Name: application of rna interference in the pinewood nematode, bursaphelenchus xylophilus
Uploaded: 2022-03-09T15:00:00
Description: Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

This research was funded by the National Natural Science Foundation of China (31870637, 31200487) and jointly funded by the Zhejiang Key Research Plan (2019C02024, LGN22C160004).

The study was approved by the council for animal experimentation of Zhejiang Agricultural &#38; Forestry University. The B. xylophilus isolate NXY61 was originally extracted from a diseased Pinus massoniana in the Ningbo area of Zhejiang province, China11.
1. Gene cloning
NOTE: See the Table of Materials for details about the primers used in this protocol.
<ol>
	<li>Collect nematodes.
	<ol...

<ol>
	<li>Nicol, J. M., Jones, J., Gheysen, G., Fenoll, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+nematode+threats+to+world+agriculture.">Current nematode threats to world agriculture.</a> Genomics and Molecular Genetics of Plant-Nematode Interactions. , 21-43 (2011).</li><li>Jones, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+plant-parasitic+nematodes+in+molecular+plant+pathology.">Top 10 plant-parasitic nematodes in molecular plant pathology.</a> Molecular Plant Pathology. 14 (9), 946-961 (2013).</li><li>Kikuchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insights+into+the+origin+of+parasitism+in+the+emerging+plant+pathogen+Bursaphelenchus+xylophilus.">Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus.</a> PLoS Pathogens. 7 (9), 1002219 (2011).</li><li>Megen, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogenetic+tree+of+nematodes+based+on+about+1200+full-length+small+subunit+ribosomal+DNA+sequences.">A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences.</a> Nematology. 11 (6), 927-950 (2009).</li><li>Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+technology+extends+its+reach:+Engineering+plant+resistance+against+harmful+eukaryotes.">RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes.</a> African Journal of Biotechnology. 9 (45), 7573-7582 (2010).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 91 (6669), 806-811 (1998).</li><li>Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+novel+traits+in+plants+through+RNA+interference.">Engineering novel traits in plants through RNA interference.</a> Trends in Plant Science. 11 (11), 559-565 (2006).</li><li>Marmonier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+acquisition+of+specific+small+interfering+RNAs+inhibits+the+expression+of+some+target+genes+in+the+plant+ectoparasite+Xiphinema+index.">In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index.</a> International Journal of Molecular Sciences. 20 (13), 3266 (2019).</li><li>Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Attempt+to+silence+genes+of+the+RNAi+pathways+of+the+root-knot+nematode,+Meloidogyne+incognita+results+in+diverse+responses+including+increase+and+no+change+in+expression+of+some+genes.">Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes.</a> Frontiers in Plant Science. 11, 328 (2020).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+akt-1+in+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus.</a> Forest Pathology. 51 (1), 12647 (2021).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+mab-3+in+spermatogenesis+and+ontogenesis+of+pinewood+nematode,+Bursaphelenchus+xylophilus.">The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 77 (1), 138-147 (2021).</li><li>Tang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bxy-fuca+encoding+&#945;-L-fucosidase+plays+crucial+roles+in+development+and+reproduction+of+the+pathogenic+pinewood+nematode,+Bursaphelenchus+xylophilus.">Bxy-fuca encoding &#945;-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 76 (1), 205-214 (2020).</li><li>Wang, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+daf-8+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Forestry Research. , (2021).</li><li>Viglierchio, D. R., Schmitt, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+methodology+of+nematode+extraction+from+field+samples:+Baermann+funnel+modifications.">On the methodology of nematode extraction from field samples: Baermann funnel modifications.</a> Journal of Nematology. 15 (3), 438-444 (1983).</li><li>Zhu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observation+and+quantification+of+mating+behavior+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Visualized Experiments: JoVE. (118), e54842 (2016).</li><li>Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+reliable+reference+genes+for+RT-qPCR+analysis+of+Bursaphelenchus+mucronatus+gene+expression+from+different+habitats+and+developmental+stages.">Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages.</a> Frontiers in Genetics. 9, 269-279 (2018).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+RNA-mediated+interference+of+dumpy+genes+in+Bursaphelenchus+xylophilus+by+feeding+on+filamentous+fungal+transformants.">Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants.</a> International Journal for Parasitology. 46 (5-6), 351-360 (2016).</li><li>Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+the+cellulose+gene+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus,+using+RNA+interference.">Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference.</a> Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).</li><li>Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+cellulase+gene+knock+down+by+dsRNA+interference+on+the+development+and+reproduction+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus.</a> Nematology. 12 (12), 225-233 (2010).</li><li>Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cathepsin+L-like+cysteine+proteinase+genes+are+associated+with+the+development+and+pathogenicity+of+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 20 (1), 215 (2019).</li><li>Tabara, H., Grishok, A., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+in+C.+elegans:+Soaking+in+the+genome+sequence.">RNAi in C. elegans: Soaking in the genome sequence.</a> Science. 282 (5388), 430-431 (1998).</li><li>Urwin, P. E., Lilley, C. J., Atkinson, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ingestion+of+double-stranded+RNA+by+pre+parasitic+juvenile+cyst+nematodes+leads+to+RNA+interference.">Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference.</a> Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).</li><li>Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+of+dual+oxidase+in+the+plant+nematode+Meloidogyne+incognita.">RNA interference of dual oxidase in the plant nematode Meloidogyne incognita.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).</li><li>Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+to+root-knot+nematode+genes+encoding+esophageal+gland+proteins.">Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).</li><li>Chen, Q., Rehman, S., Smant, G., Jones, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+pathogenicity+proteins+of+the+potato+cyst+nematode+Globodera+rostochiensis+using+RNAi.">Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).</li><li>Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+clone+and+its+RNAi+interference+effect+analysis+of+mapk+gene+in+Bursaphelenchus+xylophilus+(+in+Chinese).">Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese).</a> Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).</li><li>Qiu, X., Wu, X., Huang, L., Ye, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+Bxpel1+gene+silencing+by+dsRNA+interference+on+the+development+and+pathogenicity+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 17 (1), 125 (2016).</li><li>Dulovic, A., Streit, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+knockdown+of+daf-12+in+the+model+parasitic+nematode+Strongyloides+ratti.">RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti.</a> PLoS Pathogens. 15 (3), 1007705 (2019).</li><li>Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Research+progress+of+gene+editing+technology.">Research progress of gene editing technology.</a> Life Science Research. 21 (3), 268-274 (2017).</li><li>Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-generated+double+stranded+RNA+induces+RNAi+in+plant-parasitic+nematodes+and+protects+the+host+from+infection.">Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.</a> Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).</li><li>Jiang, Z., Sher, A. K., David, G. H., Ralph, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+insect-resistant+plants:+RNAi-mediated+crop+protection.">Next-generation insect-resistant plants: RNAi-mediated crop protection.</a> Trends in Biotechnology. 35 (9), 871-882 (2017).</li></ol>

