이 연구는 중국 국립 자연 과학 재단 (32172476, 32102275)의 프로젝트, 농업 과학 및 기술 혁신 프로그램 (CAAS-ZDRW202203, CAAS-ZDRW202108) 및 지역 과학 및 기술 개발을 이끄는 중앙 기금 (XZ202301YD0042C)의 자금 지원을 받았습니다.

알림: 이 프로토콜에 사용된 모든 재료, 기기, 소프트웨어 및 시약과 관련된 자세한 내용은 재료 표를 참조하십시오.
1. 곤충 배양의 수집 및 유지
<ol><li>아라비아 고무 분말과 물 5,000 : 9의 1 : 5 (v / v) 용액을 사용하여 Corcyra cephalonica (Stainton)의 ~ 16 개 알을25,26cm 카드에 부착합니다. 알림: 과밀로 인해 후속 이송 및 해부 절차가 불가능하므로 카드에 너무 많은 숙주 알을 부착하지 마십시오.</li>
	<li>숙주 알의 부화를 방지하려면 숙주 알 카드를 30분 동안 자외선(UV) 조사에 노출시킵니다(그림 1-i). 그런 다음 비활성화 계란이 있는 종이를 두께 1cm, 직경 8cm의 계란 카드로 자르고 각각 약 300-500개의 계란을 포함합니다(그림 1-ii)25,26,27.</li>
	<li>직경 2cm, 길이 8cm의 유리관에 80-120 T. denrolimi 말벌 집단을 도입합니다. 면으로 튜브를 밀봉하십시오. 알림: 말벌을 25 ± 1 °C의 온도로 유지하고 16 시간의 빛과 8 시간의 어둠의 밝음/어두움주기로 약 75 %의 상대 습도를 유지하십시오.</li>
	<li>기생을 위해 말벌에게 숙주 알 카드를 제시합니다(그림 1-ii). 말벌이 6시간 동안 숙주 알에 알을 낳도록 한 후 즉시 말벌을 제거하십시오. 참고 : 기생 기간을 과도하게 연장하면 숙주 알 내에서 T. denrolimi 자손이 과밀화되어 자손 말벌 사망률이 증가 할 수 있으므로 피하십시오28,29.</li>
</ol>2. dsRNA의 합성
<ol><li>이중 가닥 RNA(dsRNA) 합성을 위한 T7 promoter를 포함하는 프라이머 세트를 설계합니다. dsRNA 합성을 위해 표적 유전자(Ferhch)에서 300-400bp 세그먼트를 선택합니다.</li>
	<li>표적 유전자에 대한 dsRNA 및 음성 대조군으로 사용하기 위한 dsGFP 생산을 위해 상업적으로 합성된 프라이머 세트를 획득합니다.</li>
	<li>제조업체의 프로토콜9에 따라 참조된 키트를 사용하여 100마리의 T. denrolimi 말벌에서 RNA 함량을 추출합니다. RNA 함량의 품질을 확인하십시오. OD260/OD280 값의 범위가 1.8에서 2.0사이인 경우 진행합니다 9.</li>
	<li>2 μL의 5x 완충액(1 U/50 μL), 1 μL의 DNAse(1 U/50 μL) 및 6.5 μL의 RNA(~100 ng/μL), 0.5 μL의 H2O로 42°C에서 2분 동안 RNA 함량을 정제합니다.</li>
	<li>역전사 효소 중합효소 연쇄 반응(RT-PCR)을 수행하여 10μL의 정제된 RNA(~100ng/μL), 4μL의 5x 완충액(1U/50μL), 1μL의 효소 믹스 I(1U/50μL) 및 4μL의 H2O로 cDNA 템플릿을 생성합니다. 다음 설정을 사용하여 RT-PCR을 수행합니다. 37 °C에서 15 분, 85초 동안 5°C. 사용할 때까지 cDNA 산물을 -4 °C에서 보관하십시오.</li>
	<li>중합효소연쇄반응(PCR)을 수행하여 참조된 마스터 믹스(Taq II 10μL[1U/50μL], 0.8μL의 순방향 프라이머[0.4μM], 0.8μL의 역방향 프라이머[0.4μM], 0.8μL의 DNA 템플릿[40ng/μL], 7.6μL의 H2O)에 따라 dsRNA 염기서열을 증폭합니다. 다음 설정을 사용하여 PCR을 수행합니다: 94분 동안 2°C; 30초 동안 94°C, 30초 동안 60°C, 30초 동안 72°C에서 35회 주기; 72°C에서 2분 동안</li>
	<li>2.0% 아가로스 겔 5,9에 대한 전기영동으로 PCR 산물의 품질을 평가하고 Sanger 염기서열분석을 통해 표적 염기서열을 확인합니다.</li>
	<li>제조업체의 지침 9,23에 따라 겔 추출 키트를 사용하여 PCR 산물을 정제합니다.</li>
	<li>RNAi 시스템을 활용하여 30분 동안 37°C, 10분 동안 70°C, 20분 동안 25°C의 2x 완충액(0.02U/μL), 8μL의 DNA 템플릿(75ng/μL) 및 2μL의 효소 혼합물(1U/50μL)로 표적 유전자에 대한 dsRNA를 합성합니다. 합성된 dsRNA를 30μL의 뉴클레아제가 없는 물로 용리합니다.</li>
	<li>dsRNA 산물을 1.0% 아가로스 겔 5,9에서 시각화하여 품질을 평가합니다. dsRNA를 7,000ng/μL로 희석합니다. dsRNA 제품의 품질을 확인합니다. OD260/OD280 값의 범위가 1.8에서 2.0사이인 경우 진행합니다 9. dsRNA 제품을 사용할 때까지 -20 °C에서 보관하십시오.</li>
</ol>3. T. denrolimi 번데기의 이식
<ol><li>기생한 숙주 알을 25 ± 1°C에서 약 8일 동안 배양하고 16시간 빛/8시간 어두운 주기와 ~75%의 상대 습도를 유지합니다. 기생한 숙주 알은 5일30일 후에 검게 변합니다(그림 1-iv,v).</li>
