우리는이 비디오 및 문서를 비평에 참여를 위해 갈색과 램 실험실의 구성원을 감사하고 싶습니다. 이 작품은 건강 연구와 건강 연구에 대한 마이클 스미스 재단에 대한 캐나다 연구소에서 자금을 지원했다.

DNA 추출 및 샘플 준비 다른 샘플의 다양한 (교양 세포, 신선한뿐만 아니라 포르말린 고정 파라핀 - 임베디드 조직 얼어붙은)에서 DNA가 MeDIP 사용할 수 있습니다. 같은 histones으로 관련된 단백질없이 높은 정화 DNA를 사용하는 것이 중요합니다. 그것의 DNA quantitation 및 항체 바인딩 모두를 방해할 수 있으므로, 샘플에서 가능한 한 많은 RNA를 제거하는 것도 중요합니다. MeDIP에 사용되는 DNA의 양은 200 NG에서 사용할 DNA의 양에 따라 1 μg 범위 수 있습니다. 이 프로토콜을 입증하기 위해, DNA 1 μg가 사용됩니다. 다음 프로토콜은 교양 세포에서 고품질의 이중 좌초 DNA를 제공합니다. 다른 프로토콜은 다른 샘플 형식에서 DNA의 추출을위한 고용해야합니다. <ol><li> 1.7 ML Eppendorf 튜브에 세포 펠렛을 소화 버퍼 400 μl를 추가합니다. </li><li> 튜브에 proteinase K 100 μg을 추가하고 50 밤새 품어 ° C. </li><li> 500 μl 페놀 산도 7 추가하고 반전에 의해 부드럽게하지만 철저히 섞는다. </li><li> 실온에서 10 분 13 000g에 스핀. </li><li> 새로운 튜브로 수성 (위) 분수를 제거합니다. </li><li> 반복되면 3-5 단계를 반복합니다. </li><li> 500 μl 1시 1분 페놀 / 클로로포름 산도 7 추가하고 반전에 의해 부드럽게하지만 철저히 섞는다. </li><li> 실온에서 10 분 13 000g에 스핀. </li><li> 새로운 튜브로 수성 (위) 분수를 제거합니다. </li><li> RNase 40 μg을 추가하고 37 1 시간을 품어 ° C. </li><li> 500 μl 페놀 산도 7 추가하고 반전에 의해 부드럽게하지만 철저히 섞는다. </li><li> 실온에서 10 분 13 000g에 스핀. </li><li> 새로운 튜브로 수성 (위) 분수를 제거합니다. </li><li> 반복 일단 13을 통해 11 단계를 반복합니다. </li><li> 500 μl 1시 1분 페놀 / 클로로포름 산도 7 추가하고 반전에 의해 부드럽게하지만 철저히 섞는다. </li><li> 실온에서 10 분 13 000g에 스핀. </li><li> 새로운 튜브로 수성 (위) 분수를 제거합니다. </li><li> 1/10th 볼륨에게 3 M의 아세트산 나트륨 (40 μl)을 추가하고 잘 섞는다. </li><li> 100 % 에탄올 2 권 (900 μl)를 추가, 20 분에 대해 -20 ° C에서 잘 믹스, 장소. </li><li> 4 20 분 13 000g에 스핀 ° C. </li><li> , 에탄올을 제거 펄스 스핀, 그리고 잔류 에탄올을 제거하십시오. </li><li> 세척 500 μl 차가운 70 % 에탄올을 추가합니다. 4 20 분 13 000g에 스핀 ° C. </li><li> , 70 % 에탄올을 제거 펄스 스핀, 그리고 pipetting하여 잔류 에탄올을 제거하십시오. </li><li> 공기가 잔류 에탄올의 모든 흔적을 제거하는 실온에서 10 분 오픈 뚜껑과 펠릿 건조. </li><li> 4 밤새 소독 dH2O의 50 μl에 Resuspend의 DNA ° C. </li><li> NanoDrop 분광을 이용하여 DNA를 계량. 260 : 1.8 280 비율이 이상적입니다. </li><li> 100 BP의 사다리와 아가로 오스 겔에 DNA의 품질과 크기 범위를 확인합니다. 게놈 DNA의 조금은 10 NG는 SYBR 골드 같은 DNA의 소량에 매우 민감합니다 염료를 사용하여 얼룩 다음 1.7 % 아가로 오스 겔에서 실행할 수 있습니다. </li><li> 샘플 당 하나의 siliconized 튜브, 소독 DH 2 O.와 만들어진 볼륨의 나머지 부분과 함께 50 μl의 총 볼륨의 DNA 1 μg를 준비 </li></ol> DNA SONICATION DNA의 sonication과 MeDIP 프로토콜은 튜브 벽에 단백질이 아닌 특정 바인딩을 방지하기 위해 siliconzied 튜브에 수행되어야합니다. DNA 샘플을위한 최적의 sonication 시간은 겔 전기 영동 (단계 27)에서 결정된 DNA 샘플 조각의 정도를 기준으로합니다. 예를 들어, 교양 세포에서 추출한 DNA는 매우 높은 분자량의해야하고, 이후 종종 부분적으로 저하 아르 보존 시료에서 추출한 DNA보다 더 많은 sonication 필요합니다. 샘플이 균일하게 높은 분자량의 경우,는 각각 샘플을 확인하지 않고이 프로토콜에 설명되어있는 sonication과 함께 진행하는이 시점에서 합리적이다. 