Although the life history and parasitic environment of B. xylophilus are different from those of other nematodes, there has been limited research on the molecular pathogenesis of this plant pathogen. Despite great progress made in the application of CRISPR/Cas9 genome editing technology in C. elegans and other nematodes, only RNAi technology applied to B. xylophilus has been published to date17. RNAi is one of the most powerful tools available to study the gene function ...

Plant-parasitic nematodes (PPNs) are a continuing threat to food security and forest ecosystems. They cause an estimated 100 billion USD in economic losses each year1, the most problematic of which are primarily root-knot nematodes, cyst nematodes, and pinewood nematodes. The pinewood nematode, Bursaphelenchus xylophilus, is a migratory, endoparasitic nematode, which is the causal pathogen of pine wilt disease2. It has caused great harm to pine forests worldwide3. Using the terminology of Van Megen et al.4, B. xylophilus is a member of the Parasitaphelenchidae and belongs to clade 10, whereas most other major plant parasites belong to clade 12.
As an independent and recently evolved plant parasite, B. xylophilus is an attractive model for comparative studies. To date, there has been substantial research on root-knot nematodes and cyst nematodes belonging to clade 12, which are obligate, sedentary endoparasites and are some of the most intensely studied nematodes. However, conducting further research in this important area comes with a major challenge: the function of parasitism genes is a research bottleneck. Functional studies generally include ectopic expression and knockdown/out experiments but rely on effective genetic transformation protocols for the nematode. As a result, reverse genetics in PPNs almost exclusively relies on gene silencing by RNAi.
RNAi, a mechanism widely present in eukaryotic cells, silences gene expression by introducing double-stranded RNA (dsRNA)5. To date, the posttranscriptional gene-silencing mechanism induced by dsRNA has been found in all studied eukaryotes, and RNAi technology, as a tool of functional genomics research and other applications, has developed rapidly in many organisms. Since the discovery of the RNAi machinery in Caenorhabditis elegans in 19986, RNAi techniques have become effective methods for identifying the gene function of nematodes and are proposed as a new way to effectively control pathogenic nematodes7.
RNAi is technically facile-soaking the juveniles in dsRNA can suffice; however, the efficacy and reproducibility of this approach vary widely with the nematode species and the target gene8. The silencing of 20 genes involved in the RNAi pathways of the root-knot nematode, Meloidogyne incognita, was investigated using long dsRNAs as triggers, resulting in diverse responses, including an increase and no change in the expression of some genes9. These results show that target genes may respond to RNAi knockdown differently, necessitating an exhaustive assessment of their suitability as targets for nematode control via RNAi. However, there is currently a paucity of research on the developmental and reproductive biology of B. xylophilus.
As a continuation of previous work10,11,12,13, we describe here a protocol for applying RNAi to study the function of&#160;the ppm-1 gene of B. xylophilus, including the synthesis of dsRNA, synthetic neurostimulant soaking, and quantitative polymerase chain reaction (qPCR) detection. The knowledge gained from this experimental approach will likely contribute markedly to understanding basic biological systems and preventing pine wilt disease.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Baermann funnel</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to isolate nematodes</td>
		</tr>
		<tr>
			<td>Beacon Designer 7.9</td>
			<td>Shanghai kangyusheng information technology co.</td>
			<td>n/a</td>
			<td>to design qPCR primers</td>
		</tr>
		<tr>
			<td>Botrytis cinerea</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>as food for nematodes</td>
		</tr>
		<tr>
			<td>Bursaphelenchus xylophilus</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>its number was NXY61 and was it was originally extracted from diseased 
			Pinus massoniana in Ningbo, Zhejiang province, China.</td>