	<li>숙주 계란 카드를 해부 현미경으로 옮깁니다. 한 쌍의 텅스텐 바늘(그림 1-vi)을 사용하여 숙주 알(그림 1-vii)에서 융모막을 꼼꼼하게 제거하고 내부에서 번데기를 회수합니다(그림 1-viii)5,17,18. 알림: 해부 바늘의 끝은 0.05mm 미만이어야 합니다.</li>
	<li>기판을 위한 깨끗한 판을 준비합니다. 15g/L 한천 용액 10-15mL를 부어 자연 냉각시킵니다(그림 2-i). 참고: 한천 용액을 0.5g의 스트렙토마이신과 혼합하여 시험관 내 오염 물질의 성장을 억제합니다.</li>
	<li>소독된 조각기를 사용하여 깊이 0.2-0.3mm, 너비 0.4-0.8mm의 여러 홈을 에칭합니다(그림 2-ii).</li>
	<li>작은 브러시(그림 2-iii)를 사용하여 절개된 숙주 알의 번데기를 한천 기질의 홈 중 하나에 이식합니다(그림 2-iv).</li>
	<li>3.4단계와 3.5단계를 반복하여 100-300마리의 번데기를 홈에 하나씩 이식합니다(그림 2-v).</li>
</ol>4. dsRNA를 T. denrolimi 번데기에 미세 주입
<ol><li>유리 바늘 풀러를 사용하여 유리 모세관을 당깁니다(그림 3-i,ii). 니들 풀러에서 Heat를 280으로, Velocity를 170으로, Delay를 250으로, Pull을 30으로 설정합니다(그림 3-iii). 미세 주입을 위해 여러 개의 모세관 유리 바늘을 준비합니다(그림 3-iv,v).</li>
	<li>연마판을 사용하여 유리 바늘 끝을 경사지게 합니다(그림 3-vi). 알림: 주사 바늘의 끝이 날카롭게 유지되는지 확인하십시오. 그렇지 않으면 번데기 폐사를 초래하거나 바늘을 통한 시약 흐름을 방해할 수 있습니다(그림 3-vii).</li>
	<li>마이크로 주입 펌프를 사용하여 약 2μL의 dsRNA 주입 용액에 7,000ng/μL를 주입하여 준비된 주사 바늘에 넣습니다(그림 3-vii).</li>
	<li>수백 개의 번데기가 들어 있는 한천 기질을 복합 현미경의 플랫폼으로 옮깁니다(그림 3-viii).</li>
	<li>주사 바늘을 T. denrolimi 번데기의 복부에 렌즈 아래 복부에 ~30° 각도로 조심스럽게 삽입합니다(그림 3-ix).</li>
	<li>주사액(단계 4.3)의 ~5nL를 T. denrolimi 번데기에 가능한 한 부드럽게 점차적으로 주입합니다. 참고: T. denrolimi 번데기는 dsRNA 용액을 주입할 때 약간 부풀어 오를 수 있습니다. 번데기에 과도한 양의 용액을 주입하거나 지나치게 큰 구멍이 있는 바늘을 사용하면 번데기가 조기에 사망할 수 있습니다. 번데기를 여러 마리에서 수십 마리 정도 주사한 후 바늘이 막히면 바늘을 교체합니다.</li>
	<li>4.5단계와 4.6단계를 반복하여 dsRNA를 번데기 600마리에 하나씩 주입합니다. 참고: 신뢰할 수 있는 RT-qPCR 분석을 위해서는 최소 100개의 번데기에서 RNA 함량을 분리해야 합니다. dsRNA 처리에서 3회 복제에 대해 최소 600개의 번데기를 주입하고 dsGFP 음성 대조군9에서 3회 복제합니다.</li>
</ol>5. T. denrolimi 번데기의 배양
<ol><li>주입된 번데기가 포함된 기질을 25 ± 1°C의 인큐베이터로 16시간/8시간 명암주기 및 ~75% RH로 옮깁니다.</li>
	<li>치료당 약 700마리의 T. denrolimi 번데기를 24시간 또는 48시간 동안 배양합니다. 복제당 100마리의 번데기 그룹에서 RNA 함량을 추출합니다9. 알림: 샘플에서 수축된 번데기(죽은 번데기)를 제거합니다. 그렇지 않으면 유전자 발현 검출에 오류가 발생할 수 있습니다.</li>
	<li>말벌이 나올 때까지 치료당 ~50마리의 T. denrolimi 번데기를 배양합니다(그림 3-x). 출현율과 변형률을 기록합니다.</li>
</ol>6. 표적 유전자 발현 검출
<ol><li>design tool을 사용하여 RT-qPCR의 표적 유전자 및 참조 유전자에 대한 primer set을 설계합니다. 참고: RT-qPCR 프라이머의 염기서열이 dsRNA의 표적 영역과 겹치지 않는지 확인하십시오.</li>
	<li>유전자 포크헤드 박스 O (FoxO)를 RT-qPCR 분석에서 참조 유전자로 사용합니다. FoxO 의 뇌관은 이전에보고된 바 있다 9.</li>
	<li>상업적으로 합성된 프라이머 세트를 얻습니다. 10 μL의 Taq II(1 U/50 μL), 0.8 μL의 순방향 프라이머(0.4 μM), 0.8 μL의 역방향 프라이머(0.4 μM), 0.8 μL의 주형(10 ng/μL) 및 7.6 μL의 H2O로 RT-qPCR을 수행합니다. 다음 설정을 사용하여 RT-qPCR을 수행합니다: 30초 동안 95°C; 5초 동안 95°C, 30초 동안 57°C, 30초 동안 72°C에서 35사이클; 10초 동안 95°C; 60초 동안 5°C, 95초 동안 5°C.</li>
	<li>2-ΔΔCt 방법 9,25를 사용하여 표적 유전자의 발현 값을 계산합니다.</li>
	<li>Kruskal-Wallis 테스트를 사용하여 다양한 처리(dsFerhch, dsGFP, 비주사)의 영향을 받는 표적 유전자의 발현을 분석합니다. 참고: 데이터의 이분산성과 비정규성으로 인해 잘못된 결론이 나올 수 있으므로 사후 비교를 위해 모수적 검정(예: t-검정)을 사용하지 마십시오25.</li>
</ol>