샘플 아카이브 샘플로 조각난있다면, 그것은 300 - 100bp 조각을 얻기 위해 sonication 시간을 줄임으로써 가능성 sonication 절차를 적응하기 위해 필요한 것입니다. 당신은 부분적으로 저하, sonication 매개 변수의 최적화 관심이 그 대표 샘플을 수행할 수 아르 샘플을 처리할 것으로 예상하십시오. 겔 전기 영동 (단계 27)에서 관찰의 DNA 조각의 정도에 따라, 실험자의 샘플에 대한 최적의 sonication 시간을 미리하실 수 있습니다. 여기 우리는 높은 분자량의 DNA를 사용하여 자동 sonicating 장치 (Diagenode에서 Bioruptor, UCD - 200 TM)와 sonication하여 300-1000 BP의 DNA 조각을 얻을 수있는 방법을 설명합니다. <ol><li> Biorupter에 물이 4 있어야 ° C. </li><li> 자동 설정 7 분 (30 초 최대 전력에서 30 초 해제)에 대한 Sonicate. </li><li> immunoprecipitation (IP) 반응에 대한 siliconized 1.7 ML의 원심 분리기 튜브의 sonicated 제품과 장소 800 NG를 (40 μl)를 제거합니다. </li><li> 입력으로 봉사하는 나머지 200 NG (10 μl) (IN) (4 스토어 ° C)을 참조 DNA를 별도로 설정합니다. </리&gt; </ol> METHYLATED DNA의 IMMUNOPRECIPITATON <ol><li> 물 목욕 10 분 95 ° C에서 IP 반응 (800 NG)에 사용되는 DNA를 변성. </li><li> 얼음 즉시 쿨. 다음 단계로 진행하기 전에 (얼음 약 5 분)을 완전히 DNA은 식지. </li><li> 5 μg 단클론 항체를 추가합니다. </li><li> 500 μl의 최종 볼륨 IP 버퍼 (이 프로토콜을 통해 상온에서 사용) 추가합니다. </li><li> 튜브 홀더를 회전 4에서 2 시간 ° C에 대해 숙고하다. </li><li> 5 단계가 완료되기 전에 (6-11 단계) 세탁하여 Dynabeads를 준비합니다. 첫째, vortexing하여 유리병에 철저하게 구슬을 resuspend. </li><li> 새로운 siliconized 튜브 (예를 들어, 8 개의 반응을하는 경우, 9, 즉 270 μl 정도 구슬을 제거)로, 반응 더하기 하나 당 resuspended Dynabeads 30 μl를 (~ 2 × 10 7) 전송합니다. </li><li> 상온에서 2 분에 대한 자성 랙에 튜브를 삽입합니다. </li><li> 뜨는을 피펫. 뜨는 제거하면, 피펫 팁과 내부 벽 (구슬은 자석을 유치 어디)에 대한 구슬을 감동하지 마십시오. </li><li> 자석에서 튜브를 제거하고 IP 버퍼의 초과 량 (750 μl - 1000 μl)의 구슬을 resuspend. 다시 실온에서 2 분을위한 자기 랙에 튜브를 삽입합니다. </li><li> 한 번 더 씻어을 반복하고 7 단계에서 제거 원래 볼륨의 IP 버퍼에 씻은 구슬을 resuspend. </li><li> 각 IP 반응을 씻어 Dynabeads 30 μl 추가 </li><li> 4 2 시간에 회전 튜브 홀더에 품어 ° C. </li><li> 배양이 완료되면, 상온에서 2 분을위한 자기 랙에 튜브를 놓으십시오. </li><li> 뜨는을 피펫. 피펫 팁로 튜브의 내부 벽 (비즈는 자석을 유치 어디에) 감동하지 마십시오. IP 버퍼 500 μl를 추가합니다. 튜브의 내용을 믹스 2 분을위한 자기 선반에 놓으세요. 500 UL IP 버퍼 한 번에 함께 씻어 반복합니다. </li><li> 마지막 세척에서 뜨는을 제거한 후 소화 버퍼 400 μl의 구슬을 resuspend. </li><li> Proteinase K 100 μg과 반응을 치료하고 50 밤새 품어 ° C. </li></ol> IMMUNOPRECIPITATED DNA의 정제 <ol><li> 500 μl 1시 1분 페놀 / 클로로포름 산도 7 철저히 와동을 추가합니다. </li><li> 실온에서 10 분 13 000g에 스핀. </li><li> 새로운 튜브로 수성 (위) 분수를 제거합니다. </li><li> 수성 및 유기 층 사이의 계면이 흐린 나타나면 반복 1-3 단계를 반복합니다. </li><li> 10분의 1 일 볼륨 3 M의 아세트산 나트륨 (40 μl)와 와동을 추가합니다. </li><li> 1 글리코겐의 μl (20 μg / μl)와 와동을 추가합니다. </li><li> 100 % 에탄올, 소용돌이, 그리고 20 분에 대해 -20 ° C에서 장소 2 권 (1000 μl)를 추가합니다. </li><li> 4 20 분 13 000g에 스핀 ° C. </li><li> , 에탄올을 제거 펄스 스핀, 그리고 잔류 에탄올을 제거하십시오. </li><li> 세척 500 μl 차가운 70 % 에탄올을 추가합니다. 