td>Methylene blue</td><td>Sigma-Aldrich</td><td>M9140</td><td>Suppresses fungal outbreaks in Petri dishes</td></tr><tr><td>Microinjection mold</td><td>Adaptive Science Tools</td><td>TU-1</td><td>To prepare agaorse mold tray for holding fish embryos during injection</td></tr><tr><td>Microinjector</td><td>WPI</td><td>Pneumatic Picopump PV820</td><td>Microinjection injector</td></tr><tr><td>Micro-manipulator</td><td>WPI</td><td>Microinjector MM3301R</td><td>Microinjection operation</td></tr><tr><td>Micropipette puller</td><td>Sutter instrument</td><td>P-1000</td><td>For preparing capillary needle</td></tr><tr><td>Mineral oil</td><td>Amresco</td><td>J217-500ml</td><td>For calibrating injection volume</td></tr><tr><td>mMESSAGE mMACHINE SP6 Transcription Kit</td><td>Thermo Scientific</td><td>AM1340</td><td>mRNA in vitro transcription</td></tr><tr><td>Monocolor camera</td><td>Zeiss</td><td>AxioCam MRm</td><td>Fish embryo image recording</td></tr><tr><td>Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4020</td><td>Prepare small amount of plasmid DNA</td></tr><tr><td>Plastic Petri dishes</td><td>VWR</td><td>25384-088</td><td>For holding fish or fish embryos during imaging process</td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td>mRNA cleaning after in vitro transcription</td></tr><tr><td>Spectrophotometer</td><td>Thermo Scientific</td><td>NanoDrop 2000</td><td>For measuring DNA and RNA concentrations</td></tr><tr><td>Stage Micrometer</td><td>Am Scope</td><td>MR100</td><td>Microinjection volume calibration</td></tr><tr><td>Thermocycler</td><td>Bio-Rad</td><td>T100</td><td>DNA amplification for gene cloning</td></tr><tr><td>Thin wall glass capillaries</td><td>WPI</td><td>TW100F-4</td><td>Raw glass for making cappilary needle</td></tr><tr><td>Tol2-exL1 primer</td><td>IDT DNA</td><td>GCACAACACCAGAAATGCCCTC</td><td>Tol2 excise assay</td></tr><tr><td>Tol2-exR primer</td><td>IDT DNA</td><td>ACCCTCACTAAAGGGAACAAAAG</td><td>Tol2 excise assay</td></tr><tr><td>TOP10 Chemically Competent E. coli</td><td>Thermo Scientific</td><td>C404006</td><td>Used for transformation during gene cloning</td></tr><tr><td>Tricaine mesylate</td><td>Sigma-Aldrich</td><td>A5040</td><td>For anesthetizing fish or fish embryos</td></tr><tr><td>UV trans-illuminator 302nm</td><td>UVP</td><td>M-20V</td><td>DNA visualization</td></tr><tr><td>Water bath</td><td>Thermo Scientific</td><td>2853</td><td>For transformation process of gene cloning</td></tr></tbody></table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

전기, 내 생 전기적 신호 이온 채널에 의해 중재 및 세포 막에 있는 펌프 고르기 신경 및 근육 세포의 프로세스와 같은 다른 많은 생물 학적 과정, 신호에 중요 한 역할 배아 개발 패턴입니다. 그러나, vivo에서 전기 활동 모니터링 척추 embryogenesis에 대 한 필요가 있다. 인코딩된 유전자 형광 전압 표시기 (GEVIs)의 진보는이 전에 대 한 솔루션을 제공할 수 만들었습니다. 여기, 우리 유전자 변형 전압 표시기 zebrafish 설립된 전압 표시기, ASAP1를 사용 하 여 만드는 방법에 설명 (가속 센서의 활동 전위 1), 예를 들어. Tol2 키트와 유비 쿼터 스 zebrafish 발기인, ubi, 이 연구에서 선정 됐다. 우리는 또한 게이트웨이 사이트 복제, Tol2 transposon 기반 zebrafish transgenesis, 그리고 일반 epifluorescent 현미경을 사용 하 여 초기 단계 물고기 배아와 물고기 종양에 대 한 이미징 프로세스의 프로세스를 설명 합니다. 이 물고기 라인을 사용 하 여, 우리는 제 브라 embryogenesis, 그리고 물고기 애벌레 운동 하는 동안 세포 전기 전압 변화는 발견. 또한, 몇 가지 zebrafish 악성 말 초 신경 칼 집 종양, 셀은 일반적으로 편광 종양 주변 정상 조직에 비해 관찰 되었다.