유전자 기능 분석을 위한 Trichogramma dendrolimi 의 RNAi 기술 발전

<ol>
	<li>Zang, L. S., Wang, S., Zhang, F., Desneux, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+control+with+Trichogramma+in+China:+History,+present+status+and+perspectives.">Biological control with Trichogramma in China: History, present status and perspectives.</a> Annu Rev Entomol. 66, 463-484 (2020).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimal+clutch+size+for+quality+control+of+bisexual+and+Wolbachia-infected+thelytokous+lines+of+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+mass+reared+on+eggs+of+a+substitutive+host,+Antheraea+pernyi+Gu&#233;rin-M&#233;neville+(Lepidoptera:+Saturniidae).">Optimal clutch size for quality control of bisexual and Wolbachia-infected thelytokous lines of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) mass reared on eggs of a substitutive host, Antheraea pernyi Gu&#233;rin-M&#233;neville (Lepidoptera: Saturniidae).</a> Pest Manag Sci. 76 (8), 2635-2644 (2020).</li><li>Li, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+status+of+the+biological+control+of+the+fall+armyworm+Spodoptera+frugiperda+by+egg+parasitoids.">Current status of the biological control of the fall armyworm Spodoptera frugiperda by egg parasitoids.</a> J Pest Sci. 96, 1345-1363 (2023).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+temperature+and+superparasitism+on+quality+and+characteristics+of+thelytokous+Wolbachia-infected+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+during+mass+rearing.">Effects of temperature and superparasitism on quality and characteristics of thelytokous Wolbachia-infected Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) during mass rearing.</a> Sci Rep. 9 (1), 18114 (2019).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Penetrance+during+Wolbachia-mediated+parthenogenesis+of+Trichogramma+wasps+is+reduced+by+continuous+oviposition,+associated+with+exhaustion+of+Wolbachia+titers+in+ovary+and+offspring+eggs.">Penetrance during Wolbachia-mediated parthenogenesis of Trichogramma wasps is reduced by continuous oviposition, associated with exhaustion of Wolbachia titers in ovary and offspring eggs.</a> Pest Manag Sci. 78 (7), 3080-3089 (2022).</li><li>Huang, N. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+and+large-scale+releases+of+Trichogramma+promote+pesticide+decrease+in+maize+in+northeastern+China.">Long-term and large-scale releases of Trichogramma promote pesticide decrease in maize in northeastern China.</a> Entomol Gen. 40 (4), 331-335 (2020).</li><li>Wang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+Trichogramma+japonicum+as+a+vector+of+Beauveria+bassiana+for+parasitizing+eggs+of+rice+striped+stem+borer,+Chilo+suppressalis.">Performance of Trichogramma japonicum as a vector of Beauveria bassiana for parasitizing eggs of rice striped stem borer, Chilo suppressalis.</a> Entomol Gen. 41 (2), 147-155 (2021).</li><li>Ning, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+identification+and+expression+pattern+of+the+sex+determination+genes+and+their+sex-specific+variants+in+the+egg+parasitoid+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae).">The identification and expression pattern of the sex determination genes and their sex-specific variants in the egg parasitoid Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> Front Physiol. 14, 1243753 (2023).</li><li>Huo, L. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+and+evaluation+of+RT-qPCR+reference+genes+for+expression+analysis+in+the+tiny+egg+parasitoid+wasp,+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae).">Selection and evaluation of RT-qPCR reference genes for expression analysis in the tiny egg parasitoid wasp, Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> J Asia Pac Entomol. 25 (2), 101883 (2022).</li><li>Leung, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+biological+control:+the+need+for+integrating+genetics+and+genomics.">Next-generation biological control: the need for integrating genetics and genomics.</a> Biol Rev Camb Philos Soc. 95 (6), 1838-1854 (2020).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Leonard, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+symbionts+activate+honey+bee+immunity+and+limit+pathogens.">Engineered symbionts activate honey bee immunity and limit pathogens.</a> Science. 367 (6477), 573-576 (2020).</li><li>Sun, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+an+essential+gene+involved+in+infestation+and+digestion+in+grain+aphid+through+plant-mediated+RNA+interference+generates+aphid-resistant+wheat+plants.">Silencing an essential gene involved in infestation and digestion in grain aphid through plant-mediated RNA interference generates aphid-resistant wheat plants.</a> Plant Biotechnol J. 17 (5), 852-854 (2019).</li><li>Li, M., Bui, M., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+Microinjection+and+Transplantation+Technique+for+Nasonia+vitripennis+Genome+Manipulation.">Embryo Microinjection and Transplantation Technique for Nasonia vitripennis Genome Manipulation.</a> J Vis Exp. 130, e56990 (2017).</li><li>Dalla Benetta, E., Chaverra-Rodriguez, D., Rasgon, J. L., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pupal+and+Adult+Injections+for+RNAi+and+CRISPR+Gene+Editing+in+Nasonia+vitripennis.">Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis.</a> J Vis Exp. 166, e61892 (2020).</li><li>Lynch, J. A., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+parental+RNA+interference+in+the+wasp+Nasonia+vitripennis.">A method for parental RNA interference in the wasp Nasonia vitripennis.</a> Nat Protoc. 1 (1), 486-494 (2006).</li><li>Zhu, K. Y., Palli, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms,+Applications,+and+Challenges+of+Insect+RNA+Interference.">Mechanisms, Applications, and Challenges of Insect RNA Interference.</a> Annu Rev Entomol. 65, 293-311 (2020).</li><li>Colinet, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+RNAi+in+a+Drosophila+endoparasitoid+wasp+and+demonstration+of+its+efficiency+in+impairing+venom+protein+production.">Development of RNAi in a Drosophila endoparasitoid wasp and demonstration of its efficiency in impairing venom protein production.</a> J Insect Physiol. 63, 56-61 (2014).</li><li>Wang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+digestive+tract+expressing+&#945;-amylase+influences+the+adult+lifespan+of+Pteromalus+puparum+revealed+through+RNAi+and+rescue+analyses.">A digestive tract expressing &#945;-amylase influences the adult lifespan of Pteromalus puparum revealed through RNAi and rescue analyses.</a> Pest Manag Sci. 75 (12), 3346-3355 (2019).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia-infected+Trichogramma+dendrolimi+is+outcompeted+by+its+uninfected+counterpart+in+superparasitism+but+does+not+have+developmental+delay.">Wolbachia-infected Trichogramma dendrolimi is outcompeted by its uninfected counterpart in superparasitism but does not have developmental delay.</a> Pest Manag Sci. 79 (3), 1005-1017 (2023).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posterior+concentration+of+Wolbachia+during+the+early+embryogenesis+of+the+host+dynamically+shapes+the+tissue+tropism+of+Wolbachia+in+host+Trichogramma+wasps.">Posterior concentration of Wolbachia during the early embryogenesis of the host dynamically shapes the tissue tropism of Wolbachia in host Trichogramma wasps.</a> Front Cell Infect Microbiol. 13, 1198428 (2023).</li><li>Lee, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+development+of+Trichogramma+evanescens+Westw.+and+its+influence+on+the+embryonic+development+of+its+host,+Attacus+cynthia+ricini+Boisd.">The development of Trichogramma evanescens Westw. and its influence on the embryonic development of its host, Attacus cynthia ricini Boisd.</a> Acta Entomol Sin Z. 11 (1), 89-119 (1961).</li><li>Shen, Y., Chen, Y. Z., Zhang, C. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+silencing+of+genes+in+the+brown+planthopper+Nilaparvata+lugens+affects+survival,+growth+and+female+fecundity.">RNAi-mediated silencing of genes in the brown planthopper Nilaparvata lugens affects survival, growth and female fecundity.</a> Pest Manag Sci. 77 (1), 365-377 (2021).</li><li>Wu, S., Yin, S., Zhou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+physiology+of+iron+trafficking+in+Drosophila+melanogaster.">Molecular physiology of iron trafficking in Drosophila melanogaster.</a> Curr Res Insect Sci. 50, 100888 (2022).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia-Driven+Memory+Loss+in+a+Parasitic+Wasp+Increases+Superparasitism+to+Enhance+Horizontal+Transmission.">Wolbachia-Driven Memory Loss in a Parasitic Wasp Increases Superparasitism to Enhance Horizontal Transmission.</a> mBio. 13 (6), e0236222 (2022).</li><li>Ning, S. F., Zhou, J. C., Liu, Q. Q., Zhao, Q., Dong, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gradual,+temperature-induced+change+of+secondary+sexual+characteristics+in+Trichogramma+pretiosum+infected+with+parthenogenesis-inducing+Wolbachia.">Gradual, temperature-induced change of secondary sexual characteristics in Trichogramma pretiosum infected with parthenogenesis-inducing Wolbachia.</a> PeerJ. 7, e7567 (2019).</li><li>Zhang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decreased+Wolbachia+titers+cause+gradual+change+in+masculinization+of+intersex+individuals+of+thelytokous+Trichogramma+dendrolimi.">Decreased Wolbachia titers cause gradual change in masculinization of intersex individuals of thelytokous Trichogramma dendrolimi.</a> Entomol Gen. 42 (5), 751-759 (2022).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-parasitism:+A+promising+approach+to+simultaneously+produce+Trichogramma+chilonis+and+T.+dendrolimi+on+eggs+of+Antheraea+pernyi.">Multi-parasitism: A promising approach to simultaneously produce Trichogramma chilonis and T. dendrolimi on eggs of Antheraea pernyi.</a> Entomol Gen. 41 (6), 627-636 (2021).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Thelytokous+parthenogenesis-inducing+Wolbachia+on+the+fitness+of+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+in+superparasitised+and+single-parasitised+hosts.">Effects of Thelytokous parthenogenesis-inducing Wolbachia on the fitness of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) in superparasitised and single-parasitised hosts.</a> Front Ecol Evol. 9, 730664 (2021).</li><li>Flanders, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notes+on+the+life+history+and+anatomy+of+Trichogramma.">Notes on the life history and anatomy of Trichogramma.</a> Ann Entomol Soc Am. 30 (2), 304-308 (1937).</li></ol>