4 20 분 13 000g에 소용돌이 간략하게, 그리고 스핀 ° C. </li><li> , 70 % 에탄올을 제거 펄스 스핀, 그리고 pipetting하여 잔류 에탄올을 제거하십시오. </li><li> 공기가 잔류 에탄올의 모든 흔적을 제거하는 실온에서 10 분 오픈 뚜껑과 펠릿 건조. </li><li> 10 μl의 Resuspend DNA 펠렛은 DH 2 0을 살균. </li></ol> PCR에 의해 검증 <ol><li> 당신은 MeDIP 절차는 보통 인간의 DNA를 (남녀)를 사용하여 MeDIP 프로토콜을 수행하여 작업하고, 이후 methylation에 대한 풍부한 것으로 알려져 영역을 시금 있는지 확인하기 위해 검사 수도 있습니다. </li><li> PCR 튜브에 MeDIP 제품의 30 %, 다른 PCR 튜브에 MeDIP 제품의 또 다른 30 ​​%를 제거합니다. </li><li> PCR 튜브에 DNA에 10 NG, 다른 PCR 튜브에 DNA에 10 NG 놔. 이제 네 별도의 PCR 반응은 설정해야합니다. </li><li> PCR은 H19와 CTRL primers를 사용하여 수행은 표 1에서 지적했다. </li><li> 으로 표 2에 명시된 12.5 μl 총 볼륨 PCR 반응을위한 두 mastermixes (각 프라이머 세트)로 준비하세요. </li><li> Thermocycle PCR은 표 3에 제시된 조건을 사용합니다. </li><li> 시각화를위한 2 % 아가로 오스 겔에 PCR 제품의 5 μl를 실행합니다. </li><li> 성공 MeDIP에 대한 예상 결과는 표 4에 표시됩니다. </li></ol> 테이블 표 1 : H19 및 PCR 검증을 위해 CTRL primers. <table border="1"><tbody><tr><td> 프라이머 세트 </td><td> 앞으로 프리머 </td><td> 역방향 프리머 </td><td> 예상 제품 크기 </td></tr><tr><td> H19 </td><td> H19_F 5&#39; - cgagtgtgcgtgagtgtgag </td><td> H19_R 5&#39; - ggcgtaatggaatgcttgaa </td><td> 174 BP </td></tr><tr><td> CTRL (제어) </td><td> CTRL_F5&#39; - gagagcattagggcagacaaa </td><td> CTRL_R 5&#39; - gttcctcagacagccacattt </td><td> 139 BP </td></tr></tbody></table> 표 2. PCR 반응을위한 Mastermixes. <table border="1"><tbody><tr><td></td><td> H19 믹스 (사람마다 Rxn) </td><td> CTRL 믹스 (사람마다 Rxn) </td></tr><tr><tD&gt; ddH 2 O </td><td> 6.875 </td><td> 6.875 </td></tr><tr><td> 10X 버퍼 </td><td> 1.25 </td><td> 1.25 </td></tr><tr><td> dNTP 혼합 (10 MM 각) </td><td> 0.25 </td><td> 0.25 </td></tr><tr><td> MgCl 2 (50 ㎜) </td><td> 0.25 </td><td> 0.25 </td></tr><tr><td> Primers (H19_F / R 또는 CTRL_F / R) (10 μm의 각 F / R) </td><td> 0.625 </td><td> 0.625 </td></tr><tr><td> 플래티넘 DNA 형성 촉매 </td><td> 0.25 </td><td> 0.25 </td></tr></tbody></table> 표 3. PCR thermocyling 조건. <table border="1"><tbody><tr><td></td><td> 95 ° C </td><td> 5시 </td></tr><tr><td rowspan="3"> 40X </td><td> 95 ° C </td><td> 0시 반 </td></tr><tr><td> 56 ° C </td><td> 0시 반 </td></tr><tr><td> 72 ° C </td><td> 0시 15분 </td></tr></tbody></table> 표 4. 성공 MeDIP에 대한 PCR 결과를 예상. <table border="1"><tbody><tr><td></td><td colspan="2" align="center"> 템플릿 DNA </td></tr><tr><td> 프리머 사용되는 </td><td> IN </td><td> IP </td></tr><tr><td> H19 </td><td> 긍정적인 </td><td> 긍정적인 </td></tr><tr><td> CTRL </td><td> 긍정적인 </td><td> 부정 </td></tr></tbody></table>