성공적인 주입, 주입 50% 물고기 배아는 체세포에 녹색 형광의 어느 정도 표시 됩니다 그리고 그들의 대부분은 Tol2 transposon 소비 분석 결과 (그림 2)에 의해 긍정적인 것 보다 더 많은. 후 2-4 세대-wildtype 물고기 (까지 형광 물고기 도달 예상된 Mendelian 비율 50%)와 교차, 유전자 변형 물고기 배아 개발 하는 동안 세포 막 잠재력을 추적 하기 위해 이미징 실?...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Zebrafish 초기 배아에 종양 세포 전기 활동의 시각화

여기, 우리가 배아 개발, 운동, 시각화 세포 전기 전압 기자 제 브라 라인을 만드는 과정을 보여 그리고 물고기 종양 vivo에서세포.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

visualization-cellular-electrical-activity-zebrafish-early-embryos

Research

JoVE Journal

Developmental Biology

8.7K 조회수.  Purdue University. 여기, 우리가 배아 개발, 운동, 시각화 세포 전기 전압 기자 제 브라 라인을 만드는 과정을 보여 그리고 물고기 종양 vivo에서세포.

비디오: Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Time-lapse Live Imaging of Clonally Related Neural Progenitor Cells in the Developing Zebrafish Forebrain

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To understand the behavior of neural progenitor cells in the complex in vivo environment, time-lapse live imaging of neural progenitor cells in an intact brain is critically required. In this video, we exploit the unique features of zebrafish embryos to visualize the development of forebrain neural progenitor cells in vivo. We use electroporation to genetically and sparsely label individual neural progenitor cells. Briefly, DNA constructs coding for fluorescent markers were injected into the forebrain ventricle of 22 hours post fertilization (hpf) zebrafish embryos and electric pulses were delivered immediately. Six hours later, the electroporated zebrafish embryos were mounted with low melting point agarose in glass bottom culture dishes. Fluorescently labeled neural progenitor cells were then imaged for 36hours with fixed intervals under a confocal microscope using water dipping objective lens. The present method provides a way to gain insights into the in vivo development of forebrain neural progenitor cells and can be applied to other parts of the central nervous system of the zebrafish embryo.

The present video demonstrates a method which takes advantage of the combination of electroporation and confocal microscopy to perform live imaging on individual neural progenitor cells in the developing zebrafish forebrain. In vivo analysis of the development of forebrain neural progenitor cells at a clonal level can be achieved in this way.

개발 Zebrafish Forebrain에 Clonally 관련 신경 전구 세포의 시간 경과 라이브 영상

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To ...

연구

신경과학

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

발생학

Live Imaging of the Zebrafish Embryonic Brain by Confocal Microscopy

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the developing zebrafish brain (Gutzman et al, 2008). Such analysis affords a new understanding of the underlying cell biology required for development of the 3D structure of the vertebrate brain, and significantly increases our ability to study neural tube morphogenesis. The embryonic zebrafish brain is shaped beginning at 18 hours post fertilization (hpf) as the ventricles within the neuroepithelium inflate. By 24 hpf, the initial steps of neural tube morphogenesis are complete. Using the method described here, embryos at the one cell stage are injected with mRNA encoding membrane-targeted green fluorescent protein (memGFP). After injection and incubation, the embryo, now between 18 and 24 hpf, is mounted, inverted, in agarose and imaged by confocal microscopy. Notably, the zebrafish embryo is transparent making it an ideal system for fluorescent imaging. While our analyses have focused on the midbrain-hindbrain boundary and the hindbrain, this method could be extended for analysis of any region in the zebrafish to a depth of 
80-100 &mu;m.