		</tr>
		<tr>
			<td>constant temperature incubator</td>
			<td>Shanghai Jing Hong Laboratory Instrument Co.</td>
			<td>H1703544</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>Bio-Rad Laboratories</td>
			<td>1704466</td>
			<td>to achieve electrophoretic analysis</td>
		</tr>
		<tr>
			<td>Ethanol, 75%</td>
			<td>Sinopharm Chemical Reagent Co.</td>
			<td>80176961</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR030A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR390A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Gel imager</td>
			<td>LongGene Scientific Instruments Co.</td>
			<td>LG2020</td>
			<td>to make nucleic acid bands visible</td>
		</tr>
		<tr>
			<td>GraphPad Prism 8</td>
			<td>GraphPad Prism</td>
			<td>n/a</td>
			<td>to analyze the data and make figurs</td>
		</tr>
		<tr>
			<td>High Speed Centrifuge</td>
			<td>Hangzhou Allsheng Instruments Co.</td>
			<td>AS0813000</td>
			<td>centrifug</td>
		</tr>
		<tr>
			<td>High-flux tissue grinder</td>
			<td>Bertin</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>ImageJ software</td>
			<td>National Institutes of Health</td>
			<td>n/a</td>
			<td>to measure the body lengths</td>
		</tr>
		<tr>
			<td>isopropyl alcohol</td>
			<td>Shanghai Aladdin Biochemical Technology Co.</td>
			<td>L1909022</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Leica DM4B microscope</td>
			<td>Leica Microsystems Inc.</td>
			<td></td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>magnetic beads</td>
			<td>Aoran science technology co.</td>
			<td>150010C</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>MEGAscript T7 High Yield Transcription Kit</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>AM1333</td>
			<td>to synthesize dsRNA in vitro</td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 spectrophotometer</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>NanoDrop 2000/2000C</td>
			<td>to analyze the quality of the dsRNA</td>
		</tr>
		<tr>
			<td>PCR Amplifier</td>
			<td>Bio-Rad Life Medical Products Co.</td>
			<td>1851148</td>
			<td>to amplify nucleic acid sequence</td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>pGEM-T Easy vector</td>
			<td>Promega Corporation</td>
			<td>A1360</td>
			<td>for cloning</td>
		</tr>
		<tr>
			<td>Potato Dextrose Agar (Medium)</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur Botrytis cinerea</td>
		</tr>
		<tr>
			<td>Prime Script RT reagent Kit with gDNA Eraser</td>
			<td>Takara Bio Inc.</td>
			<td>RR047B</td>
			<td>to synthetic cDNA</td>
		</tr>
		<tr>
			<td>Primer Premier 5.0</td>
			<td>PREMIER Biosoft</td>
			<td>n/a</td>
			<td>to design PCR primers</td>
		</tr>
		<tr>
			<td>primers:ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-GATGCGAAGTTGCCAATCATTCT -3&#39;; R: 5&#39;- CCAGATCCAGTCCACCATACACC -3</td>
		</tr>
		<tr>
			<td>q-ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-CATCCGAATGGCAATACAG-3&#39;; R: 5&#39;-ACTATCCTCAGCGTTAGC-3&#39;</td>
		</tr>
		<tr>
			<td>Real-time thermal cycler&#160;qTOWER 2.2</td>
			<td>Analytique Jena Instruments (Beijing) Co.</td>
			<td></td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>shaking table</td>
			<td>Shanghai Zhicheng analytical instrument manufacturing co.</td>
			<td></td>
			<td>to soak nematodes</td>
		</tr>
		<tr>
			<td>stereoscopic microscope</td>
			<td>Chongqing Optec Instrument Co.</td>
			<td>1814120</td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>T7-GFP-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-TAATACGACTCACTATAGGGAAA 
			GGAGAAGAACTTTTCAC-3&#39;; R: 5&#39;-TAATACGACTCACTATAGGGCTG 
			TTACAAACTCAAGAAGG-3&#39;</td>
		</tr>
		<tr>
			<td>&#160;T7 promoter</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>TAATACGACTCACTATAGGG</td>
		</tr>
		<tr>
			<td>Takara MiniBEST Agarose Gel DNA Extraction Kit</td>
			<td>Takara Bio Inc.</td>
			<td>9762</td>
			<td>to recover DNA</td>
		</tr>
		<tr>
			<td>TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)</td>
			<td>Takara Bio Inc.</td>
			<td>RR820A</td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>trichloroethane</td>
			<td>Shanghai LingFeng Chemical Reagent Co.</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>15596026</td>
			<td>total RNA extraction reagent,to extract RNA</td>
		</tr>
	</tbody>
</table>