<ol>
	<li>Beck, S., Rakyan, V. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+methylome:+approaches+for+global+DNA+methylation+profiling.">The methylome: approaches for global DNA methylation profiling.</a> Trends Genet. 24, 231-237 (2008).</li><li>Lu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetics,+disease,+and+therapeutic+interventions.">Epigenetics, disease, and therapeutic interventions.</a> Ageing research reviews. 5, 449-467 (2006).</li><li>Zilberman, D., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+DNA+methylation+patterns.">Genome-wide analysis of DNA methylation patterns.</a> Development. 134, 3959-3965 (2007).</li><li>Feinberg, A. P., Tycko, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+history+of+cancer+epigenetics.">The history of cancer epigenetics.</a> Nature reviews. 4, 143-153 (2004).</li><li>Weber, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution,+silencing+potential+and+evolutionary+impact+of+promoter+DNA+methylation+in+the+human+genome.">Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome.</a> Nat Genet. 39, 457-466 (2007).</li><li>Weber, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome-wide+and+promoter-specific+analyses+identify+sites+of+differential+DNA+methylation+in+normal+and+transformed+human+cells.">Chromosome-wide and promoter-specific analyses identify sites of differential DNA methylation in normal and transformed human cells.</a> Nat Genet. 37, 853-862 (2005).</li><li>Wilson, I. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenomics:+mapping+the+methylome.">Epigenomics: mapping the methylome.</a> Cell Cycle. 5, 155-158 (2006).</li><li>Gazin, C., Wajapeyee, N., Gobeil, S., Virbasius, C. M., Green, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+elaborate+pathway+required+for+Ras-mediated+epigenetic+silencing.">An elaborate pathway required for Ras-mediated epigenetic silencing.</a> Nature. 449, 1073-1077 (2007).</li><li>Karpinski, P., Sasiadek, M. M., Blin, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+epigenetic+patterns+in+the+etiology+of+gastrointestinal+cancers.">Aberrant epigenetic patterns in the etiology of gastrointestinal cancers.</a> Journal of applied. 49, 1-10 (2008).</li><li>Maekawa, M., Watanabe, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetics:+relations+to+disease+and+laboratory+findings.">Epigenetics: relations to disease and laboratory findings.</a> Current medicinal chemistry. 14, 2642-2653 (2007).</li><li>Vucic, E. A., Brown, C. J., Lam, W. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetics+of+cancer+progression.">Epigenetics of cancer progression.</a> Pharmacogenomics. 9, 215-234 (2008).</li><li>Egger, G., Liang, G., Aparicio, A., Jones, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetics+in+human+disease+and+prospects+for+epigenetic+therapy.">Epigenetics in human disease and prospects for epigenetic therapy.</a> Nature. 429, 457-463 (2004).</li><li>Jones, P. A., Baylin, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fundamental+role+of+epigenetic+events+in+cancer.">The fundamental role of epigenetic events in cancer.</a> Nat Rev Genet. 3, 415-428 (2002).</li><li>Fraga, M. F., Esteller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+methylation:+a+profile+of+methods+and+applications.">DNA methylation: a profile of methods and applications.</a> Biotechniques. 33, 632-649 (2002).</li></ol>