저자는 이해 상충이 없음을 선언합니다.

Trichogramma 말벌은 특히 농업 및 임업에서 다양한 나비목 해충을 표적으로 하는 효과적인 생물학적 방제제로 인식되고있습니다 1. 이 작은 말벌은 숙주 알 내에서 미성숙 단계를 거치는데, 이는 RNAi 실험 5,18을 수행하는 데 어려움을 주는 특성입니다. 이 연구는 T. denrolimi에서 RNAi 실험을 수행하기 위한 포괄적인 시각적 가이...

Trichogramma spp.는 전 세계 농업 및 산림 생태계에서 광범위한 나비목 해충에 대한 고효율 생물학적 방제제로 광범위하게 활용된 계란 기생충 그룹입니다 1,2,3,4. 대량 사육 Trichogramma의 적용은 해충의 지속 가능한 관리를위한 환경 친화적 인 접근 방식을 제공합니다 5,6,7. Trichogramma 말벌의 분자 생물학을 이해하면 유전자 조절 및 게놈 편집 방법론을 조사하여 이러한 생물학적 방제제 8,9의 대량 사육 효율성과 현장 성능을 향상시키는 데 귀중한 통찰력을 제공합니다10.
1998년 예쁜꼬마선충(Caenorhabditis elegans)에서 이중 가닥 RNA(dsRNA) 매개 특이적 유전적 간섭이 발견된 이후, RNA 간섭(RNAi) 방법은 표적 유전자의 발현을 억제하여 유기체의 조절 메커니즘을 탐구하기 위한 중요한 유전 툴킷으로 발전했습니다11. RNAi 실험은 수많은 곤충 종의 유전자 기능을 연구하는 데 널리 적용되는 표준 방법론이 되었습니다12,13. 그럼에도 불구하고, RNAi의 조작은 많은 기생충 종들, 특히 내생충 Chalcidoidea 과에 속하는 종들 사이에서 만만치 않은 도전을 제시한다 14,15,16. RNAi 방법은 적어도 13개의 기생충 종 14,15,16,17,18,19에서 문서화되었습니다. 이 중 RNAi 접근법은 Nasonia 말벌에서 포괄적으로 수행되었으며 배아, 유충, 번데기 및 성충을 포함한 발달 단계 전반에 걸쳐 적용할 수 있습니다 14,15,16. Nasonia 말벌은 외부 기생충으로, 숙주 번데기와 번데기 사이의 틈새 공간에서 자손이 발달하여 시험관 내에서 배양할 수 있고 미세 주입과 같은 특정 치료를 견딜 수 있습니다. Nasonia 말벌과 달리 Trichogramma 개체는 숙주 알 내에서 전체 배아, 유충 및 번데기 발달을 겪습니다. 배아 및 유충 단계의 층(dsRNA 투과성을 저해할 수 있음), 손상에 대한 취약성 및 체외 생존의 어려움은 만만치 않은 장애물을 제시합니다 20,21,22. 또한, Trichogramma 개체의 작은 크기는 성인 또는 번데기 길이에서 약 ~ 0.5mm로20,21,22를 조작하기에 매우 복잡합니다.
본 연구에서는 Trichogramma denrolimi Matsumura에서 RNA 간섭(RNAi) 실험을 수행하기 위한 포괄적인 절차를 간략하게 설명합니다. 이 절차에는 (1) 이중 가닥 RNA(dsRNA)의 설계 및 합성, (2) T. denrolimi 번데기의 미세 주입, (3) 번데기의 이식 및 체외 배양, (4) RT-qPCR 분석을 통한 표적 유전자 녹다운 검출이 포함됩니다. RNAi 실험을 위해 선택된 표적 유전자는 페리틴 중쇄 상동성(ferhch)이다. 철 결합 단백질인 FerHCH는 항산화 기능이 부여된 페록시다아제 센터를 함유하여 Fe2+에서 Fe3+로의 산화를 촉진합니다. 산화 환원 평형과 철 항상성을 유지하여 다양한 유기체의 성장과 발달에 없어서는 안될 역할을합니다. FerHCH의 고갈은 철분의 과잉 축적을 초래하여 돌이킬 수 없는 조직 손상을 초래할 수 있으며, 종종 성장 결함, 기형 및 사망률을 포함한 중요한 표현형 변화를 초래할 수 있습니다23,24. 이 연구는 T. denrolimi에서 RNAi를 수행하기 위한 단계별 가이드를 제공하며, 이는 Trichogramma 말벌의 더 넓은 맥락에서 유전자 기능을 조사하는 데 매우 유용할 것입니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2x ES Taq MasterMix (Dye)</td>
			<td>Cowin Biotech, China</td>
			<td>CW0690H</td>
			<td>To amplify the dsRNA sequences</td>
		</tr>
		<tr>
			<td>20x PBS Buffer, DEPC treated (7.2-7.6)</td>
			<td>Sangon Biotech, China</td>
			<td>B540627-0500</td>
			<td>To dilute dsRNA</td>
		</tr>
		<tr>
			<td>Agar strip</td>
			<td>Shishi Globe Agar Industries Co.,Ltd, China</td>
			<td>n/a</td>
			<td>To make culture medium</td>
		</tr>
		<tr>
			<td>Ampicillin sodium</td>
			<td>Sangon Biotech, China</td>
			<td>A610028</td>
			<td>To make culture medium</td>
		</tr>
		<tr>
			<td>Bioer Constant temperature metal bath&#160;</td>
			<td>BIOER, China</td>
			<td>MB-102</td>
			<td>To synthesis dsRNA</td>
		</tr>
		<tr>
			<td>Borosilicate glass capillary&#160;</td>
			<td>WPI, USA</td>
			<td>1B100-4</td>
			<td>To pull capillary glass needle</td>
		</tr>
		<tr>
			<td>Clean bench&#160;</td>
			<td>Airtech, China</td>
			<td>SW-CJ-1FD</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Double distilled water</td>
			<td>Sangon Biotech, China</td>
			<td>A500197-0500</td>
			<td>To dilute cDNA</td>
		</tr>
		<tr>
			<td>Environmental Testing chamber&#160;</td>
			<td>Panasonic, Japan</td>
			<td>MLR-352H-PC</td>
			<td>To culture T. denrolimi</td>
		</tr>
		<tr>
			<td>Eppendorf Centrifuge&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>5418R</td>
			<td>To store RNA content</td>
		</tr>
		<tr>
			<td>Eppendorf FemtoJet 4i</td>
			<td>Eppendrof, Germany</td>
			<td>FemtoJet 4i</td>
			<td>To inject T. denrolimi</td>
		</tr>
		<tr>
			<td>Eppendorf Refrigerated Centrifuge&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>5810R</td>
			<td>Centrifuge</td>
		</tr>
		<tr>
			<td>Ethanol solution (75%, RNase-free)</td>
			<td>Aladdin, China</td>
			<td>M052131-500ml</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Gel Extraction Kit</td>
