A subscription to JoVE is required to view this content. Sign in or start your free trial.
We established an efficient way to deplete intestinal bacteria in three days, and subsequently transplant fecal microbiota via gavage of fecal fluid prepared from fresh or frozen intestinal contents in mice. We also present an optimized method to detect the frequency of IgA-coated bacteria in the gut.
Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the biological function of intestinal bacteria as a whole or at the species level. Several different FMT methods have been published. Here, we present an FMT protocol that successfully depletes gut microbiota in a matter of days, followed by transplantation of fecal microbiota from fresh or frozen donor intestinal contents to conventional mice. Real time-PCR is applied to test the efficacy of bacterial depletion. Sequencing of the 16S ribosomal RNA (rRNA) is then applied to test the relative abundance and identity of gut microbiota in recipient mice. We also present a flow cytometry-based detection method of immunoglobulin A (IgA)-coated bacteria in the gut.
A diverse gut microbiota plays a major role in maintaining host homeostasis. This microbiome aids in various physiological processes ranging from digestion and absorption of nutrients from food, defense against infection of pathogens, regulation of immune system development, and immune homeostasis1. Perturbation in gut microbial composition has been linked to many diseases, including cancer2, autoimmune diseases3, inflammatory bowel disease4, neurological diseases5, and metabolic diseases6,7.....
Animal experiments were conducted in accordance with the current ethical regulations for animal care and use in China.
NOTE: Animals were housed in a specific pathogen-free (SPF), controlled environment under 12-hour light and dark cycles at 25 °C. Food was irradiated before being fed to mice. Drinking water and cages were autoclaved before use. Eight-week-old male C57BL/6J mice were used in the study following 1 week of acclimatization. They were divided into several groups based on the .......
The FMT schedule used in this study is outlined in Figure 1. After treatment with the antibiotic cocktail, the efficiency of intestinal microbiota depletion was analyzed by sequencing the 16S rRNA region. We detected 196 species in the ileum of naive mice, whereas 3-day antibiotic treatment rapidly reduced the bacterial species to 35Â (Figure 2A). There were eight species detected solely in mice that underwent the antibiotic cocktail treatment (
Antibiotics used in the depletion procedure have different antibacterial properties. Vancomycin is specific for gram-positive bacteria30. Oral doxycycline can induce significant intestinal microbiota composition changes in female C57BL/6NCrl mice31. Neomycin is a broad-spectrum antibiotic that targets most gut-resident bacteria32. It does not prevent intestinal inflammation, however. Broad-spectrum antibiotic cocktails are more effective than a singl.......
This work was carried out under the sponsor of Outstanding interdisciplinary project of West China Hospital, Sichuan University (Grant Nr: ZYJC18024) and National Natural Science Foundation of China (Grant: 81770101 and 81973540).
....Name | Company | Catalog Number | Comments |
5 mL syringe needle | Sheng guang biotech | 5mL | |
70 µm cell strainer | BD biosciences | 352350 | |
Ampicillin sodium salt | AMERESCO | 0339 | |
APC Streptavidin | BD biosciences | 554067 | |
Biotin anti-mouse IgA antibody | Biolegend | 407003 | |
Bovine serum albiumin (BSA) | Sigma | B2064-50G | |
C57BL/6J mice | Chengdu Dashuo | ||
CO2 | Xiyuan biotech | ||
E.Coil genome DNA | TsingKe | ||
Eppendorf tubes | Axygen | MCT150-C | |
Fast DNA stool mini Handbook | QIAGEN | 51604 | |
Metronidazole | Shyuanye | S17079-5g | |
Neomycin sulfate | SIGMA | N-1876 | |
Oral gavage needle | Yuke biotech | 10# | |
pClone007 Versatile simple TA vector kit | TsingKe | 007VS | |
Phosphate Buffer Saline (PBS) | Hyclone | SH30256 | |
Precellys lysing kit | Precellys | KT03961-1-001.2 | |
RT PCR SYBR MIX | Vazyme | Q411-01 | |
SYTO BC green Fluorescent Nucleic Acid Stain | Thermo fisher scientific | S34855 | |
V338 F primer | TsingKe | ACTCCTACGGGAGGCAGCAG | |
V806 R primer | TsingKe | GGACTACHVGGGTWTCTAAT | |
Vancomycin hydrochloride | Sigma | V2002 | |
Equipments | |||
BD FACSCalibur flow cytometer | BD biosciences | ||
Bead beater vortx | Scilogex | ||
BIORAD CFX Connect | BIORAD | ||
Centrifuge machine | Eppendorf | ||
Illumina MiSeq | Illumina | ||
Nanodrop nucleic acid measurements machine | Thermo fisher scientific | ||
Surgical instruments | Yuke biotech | ||
Software | |||
Adobe Illustrator CC 2015 | Version 2015 | ||
BIORAD CFX qPCR SOFTWARE | |||
FlowJo software | |||
Graphpad prism 7 | |||
Database | |||
Silva (SSU132) 16S rRNA database |
This article has been published
Video Coming Soon
ABOUT JoVE
Copyright © 2025 MyJoVE Corporation. All rights reserved