질병에있는 중요한 역할의 DNA methylation의 재생의 성장 의식이있다,이 수정을 측정 assays의 따라서 개발은 13 초, 12 초, 3 점차 중요 해지고 있습니다. MeDIP 기술은 전체 게놈과 로커스 - 특정 레벨 6, 7 모두에서 검사를받을 수있는 도구입니다. 이 기술은 DNA를 시작하는 제한된 양의를 사용하여 DNA의 methylation 수준의 빠른 볼을 제공하며 서로 다른 소스 사이에서 쉽게 비교를 위해 수 있...

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>Biorupter sonicator</td>
<td>Tool</td>
<td>Diagenode</td>
<td>UCD-200 TM</td>
<td>&nbsp;</td>
<tr>
<td>1.7ml SafeSeal Microcentrifuge Tubes</td>
<td>Other</td>
<td>Sorenson BioScience</td>
<td>11510</td>
<td>&nbsp;</td>
<tr>
<td>ND 3300 Spectrophotometer</td>
<td>Tool</td>
<td>NanoDrop</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<tr>
<td>Primary Antibody: Anti-5'-methylcytosine mouse mAb</td>
<td>Reagent</td>
<td>CalBiochem</td>
<td>162 33 D3</td>
<td>&nbsp;</td>
<tr>
<td>Secondary Antibody: Dynabeads M-280 Sheep anti-mouse IgG</td>
<td>Reagent</td>
<td>Invitrogen</td>
<td>112-01D</td>
<td>&nbsp;</td>
<tr>
<td>Magnetic Tube Rack</td>
<td>Tool</td>
<td>Invitrogen</td>
<td>CS15000</td>
<td>&nbsp;</td>
<tr>
<td>Mini LabRoller</td>
<td>Tool</td>
<td>Labnet International</td>
<td>H5500</td>
<td>&nbsp;</td>
<tr>
<td>IP Buffer</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>10 mM NaPO4 pH 7.0, 140 mM NaCl, 0.05% Triton X-100. Stored at room temperature</td>
</tr>
<tr>
<td>Digestion Buffer</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>10 mM Tris pH8.0, 100 mM EDTA, 0.5% SDS, 50 mM NaCl</td>
</tr>		</tbody>
		</table>
		</div>

methylated dna immunoprecipitation

DNA의 methylation 패턴의 식별은 methylation은 유전자 발현에 큰 영향을 미칠 것으로 알려져으로 epigenetics의 연구에서 일반적인 절차이며, 정상적인 발달뿐만 아니라 질병에 관여<sup&gt; 1-4</sup&gt;. 그러므로, methylated DNA가 아닌 methylated DNA 구별하는 능력은 연구 methylation 프로파일을 생성하기 위해 필수적입니다. Methylated DNA immunoprecipitation (MeDIP)는 관심의 샘플에서 methylated DNA의 추출을위한 효율적인 기술입니다<sup&gt; 5-7</sup&gt;. DNA의 짧은 200 NG의 예제는 항체 또는 immunoprecipitation (IP), 반응 충분합니다. DNA는 300-1000 BP의 크기에 이르기까지 조각으로 sonicated이며, immunoprecipitated (IP)과 입력 (IN) 부분으로 나뉘어져 있습니다. IP DNA는 이후 단클론 항체가 methylated DNA를 바인딩 수 있도록, 변성 그리고 안티 5&#39;mC와 incubated 열 수 있습니다. 이 후, 차 항체에 대한 친화력이있는 이차 항체를 포함하는 자성 비즈를 추가하고, incubated 있습니다. 이러한 비드 링크된 항체는 첫 번째 단계에서 사용하는 단클론 항체를 바인딩합니다. 항체 복합 (methylated DNA)에 바운드 DNA는 솔루션의 단지를 빼내 자석을 사용하여 DNA의 나머지 부분에서 분리됩니다. IP 버퍼를 사용하는 몇 가지 세척은 다음 언바운드 아닌 methylated DNA를 제거하기 위해 수행됩니다. methylated DNA / 항체 단지 그 다음은 methylated DNA가 그대로 둔 항체를 소화 Proteinase K와 소화하고 있습니다. 단백질 물질을 제거하는 클로로포름 추출 후 나중에 사용하기 위해 시켰던과 물에 resuspended : 농축 DNA는 페놀로 정화됩니다. PCR 기법은 IP의 증폭 제품을 분석하여하고 부족으로 알려진 methylated 시퀀스를 포함하는 것으로 알려진 지역에 대한 DNA에 MeDIP 절차의 효율성을 확인하는 데 사용할 수 있습니다. 정화 methylated DNA는 다음 로커스 특정 (PCR) 또는 게놈 전체 (microarray 및 시퀀싱) methylation 연구에 사용하고, 같은 유전자 발현 프로 파일링 및 배열 비교 게놈 하이브 리다이 제이션 등 다른 연구 도구와 함께 적용하면 (특히 유용합니다 수 있습니다 CGH)<sup&gt; 8</sup&gt;. DNA의 methylation에 추가 수사를 차례로, aberrantly methylated DNA의 특징과 같은 암 같은 질병에 대한 새로운 치료 또는 전조의 연구 도구를 개발에 유용할 수 있습니다 새로운 epigenetic 목표의 발견으로 이어질 것입니다<sup&gt; 2, 4, 9-11</sup&gt;.

Watch this Scientific Journal Video about Methylated DNA Immunoprecipitation at JoVE.com

Methylated DNA Immunoprecipitation

이 동영상은 methylated DNA의 immunoprecipitation (MeDIP)에 대한 프로토콜을 보여줍니다. MeDIP가 선택 (안티 - 5 MC) 5 methylcytosine에 대한 특이성과 항체를 사용하여 게놈 DNA 샘플에서 methylated DNA 조각을 추출 두 하루 절차입니다.

Methylated DNA의 Immunoprecipitation

The identification of DNA methylation patterns is a common procedure in the study of epigenetics, as methylation is known to have significant effects on ...