			<td>Omega, USA</td>
			<td>D25000-02</td>
			<td>To extract cDNA</td>
		</tr>
		<tr>
			<td>GUM Arabic</td>
			<td>Solarbio, China</td>
			<td>CG5991-500g</td>
			<td>To make egg card</td>
		</tr>
		<tr>
			<td>Isopropyl alchohol</td>
			<td>Aladdin, China</td>
			<td>80109218</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Laser-Based Micropipette Puller&#160;</td>
			<td>SUTTER, USA</td>
			<td>P-2000</td>
			<td>To pull capillary glass needle</td>
		</tr>
		<tr>
			<td>Microloader&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>20 &#181;L</td>
			<td>To load dsRNA</td>
		</tr>
		<tr>
			<td>Multi-sample tissue grinder&#160;</td>
			<td>LICHEN, China</td>
			<td>LC-TG-24</td>
			<td>To grind T. denrolimi</td>
		</tr>
		<tr>
			<td>Needle Grinder&#160;</td>
			<td>SUTTER, USA</td>
			<td>BV-10-E</td>
			<td>To grind capillary glass needle</td>
		</tr>
		<tr>
			<td>Nuclease-Free Water</td>
			<td>Sangon Biotech, China</td>
			<td></td>
			<td>To dilute RNA</td>
		</tr>
		<tr>
			<td>OLYMPUS Microscope</td>
			<td>OLYMPUS, Japan</td>
			<td>XZX16</td>
			<td>To observe T. denrolimi</td>
		</tr>
		<tr>
			<td>PCR machine&#160;</td>
			<td>Bio-rad, USA</td>
			<td>S-1000</td>
			<td>For DNA amplification</td>
		</tr>
		<tr>
			<td>PowerPac Basic</td>
			<td>Bio-rad, USA</td>
			<td>PowerPacTM Basic</td>
			<td>To detect the quality of dsRNA&#160;</td>
		</tr>
		<tr>
			<td>Primer of dsGFP (Forward)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			ACAAACCAAGGCAAGTAATA</td>
		</tr>
		<tr>
			<td>Primer of dsGFP (Reverse)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			CAGAGGCATCTTCAACG</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for qPCR (Forward)</td>
			<td></td>
			<td></td>
			<td>TGAAGAGATTCTGCGTTCTGCT</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for qPCR (Reverse)</td>
			<td></td>
			<td></td>
			<td>CTGTAGGAACATCAGCAGGCTT</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for RNAi (Reverse)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG]AG 
			TAGCCATCATCTTTCC</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for RNAi(Forward)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			ACACTGTCAATCGTCCTG</td>
		</tr>
		<tr>
			<td>Primer of FoxO for qPCR (Forward)</td>
			<td></td>
			<td></td>
			<td>CTACGCCGATCTCATAACGC</td>
		</tr>
		<tr>
			<td>Primer of FoxO for qPCR (Reverse)</td>
			<td></td>
			<td></td>
			<td>TGCTGTCGCCCTTGTCCT</td>
		</tr>
		<tr>
			<td>PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time)</td>
			<td>TaKaRa, Japan</td>
			<td>RR047A</td>
			<td></td>
		</tr>
		<tr>
			<td>Quantitative Real-time PCR&#160;</td>
			<td>Bio-rad, USA</td>
			<td>CFX 96 Touch</td>
			<td>To perform reverse transcriptase polymerase chain reaction (RT-PCR)&#160;</td>
		</tr>
		<tr>
			<td>Real-time PCR (TaqMan) Primer and Probes Design Tool</td>
			<td></td>
			<td></td>
			<td>https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/</td>
		</tr>
		<tr>
			<td>T7 RiBoMAX Express RNAi System</td>
			<td>Promega, USA</td>
			<td>P1700</td>
			<td>To synthesis dsRNA &#160;in vitro&#160;</td>
		</tr>
		<tr>
			<td>TB Green Premix Ex TaqTM <img alt="Equation 1" src="/files/ftp_upload/66250/66250eq01.jpg" style="margin: auto;" /> (Til RnaseH Plus)</td>
			<td>TaKaRa, Japan</td>
			<td>RR820A</td>
			<td>To perform RT-qPCR</td>
		</tr>
		<tr>
			<td>Trichloromethane</td>
			<td>KESHI, China</td>
			<td>GB/T682-2002</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Ambion, USA</td>
			<td>15596018</td>
			<td>To extract total RNA content from samples</td>
		</tr>
		<tr>
			<td>Ultra-low Temperature Freezer&#160;</td>
			<td>Thermo, USA</td>
			<td>Forma 911</td>
			<td></td>
		</tr>
	</tbody>
</table>