In this video, we demonstrate a method by which to analyze the developing vertebrate brain in live zebrafish embryos at single cell resolution by confocal microscopy. This includes the method by which we inject the single-cell zebrafish embryo and subsequently mount and image the developing brain.

공촛점 현미경으로 Zebrafish 배아 뇌 영상 라이브

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the ...

생물학

Forebrain Electrophysiological Recording in Larval Zebrafish

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked seizures, epilepsy can be acquired as a result of an insult to the brain or a genetic mutation. Efforts to model seizures in animals have primarily utilized acquired insults (convulsant drugs, stimulation or brain injury) and genetic manipulations (antisense knockdown, homologous recombination or transgenesis) in rodents. Zebrafish are a vertebrate model system1-3 that could provide a valuable alternative to rodent-based epilepsy research. Zebrafish are used extensively in the study of vertebrate genetics or development, exhibit a high degree of genetic similarity to mammals and express homologs for ~85% of known human single-gene epilepsy mutations. Because of their small size (4-6 mm in length), zebrafish larvae can be maintained in fluid volumes as low as 100 &mu;l during early development and arrayed in multi-well plates. Reagents can be added directly to the solution in which embryos develop, simplifying drug administration and enabling rapid in vivo screening of test compounds4. Synthetic oligonucleotides (morpholinos), mutagenesis, zinc finger nuclease and transgenic approaches can be used to rapidly generate gene knockdown or mutation in zebrafish5-7. These properties afford zebrafish studies an unprecedented statistical power analysis advantage over rodents in the study of neurological disorders such as epilepsy. Because the "gold standard" for epilepsy research is to monitor and analyze the abnormal electrical discharges that originate in a central brain structure (i.e., seizures), a method to efficiently record brain activity in larval zebrafish is described here. This method is an adaptation of conventional extracellular recording techniques and allows for stable long-term monitoring of brain activity in intact zebrafish larvae. Sample recordings are shown for acute seizures induced by bath application of convulsant drugs and spontaneous seizures recorded in a genetically modified fish.

A simple method to record extracellular field potentials in the larval zebrafish forebrain is described. The method provides a robust in vivo read-out of seizure-like activity. This technique can be used with genetically modified zebrafish larvae carrying epilepsy-related genes or seizures evoked by administration of convulsant drugs.

애벌레의 Zebrafish의 Forebrain Electrophysiological 기록

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked ...

Live Imaging of Cell Motility and Actin Cytoskeleton of Individual Neurons and Neural Crest Cells in Zebrafish Embryos

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily accessible at all stages of development. Moreover, their optical clarity allows high resolution imaging of cell and molecular dynamics in the natural environment of the intact embryo. We are using a live imaging approach to analyze cell behaviors during neural crest cell migration and the outgrowth and guidance of neuronal axons.
Live imaging is particularly useful for understanding mechanisms that regulate cell motility processes. To visualize details of cell motility, such as protrusive activity and molecular dynamics, it is advantageous to label individual cells. In zebrafish, plasmid DNA injection yields a transient mosaic expression pattern and offers distinct benefits over other cell labeling methods. For example, transgenic lines often label entire cell populations and thus may obscure visualization of the fine protrusions (or changes in molecular distribution) in a single cell. In addition, injection of DNA at the one-cell stage is less invasive and more precise than dye injections at later stages.
Here we describe a method for labeling individual developing neurons or neural crest cells and imaging their behavior in vivo. We inject plasmid DNA into 1-cell stage embryos, which results in mosaic transgene expression. The vectors contain cell-specific promoters that drive expression of a gene of interest in a subset of sensory neurons or neural crest cells. We provide examples of cells labeled with membrane targeted GFP or with a biosensor probe that allows visualization of F-actin in living cells1.
Erica Andersen, Namrata Asuri, and Matthew Clay contributed equally to this work.

This protocol describes imaging of individual neurons or neural crest cells in living zebrafish embryos. This method is used to examine cellular behaviors and actin localization using fluorescence confocal time-lapse microscopy.

세포 운동성 및 Zebrafish 태아의 개별 뉴런과 신경 크레스트 세포의 굴지의 Cytoskeleton의 라이브 영상

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily ...