Research

JoVE Journal

Biology

23.2K 조회수.  BC Cancer Research Centre. 이 동영상은 methylated DNA의 immunoprecipitation (MeDIP)에 대한 프로토콜을 보여줍니다. MeDIP가 선택 (안티 - 5 MC) 5 methylcytosine에 대한 특이성과 항체를 사용하여 게놈 DNA 샘플에서 methylated DNA 조각을 추출 두 하루 절차입니다.

비디오: Methylated DNA Immunoprecipitation

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

인간 배아 줄기 세포에서 염색질의 Immunoprecipitation

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

연구

생물학

Antibody Profiling by Luciferase Immunoprecipitation Systems (LIPS)

Technologies for comprehensively understanding and quantifying antibody profiles to autoantigens and infectious agents may yield new insights into disease mechanisms and may elucidate new markers to substratify disease with different clinical features and better understand pathogenesis. We have developed a highly quantitative method called Luciferase Immunoprecipitation Systems (LIPS) for profiling patient sera antibody responses to autoantigens and pathogen antigens associated with infection. Unlike ELISAs, the highly sensitive LIPS is easily implemented to survey humoral serological response profiles to different antigens in a universal format and produces dynamic antibody titer ranges up to 6 log10 for some antigens. In these studies, quantitative profiling by LIPS of patient humoral responses against panels of antigens or even the entire proteome of some pathogens (i.e. HIV), is typically more informative than testing a single antigen by ELISA. In addition, LIPS also eliminates time and effort needed to produce highly purified antigens as well as the labor-intensive assay optimization steps needed for standard ELISAs. Here we provide a detailed protocol describing the technical aspects of performing LIPS assays for readily profiling antibody responses to single or multiple antigens.

Antibody Profiling by Luciferase Immunoprecipitation Systems LIPS

The technical aspects of performing LIPS (Luciferase Immunoprecipitation Systems) are described. The overall approach involves expressing chimeric genes encoding antigens fused to Renilla luciferase (Ruc) in mammalian cells. Crude Ruc-antigen extracts are then prepared and, without purification, employed in immunoprecipitation assays to quantify antibodies.

루시페라제 Immunoprecipitation 시스템 (입술)에 의해 항체 프로파일

Technologies for comprehensively understanding and quantifying antibody profiles to autoantigens and infectious agents may yield new insights into disease ...

DNA Stable-Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

DNA Stable-Isotope Probing DNA-SIP

DNA stable-isotope probing is a cultivation-independent method to identify and characterize active communities of microorganisms that are capable of utilizing specific substrates. Assimilation of substrate enriched in heavy isotope leads to incorporation of labelled atoms into microbial biomass. Density gradient ultracentrifugation retrieves labelled DNA for downstream molecular analyses.

DNA 안정 - 동위 원소 (DNA - SIP) 탐색

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and ...

IP-FCM:  Immunoprecipitation Detected by Flow Cytometry

Immunoprecipitation detected by flow cytometry (IP-FCM) is an efficient method for detecting and quantifying protein-protein interactions. The basic principle extends that of sandwich ELISA, wherein the captured primary analyte can be detected together with other molecules physically associated within multiprotein complexes. The procedure involves covalent coupling of polystyrene latex microbeads with immunoprecipitating monoclonal antibodies (mAb) specific for a protein of interest, incubating these beads with cell lysates, probing captured protein complexes with fluorochrome-conjugated probes, and analyzing bead-associated fluorescence by flow cytometry. IP-FCM is extremely sensitive, allows analysis of proteins in their native (non-denatured) state, and is amenable to either semi-quantitative or quantitative analysis. As additional advantages, IP-FCM requires no genetic engineering or specialized equipment, other than a flow cytometer, and it can be readily adapted for high-throughput applications.

The IP-FCM method is presented, which allows a sensitive, robust, biochemical assessment of native protein-protein interactions, without requiring genetic engineering or large sample sizes.

IP - FCM : 유동세포계측법에 의해 감지 Immunoprecipitation

Immunoprecipitation detected by flow cytometry (IP-FCM) is an efficient method for detecting and quantifying protein-protein interactions. The basic ...