rna interference in the egg parasitoid, trichogramma dendrolimi matsumura

알 기생충인 Trichogramma spp는 농업과 산림에서 다양한 나비목 해충에 대한 효율적인 생물학적 방제제로 인정받고 있습니다. Trichogramma 자손의 미성숙 단계는 숙주 난자 내에서 발달하여 현저한 작음(성인 길이 약 0.5mm)을 나타냅니다. RNA 간섭(RNAi) 방법론은 수많은 유기체의 유전자 기능을 규명하기 위한 중요한 도구로 부상했습니다. 그러나 Trichogramma와 같은 특정 작은 기생충 종에서 RNAi를 조작하는 것은 일반적으로 상당한 도전을 제기했습니다. 이 연구에서는 Trichogramma denrolimi에서 효율적인 RNAi 방법을 제시합니다. 간략하게 설명된 절차에는 숙주 난자에서 개별 T. dendrolimi 검체의 획득 및 분리, 이중 가닥 RNA(dsRNA)의 설계 및 합성, T. dendrolimi 번데기의 체외 이식 및 배양, dsRNA의 미세 주입 및 RT-qPCR 분석을 통한 표적 유전자 녹다운의 후속 평가가 포함됩니다. 이 연구는 T. dendrolimi에서 RNAi 실험을 수행하기 위한 포괄적이고 시각적으로 상세한 절차를 제공하여 연구원이 이 종의 유전자 조절을 조사할 수 있도록 합니다. 또한 이 방법론은 약간의 조정으로 다른 Trichogramma 종의 RNAi 연구 또는 미세 주입에 적용할 수 있으므로 다른 기생충 종에서 RNAi 실험을 수행하는 데 귀중한 참고 자료가 됩니다.

Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide1,2,3,4. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests5,6,7. Understanding the molecular biology of Trichogramma wasps provides valuable insights into enhancing the mass-rearing efficiency and field performance of these biological control agents8,9by investigating the methodology of gene regulation and genome editing10.
Since the discovery of double-stranded RNA (dsRNA)-mediated specific genetic interference in Caenorhabditis elegans in 1998, the RNA-interference (RNAi) method has evolved into a vital genetic toolkit for exploring the regulatory mechanisms of organisms by suppressing the expression of target genes11. RNAi experiments have become a standard methodology widely applied to study gene function in numerous insect species12,13. Nevertheless, the manipulation of RNAi presents a formidable challenge in many parasitoid species, particularly among those belonging to the endoparasitic Chalcidoidea family14,15,16. The RNAi method has been documented in at least 13 parasitoid species14,15,16,17,18,19. Among these, the RNAi approach has been comprehensively conducted in Nasonia wasps and is applicable throughout the developmental stages, including embryos, larvae, pupae, and adults14,15,16. It is noteworthy that Nasonia wasps are ectoparasitoids, with their offspring developing in the interstitial space between the host pupa and the puparium, enabling their cultivation in vitro and making them tolerate certain treatments, such as micro-injection. Unlike Nasonia wasps, Trichogramma individuals undergo their entire embryonic, larval, and pupal development inner the host egg. The layer at embryo and larva stages (which may impede dsRNA permeability), vulnerability to damage, and the difficulty in surviving in vitro present formidable obstacles20,21,22. Additionally, the diminutive size of Trichogramma individuals, approximately ~0.5 mm in adult or pupal length, renders them exceedingly intricate to manipulate20,21,22.
In the present study, we outline a comprehensive procedure for conducting RNA interference (RNAi) experiments in Trichogramma denrolimi Matsumura. This procedure encompasses the following procedures: (1) the design and synthesis of double-stranded RNA (dsRNA), (2) microinjection of T. denrolimi pupae, (3) the transplantation and in vitro incubation of these pupae, and (4) the detection of target gene knockdown through RT-qPCR analysis. The target gene selected for the RNAi experiment is the ferritin heavy chain homology (Ferhch). FerHCH, an iron-binding protein, contains a ferroxidase center endowed with antioxidant capabilities, facilitating the oxidation of Fe2+ to Fe3+. It plays an indispensable role in the growth and development of various organisms by maintaining redox equilibrium and iron homeostasis. Depletion of FerHCH can result in the overaccumulation of iron, leading to irreversible tissue damage, and often culminating in significant phenotypic alterations, including growth defects, deformities, and mortality23,24. This study offers a step-by-step guide for conducting RNAi in T. denrolimi, which will be invaluable for investigating the gene functions within the broader context of Trichogramma wasps.

저자 스포트라이트: RNA 간섭을 통한 Wolbachia-Induced Thelytokous partthenogenesis 및 Genetic Toolkit Development 조사

계란 기생충의 RNA 간섭, Trichogramma dendrolimi Matsumura

dsFerhch를 주입한 번데기(T. denrolimi 번데기)의 출현율은 dsGFP를 주입한 번데기 또는 주입하지 않은 번데기의 출현률보다 현저히 낮았다(표 1). 출현한 말벌 중 dsFerhch를 투여받은 T. denrolimi 말벌의 51.85%가 변형된 작은 날개를 발달시켰다. 변형된 말벌은 dsGFP를 주입하거나 주입하지 않은 말벌에서 관찰되지 않았다(표 1). 또한, dsFerhch<...

Watch this Scientific Journal Video about RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura at JoVE.com

RNA 간섭(RNAi)의 조작은 Trichogramma 말벌과 같이 크기가 작은 많은 기생충 종에서 만만치 않은 도전을 제시합니다. 이 연구는 Trichogramma denrolimi에서 효율적인 RNAi 방법을 설명했습니다. 본 방법론은 Trichogramma 말벌의 유전자 조절을 조사하기 위한 강력한 모델을 제공합니다.

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and ...

Trichogramma 말벌은 농업에서 나비목 해충을 방제하는 데 사용되는 알 기생충 그룹입니다. 세포 내 박테리아 Wolbachia는 일부 Trichogramma 말벌에서 thelytokous parthenogenesis를 유도합니다. 우리는 Trichogramma 말벌의 Wolbachia 및 성 결정 시스템의 메커니즘에 답하려고 노력하고 있습니다.우리는 Trichogramma 말벌에서 RNA 간섭 방법을 개발했습니다. 이 방법은 Trichogramma의 유전자 기능을 조사하기 위한 중요한 유전 툴킷입니다. Trichogramma 자손의 미성숙 단계는 숙주 난자 내에서 발달합니다.Trichogramma의 몸 크기는 매우 작으며 성인 길이는 약 0.5mm입니다. RNA 간섭 및 게놈 편집과 같은 유전 도구의 조작은 이 작은 기생 말벌에게 엄청난 도전을 제시합니다. 수십 년 동안 전체 Trichogramma 속 내의 유전자 기능은 거의 연구되지 않았습니다.본 방법론은 Trichogramma 말벌의 발달 및 생리학적 활동 중 유전자 조절을 조사하기 위한 강력한 모델을 제공합니다.

rna-interference-egg-parasitoid-trichogramma-dendrolimi

Research

JoVE Journal

Biology

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

1.1K 조회수.  Shenyang Agricultural University. Trichogramma 말벌은 농업에서 나비목 해충을 방제하는 데 사용되는 알 기생충 그룹입니다. 세포 내 박테리아 Wolbachia는 일부 Trichogramma 말벌에서 thelytokous parthenogenesis를 유도합니다. 우리는 Trichogramma 말벌의 Wolbachia 및 성 결정 시스템의 메커니즘에 답하려고 노력하고 있습니다.우리는 Trichogramma 말벌에서 RNA 간섭 방법을 개발했습니다. 이 방법은 Trichogramma의 유전자 기능을 ?...

비디오: 저자 스포트라이트: RNA 간섭을 통한 Wolbachia-Induced Thelytokous partthenogenesis 및 Genetic Toolkit Development 조사

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.