Visualizing the Developing Brain in Living Zebrafish using Brainbow and Time-lapse Confocal Imaging

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in vivo imaging techniques can provide a clear window into these processes in the living organism. For example, dividing cells and their progeny can be followed in real time as the nervous system forms. In recent years, technical advances in multicolor techniques have expanded the types of questions that can be investigated. The multicolor Brainbow approach can be used to not only distinguish among like cells, but also to color-code multiple different clones of related cells that each derive from one progenitor cell. This allows for a multiplex lineage analysis of many different clones and their behaviors simultaneously during development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells over real time within the developing zebrafish nervous system. This is particularly useful for following cellular interactions among like cells, which are difficult to label differentially using traditional promoter-driven colors. Our approach can be used for tracking lineage relationships among multiple different clones simultaneously. The large datasets generated using this technique provide rich information that can be compared quantitatively across genetic or pharmacological manipulations. Ultimately the results generated can help to answer systematic questions about how the nervous system develops.

In vivo imaging is a powerful tool that can be used to investigate the cellular mechanisms underlying nervous system development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells in real time within the developing zebrafish nervous system.

무지개와 타임랩스 공초점 이미징을 사용하여 살아있는 제브라피시의 뇌 발달 시각화

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in ...

Multicolor Time-lapse Imaging of Transgenic Zebrafish: Visualizing Retinal Stem Cells Activated by Targeted Neuronal Cell Ablation

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound transgenic fish which express different fluorescent reporters in neighboring cell types provide a means of following cellular interactions 2 and/or tissue-level responses to experimental manipulations over time. In this video, we demonstrate methods that can be used for imaging multiple transgenically labeled cell types serially in individual fish over time courses that can span from minutes to several days. The techniques described are applicable to any study seeking to correlate the "behavior" of neighboring cells types over time, including: 1) serial 'catch and release' methods for imaging a large number of fish over successive days, 2) simplified approaches for separating fluorophores with overlapping excitation/emission profiles (e.g., GFP and YFP), 3) use of hypopigmented mutant lines to extend the time window available for high-resolution imaging into late larval stages of development, 4) use of membrane targeted fluorescent reporters to reveal fine morphological detail of individual cells as well as cellular details in larger populations of cells, and 5) a previously described method for chemically-induced ablation of transgenically targeted cell types; i.e., nitroreductase (NTR) mediated conversion of prodrug substrates, such as metronidazole (MTZ), to cytotoxic derivatives 3,5.
As an example of these approaches, we will visualize the ablation and regeneration of a subtype of retinal bipolar neuron within individual fish over several days. Simultaneously we will monitor several other retinal cell types, including neighboring non-targeted bipolar cells and potential degeneration-stimulated retinal stem cells (i.e., M&#971;ller glia). This strategy is being applied in our lab to characterize cell- and tissue-level (e.g., stem cell niche) responses to the selective loss and regeneration of targeted neuronal cell types.

In this video, techniques for multicolor confocal time-lapse imaging and targeted cell ablation are provided. Time-lapse imaging is used to monitor the behavior of multiple cell types of interest in vivo. Targeted cell ablation facilitates the study neural circuit function and cell-specific neuronal regeneration paradigms.

트렌스 제닉 Zebrafish의 여러 가지 빛깔의 시간 저속 영상 : 타겟의 연결을 세포 절제에 의해 활성화 떠올리 망막 줄기 세포

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound ...

Imaging and 3D Reconstruction of Cerebrovascular Structures in Embryonic Zebrafish

Zebrafish are a powerful tool to study developmental biology and pathology in vivo. The small size and relative transparency of zebrafish embryos make them particularly useful for the visual examination of processes such as heart and vascular development. In several recent studies transgenic zebrafish that express EGFP in vascular endothelial cells were used to image and analyze complex vascular networks in the brain and retina, using confocal microscopy. Descriptions are provided to prepare, treat and image zebrafish embryos that express enhanced green fluorescent protein (EGFP), and then generate comprehensive 3D renderings of the cerebrovascular system. Protocols include the treatment of embryos, confocal imaging, and fixation protocols that preserve EGFP fluorescence. Further, useful tips on obtaining high-quality images of cerebrovascular structures, such as removal the eye without damaging nearby neural tissue are provided. Potential pitfalls with confocal imaging are discussed, along with the steps necessary to generate 3D reconstructions from confocal image stacks using freely available open source software.