Chromatin Immunoprecipitation Assay for Tissue-specific Genes using Early-stage Mouse Embryos

Chromatin immunoprecipitation (ChIP) is a powerful tool to identify protein:chromatin interactions that occur in the context of living cells 1-3. This technique has been widely exploited in tissue culture cells, and to a lesser extent, in primary tissue. The application of ChIP to rodent embryonic tissue, especially at early times of development, is complicated by the limited amount of tissue and the heterogeneity of cell and tissue types in the embryo. Here we present a method to perform ChIP using a dissociated embryonic day 8.5 (E8.5) embryo. Sheared chromatin from a single E8.5 embryo can be divided into up to five aliquots, which allows the investigator sufficient material for controls and for investigation of specific protein:chromatin interactions.
We have utilized this technique to begin to document protein:chromatin interactions during the specification of tissue-specific gene expression programs. The heterogeneity of cell types in an embryo necessarily restricts the application of this technique because the result is the detection of protein:chromatin interactions without distinguishing whether the interactions occur in all, a subset of, or a single cell type(s). However, examination of tissue-specific genes during or following the onset of tissue-specific gene expression is feasible for two reasons. First, immunoprecipitation of tissue specific factors necessarily isolates chromatin from the cell type where the factor is expressed. Second, immunoprecipitation of coactivators and histones containing post-translational modifications that are associated with gene activation should only be found at genes and gene regulatory sequences in the cell type where the gene is being or has been activated. The technique should be applicable to the study of most tissue-specific gene activation events.
In the example described below, we utilized E8.5 and E9.5 mouse embryos to examine factor binding at a skeletal muscle specific gene promoter. Somites, which are the precursor tissues from which the skeletal muscles of the trunk and limbs will form, are present at E8.5-9.54,5. Myogenin is a regulatory factor required for skeletal muscle differentiation 6-9. The data demonstrate that myogenin is associated with its own promoter in E8.5 and E9.5 embryos. Because myogenin is only expressed in somites at this stage of development 6,10, the data indicate that myogenin interactions with its own promoter have already occurred in skeletal muscle precursor cells in E8.5 embryos.

We demonstrate a chromatin immunoprecipitation (ChIP) method to identify factor interactions at tissue-specific genes during or after the onset of tissue-specific gene expression in mouse embryonic tissue. This protocol should be widely applicable for the study of tissue-specific gene activation as it occurs during normal embryonic development.

초기 마우스 배아를 사용하는 조직 특정 유전자에 대한 염색질의 Immunoprecipitation 분석

Chromatin immunoprecipitation (ChIP) is a powerful tool to identify protein:chromatin interactions that occur in the context of living cells 1-3. This ...

Chromatin Immunoprecipitation (ChIP) using Drosophila tissue

Epigenetics remains a rapidly developing field that studies how the chromatin state contributes to differential gene expression in distinct cell types at different developmental stages. Epigenetic regulation contributes to a broad spectrum of biological processes, including cellular differentiation during embryonic development and homeostasis in adulthood. A critical strategy in epigenetic studies is to examine how various histone modifications and chromatin factors regulate gene expression. To address this, Chromatin Immunoprecipitation (ChIP) is used widely to obtain a snapshot of the association of particular factors with DNA in the cells of interest.
ChIP technique commonly uses cultured cells as starting material, which can be obtained in abundance and homogeneity to generate reproducible data. However, there are several caveats: First, the environment to grow cells in Petri dish is different from that in vivo, thus may not reflect the endogenous chromatin state of cells in a living organism. Second, not all types of cells can be cultured ex vivo. There are only a limited number of cell lines, from which people can obtain enough material for ChIP assay.
Here we describe a method to do ChIP experiment using Drosophila tissues. The starting material is dissected tissue from a living animal, thus can accurately reflect the endogenous chromatin state. The adaptability of this method with many different types of tissue will allow researchers to address a lot more biologically relevant questions regarding epigenetic regulation in vivo1, 2. Combining this method with high-throughput sequencing (ChIP-seq) will further allow researchers to obtain an epigenomic landscape.

Chromatin Immunoprecipitation ChIP using Drosophila tissue

Recently high-throughput sequencing technology has greatly increased sensitivity of Chromatin Immunoprecipitation (ChIP) experiment and prompted its application using purified cells or dissected tissue. Here we delineate a method to use ChIP technique with Drosophila tissue, which can address the endogenous chromatin state in a well-characterized biological system.

사용 염색질 Immunoprecipitation (CHIP) Drosophila 조직

Epigenetics remains a rapidly developing field that studies how the chromatin state contributes to differential gene expression in distinct cell types at ...

Efficient Chromatin Immunoprecipitation using Limiting Amounts of Biomass

Chromatin immunoprecipitation (ChIP) is a widely-used method for determining the interactions of different proteins with DNA in chromatin of living cells. Examples include sequence-specific DNA binding transcription factors, histones and their different modification states, enzymes such as RNA polymerases and ancillary factors, and DNA repair components. Despite its ubiquity, there is a lack of up-to-date, detailed methodologies for both bench preparation of material and for accurate analysis allowing quantitative metrics of interaction. Due to this lack of information, and also because, like any immunoprecipitation, conditions must be re-optimized for new sets of experimental conditions, the ChIP assay is susceptible to inaccurate or poorly quantitative results.
Our protocol is ultimately derived from seminal work on transcription factor:DNA interactions1,2 , but incorporates a number of improvements to sensitivity and reproducibility for difficult-to-obtain cell types. The protocol has been used successfully3,4 , both using qPCR to quantify DNA enrichment, or using a semi-quantitative variant of the below protocol.
This quantitative analysis of PCR-amplified material is performed computationally, and represents a limiting factor in the assay. Important controls and other considerations include the use of an isotype-matched antibody, as well as evaluation of a control region of genomic DNA, such as an intergenic region predicted not to be bound by the protein under study (or anticipated not to show changes under the experimental conditions). In addition, a standard curve of input material for every ChIP sample is used to derive absolute levels of enrichment in the experimental material. Use of standard curves helps to take into account differences between primer sets, regardless of how carefully they are designed, and also efficiency differences throughout the range of template concentrations for a single primer set. Our protocol is different from others that are available5-8 in that we extensively cover the later, analysis phase.