application of rna interference in the pinewood nematode, bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of pine trees. Despite the recognition of their economic and environmental significance, it has thus far been impossible to study the detailed gene functions of plant-parasitic nematodes (PPNs) using conventional forward genetics and transgenic methods. However, as a reverse genetics technology, RNA interference (RNAi) facilitates the study of the functional genes of nematodes, including B. xylophilus. 
This paper outlines a new protocol for RNAi of the ppm-1 gene in B. xylophilus, which has been reported to play crucial roles in the development and reproduction of other pathogenic nematodes. For RNAi, the T7 promoter was linked to the 5&#8242;-terminal of the target fragment by polymerase chain reaction (PCR), and double-stranded RNA (dsRNA) was synthesized by in vitro transcription. Subsequently, dsRNA delivery was accomplished by soaking the nematodes in a dsRNA solution mixed with synthetic neurostimulants. Synchronized juveniles of B. xylophilus (approximately 20,000 individuals) were washed and soaked in dsRNA (0.8 &#181;g/mL) in the soaking buffer for 24 h in the dark at 25 &#176;C.
The same quantity of nematodes was placed in a soaking buffer without dsRNA as a control. Meanwhile, another identical quantity of nematodes was placed in a soaking buffer with green fluorescent protein (gfp) gene dsRNA as a control. After soaking, the expression level of the target transcripts was determined using real-time quantitative PCR. The effects of RNAi were then confirmed using microscopic observation of the phenotypes and a comparison of the body size of the adults among the groups. The current protocol can help advance research to better understand the functions of the genes of B. xylophilus and other parasitic nematodes toward developing control strategies through genetic engineering.

Analysis of ppm-1 expression of B. xylophilus after RNAi 
The relative expression level of the ppm-1 gene of B. xylophilus soaked with GFP dsRNA and that soaked with target gene dsRNA was 0.92 and 0.52, respectively (the ppm-1 gene expression level of the ddH2O-treated control group was set to 1) (Figure 1). Thus, exogenous dsRNA has no effect on t...

Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions.