Imaging of cerebrovascular development in larval zebrafish is described. Techniques to facilitate 3D imaging and modify cerebrovascular development using chemical treatments are also provided.

이미징 및 배아 제브라 피쉬의 뇌 혈관 구조의 3 차원 재구성

Zebrafish are a powerful tool to study developmental biology and pathology in vivo.  The small size and relative transparency of zebrafish embryos make ...

Semi-automated Imaging of Tissue-specific Fluorescence in Zebrafish Embryos

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are frequently used to identify chemicals that modulate gene expression. Chemical screens that assay fluorescence in live zebrafish often rely on expensive, specialized equipment for high content screening. We describe a procedure using a standard epifluorescence microscope with a motorized stage to automatically image zebrafish embryos and detect tissue-specific fluorescence. Using transgenic zebrafish that report estrogen receptor activity via expression of GFP, we developed a semi-automated procedure to screen for estrogen receptor ligands that activate the reporter in a tissue-specific manner. In this video we describe procedures for arraying zebrafish embryos at 24-48 hours post fertilization (hpf) in a 96-well plate and adding small molecules that bind estrogen receptors. At 72-96 hpf, images of each well from the entire plate are automatically collected and manually inspected for tissue-specific fluorescence. This protocol demonstrates the ability to detect estrogens that activate receptors in heart valves but not in liver.

Described here is a protocol for semi-automated imaging of tissue-specific fluorescence in zebrafish embryos.

Zebrafish의 태아의 조직 특이 형광의 반 자동화 이미징

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are ...

In vivo Imaging of Fully Active Brain Tissue in Awake Zebrafish Larvae and Juveniles by Skull and Skin Removal

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at cellular and subcellular resolution. Advances in molecular and imaging technologies have allowed us to gain numerous detailed insights into cellular and molecular mechanisms of brain development in the transparent zebrafish embryo. Recently, processes of refinement of neuronal connectivity that occur at later larval stages several weeks after fertilization, which are for example control of social behavior, decision making or motivation-driven behavior, have moved into focus of research. At these stages, pigmentation of the zebrafish skin interferes with light penetration into brain tissue, and solutions for embryonic stages, e.g., pharmacological inhibition of pigmentation, are not feasible anymore.
Therefore, a minimally invasive surgical solution for microscopy access to the brain of awake zebrafish is provided that is derived from electrophysiological&#160;approaches. In teleosts, skin and soft skull cartilage can be carefully removed by micro-peeling these layers, exposing underlying neurons and axonal tracts without damage. This allows for recording neuronal morphology, including synaptic structures and their molecular contents, and the observation of physiological changes such as Ca2+ transients or intracellular transport events. In addition, interrogation of these processes by means of pharmacological inhibition or optogenetic manipulation is feasible. This brain exposure approach provides information about structural and physiological changes in neurons as well as the correlation and interdependence of these events in live brain tissue in the range of minutes or hours. The technique is suitable for in vivo brain imaging of zebrafish larvae up to 30 days post fertilization, the latest developmental stage tested so far. It, thus, provides access to such important questions as synaptic refinement and scaling, axonal and dendritic transport, synaptic targeting of cytoskeletal cargo or local activity-dependent expression. Therefore, a broad use for this mounting and imaging approach can be anticipated.

Here we present a method to image the zebrafish embryonic brain in vivo upto larval and juvenile stages. This microinvasive procedure, adapted from electrophysiological approaches, provides access to cellular and subcellular details of mature neuron and can be combined with optogenetics and neuropharmacological studies for characterizing brain function and drug intervention.

두개골과 피부 제거에 의해 깨어 얼룩말 물고기 애벌레와 청소년에서 완전히 활성 뇌 조직의 생체 내 이미징

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at ...