We describe a robust method for chromatin immunoprecipitation using primary T cells. The method is founded on standard approaches, but uses a specific set of conditions and reagents that improve efficiency for limited a quantities of cells. Importantly, a detailed description of the data analysis phase is presented.

바이오 매스의 제한 금액을 사용하여 효율적으로 염색질 immunoprecipitation의

Chromatin immunoprecipitation (ChIP) is a  widely-used method for determining the interactions of different proteins with  DNA in chromatin of living ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

높은 처리량 시퀀싱을위한 고품질 염색질 면역 침전의 DNA 템플릿의 생성 (칩 SEQ)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Real-time Imaging of Single Engineered RNA Transcripts in Living Cells Using Ratiometric Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the development of diverse techniques to visualize individual RNA transcripts in single living cells. One promising technique that has recently been described utilizes an oligonucleotide-based optical probe, ratiometric bimolecular beacon (RBMB), to detect RNA transcripts that were engineered to contain at least four tandem repeats of the RBMB target sequence in the 3&#8217;-untranslated region. RBMBs are specifically designed to emit a bright fluorescent signal upon hybridization to complementary RNA, but otherwise remain quenched. The use of a synthetic probe in this approach allows photostable, red-shifted, and highly emissive organic dyes to be used for imaging. Binding of multiple RBMBs to the engineered RNA transcripts results in discrete fluorescence spots when viewed under a wide-field fluorescent microscope. Consequently, the movement of individual RNA transcripts can be readily visualized in real-time by taking a time series of fluorescent images. Here we describe the preparation and purification of RBMBs, delivery into cells by microporation and live-cell imaging of single RNA transcripts.

Ratiometric bimolecular beacons (RBMBs) can be used to image single engineered RNA transcripts in living cells. Here, we describe the preparation and purification of RBMBs, delivery of RBMBs into cells by microporation and fluorescent imaging of single RNA transcripts in real-time.

비례 생체 분자 비콘을 사용하여 살아있는 세포의 단일 엔지니어링 RNA 성적 증명서의 실시간 영상

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the ...

Reduced-gravity Environment Hardware Demonstrations of a Prototype Miniaturized Flow Cytometer and Companion Microfluidic Mixing Technology

Until recently, astronaut blood samples were collected in-flight, transported to earth on the Space Shuttle, and analyzed in terrestrial laboratories. If humans are to travel beyond low Earth orbit, a transition towards space-ready, point-of-care (POC) testing is required. Such testing needs to be comprehensive, easy to perform in a reduced-gravity environment, and unaffected by the stresses of launch and spaceflight. Countless POC devices have been developed to mimic laboratory scale counterparts, but most have narrow applications and few have demonstrable use in an in-flight, reduced-gravity environment. In fact, demonstrations of biomedical diagnostics in reduced gravity are limited altogether, making component choice and certain logistical challenges difficult to approach when seeking to test new technology. To help fill the void, we are presenting a modular method for the construction and operation of a prototype blood diagnostic device and its associated parabolic flight test rig that meet the standards for flight-testing onboard a parabolic flight, reduced-gravity aircraft. The method first focuses on rig assembly for in-flight, reduced-gravity testing of a flow cytometer and a companion microfluidic mixing chip. Components are adaptable to other designs and some custom components, such as a microvolume sample loader and the micromixer may be of particular interest. The method then shifts focus to flight preparation, by offering guidelines and suggestions to prepare for a successful flight test with regard to user training, development of a standard operating procedure (SOP), and other issues. Finally, in-flight experimental procedures specific to our demonstrations are described.

Spaceflight blood diagnostics need innovation. Few demonstrations have been published illustrating in-flight, reduced-gravity health diagnostic technology. Here we present a method for construction and operation of a parabolic flight test rig for a prototype point-of-care flow-cytometry design, with components and preparation strategies adaptable to other setups.

프로토 타입 소형 흐름 사이토와 동반자 미세 유체 혼합 기술의 감소 - 중력 환경 하드웨어 데모

Until recently, astronaut blood samples were collected in-flight, transported to earth on the Space Shuttle, and analyzed in terrestrial laboratories. If ...