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

RNAi has become an effective method for identifying the function of genes in nematodes and are proposed as a new way to effectively control pathogenic nematodes. RNAi is soaking nematodes in dsRNA can suffice for the procedure. To begin, collect the nematodes by the Baermann funnel method.For this, place a clamped rubber tube below a funnel and place two layers of filter paper in the mouth of the funnel. Transfer the Botrytis cinerea fungal cultures to the funnel and add water to immerse the fungal mat. When nematodes are collected, add 500 microliters of extraction reagent and 100 microliters of magnetic beads to a two milliliter centrifuge tube.Aspirate 20 microliters of the nematodes and grind the samples at 9, 000 x g for 30 seconds. Incubate for five minutes and centrifuge at 12, 000 x g for 10 minutes at four degrees Celsius. Transfer the supernatant to a fresh centrifuge tube.Add 100 microliters of chloroform and mix by inverting the tube several times. Incubate for three minutes and then centrifuge at 12, 000 x g for 10 minutes at four degrees Celsius. Again, transfer the supernatant to a fresh centrifuge tube.Add 250 microliters of isopropyl alcohol and vortex vigorously. Centrifuge at 12, 000 x g for 10 minutes and vortex. Discard the supernatant and add 500 microliters of 75%ethanol to wash the RNA.Vortex the sample followed by centrifugation at 12, 000 x g for five minutes at four degrees Celsius. Air dry the RNA pellet for five minutes and resuspend it in 30 microliters of RNase free water. Calculate the RNA concentration using this formula and calculate the A260 to A280 ratio.Next, use a pair of primers to amplify the partial coding sequence of the BX ppm-1 gene from the B.xylophilus. Then clone the ppm-1 one gene sequences into a pGEM-T Easy vector containing the T7 promoter. Recover the 894 base pair long ppm-1 gene fragment by using the cloned plasmid as the template for pcr.Then, use an in vitro transcription kit to synthesize the dsRNA. Analyze the quality of the dsRNA using a spectrophotometer and visualize the products on a 1%agarose gel. Add four microliters of 5X soaking buffer and make up the volume to 20 microliters with double distilled water to get a final RNA concentration of 0.8 micrograms per milliliter.Then place the nematodes in the dish for 30 minutes and wait for the eggs to adhere to the bottom. Carefully remove the water and nematodes without disturbing the eggs until only the eggs remain in the dish. Hatch the collected eggs in the dark at 25 degree Celsius for 24 hours to obtain J2 larvae.Collect the larvae in a tube and wash them three times with double distilled water. Then, transfer the larvae into the tube containing the dsRNA solution. To this, add resorcinol solution to get a 1%solution.Place the larvae on a shaking table to ensure sufficient absorption of dsRNA into the larvae. For controls, soak the same quantity of nematodes in the soaking buffer without the dsRNA probe or with a GFP dsRNA probe. Perform a qPCR using the actB and tbb-2 genes as internal references to evaluate the changes in gene expression level.Use the delta delta Ct method to estimate the relative gene expression level from the dissolution curve and Ct value. After RNAi, culture the J2 larvae until adulthood on Botrytis cinerea lawns on PDA plates. Collect the adults using the Baermann funnel method as shown in section one.Acquire images of the adult nematodes under a microscope and use the ImageJ software to measure the body length of 50 male and 50 female nematodes. Analyze the data by calculating the mean and standard deviation for each sample. Apply Student's t test to compare the means of the samples from the different groups.Relative gene expression analysis after RNAi indicated that the ppm-1 dsRNA can effectively inhibit the expression of the ppm-1 one gene of B.Xylophilus. Whereas exogenous GFP dsRNA had no effect on the ppm-1 expression. After RNAi, the size of the adults markedly decreased despite attaining sexual maturity resulting in the small body size mutant phenotype.The mean body length of the mutant females and males was 544 and 526 micrometers compared to 971 and 912 micrometers for the control group The most important thing is to transfer the nematodes into the double strand RNA solution and add another reagent to stimulate the nematodes to feed. This method is suitable for large scale gene screen and is commonly used in cell research. Studying the gene function of B.Xylophilus by this method has guiding value for the biological control of B.Xylophilus.

Research

JoVE Journal

Biology

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Chromatin Isolation by RNA Purification (ChIRP)

Chromatin Isolation by RNA Purification ChIRP

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems ...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...