This work was supported by the National Human Genome Research Institute of the National Institutes of Health under Award Number R01HG006785.

1. Sequence Design and Synthesis
<ol>
	<li>Begin MPRA with the design and synthesis of sequences to be assayed for regulatory activity. For compatibility with the pMPRA vector series, design each sequence using the following template: 5’-ACTGGCCGCTTCACTG-var-GGTACCTCTAGA-tag-AGATCGGAAGAGCGTCG-3’ where var denotes the sequence to be assayed and tag denotes one or more identifying tags.</li>
	<li>The two variable regions (var and tag) are separated by a pair of KpnI (GGTACC) and XbaI (TCTAGA) restriction sites to facilitate directional ligation of a reporter gene fragment between them. In addition, two distinct SfiI (GGCCNNNNNGGCC) sites will be added by PCR to allow directional ligation into the pMPRA backbone. The variable regions must not contain additional copies of any of these restriction sites. If necessary, one or more of these restriction enzymes can be replaced, as long as the replacements 1) allow efficient cutting close to the ends of DNA molecules, and 2) do not cut elsewhere in the vector sequence. See Discussion for additional details.</li>
	<li>Obtain the required primers listed in Table 1 from a commercial vendor.</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="381">
	<tbody>
		<tr>
			<td>MPRA_SfiI_F</td>
			<td>GCTAAGGGCCTAACTGGCCGCTTCACTG</td>
		</tr>
		<tr>
			<td>MPRA_SfiI_R</td>
			<td>GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td>
		</tr>
		<tr>
			<td>TAGseq_P1</td>
			<td>AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>TAGseq_P2</td>
			<td>CAAGCAGAAGACGGCATACGAGAT[index]GTGAC TGGAGTTCAGACGTGTGCTCTTCCGATCTCGAG GTGCCTAAAGG</td>
		</tr>
	</tbody>
</table>
Table 1. Primer sequences. [index] denotes a 6 to 8 nt index sequence used for multiplexed sequencing. Obtain at least 8 TagSeq-P2 primers with different indices. All of the primers should be purified by HPLC or PAGE.
<ol start="4">
	<li>Oligonucleotide libraries can be obtained from a commercial vendor or core facility, or generated by using a programmable microarray-based oligonucleotide synthesizer as described by the manufacturer. Resuspend the OLS products in 100 µl TE 0.1 buffer.</li>
	<li>Run the oligonucleotide libraries on a 10% TBE-Urea denaturing polyacrylamide gel. Load approximately 1 pmol per lane and stain with ssDNA-sensitive fluorescent stain to assess their quality (Figure 2A).</li>
	<li>If a discrete band corresponding to the full-length oligonucleotides can be visualized (Figure 2A, lanes 1 and 2), excise the corresponding acrylamide gel slice and elute oligonucleotides into 100 µl TE 0.1 overnight at room temperature with shaking. Otherwise, proceed using the raw OLS suspension.</li>
	<li>Amplify and add SfiI tails to the oligonucleotide library using emulsion PCR 9.</li>
	<li>Set up 50 µl PCR reaction mixtures as described in Table 2. Then combine with 300 µl oil and surfactant mixture from the Micellula DNA Emulsion and Purification kit and vortex for 5 min at 4 °C.</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="368">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>1x Volume (µl)</td>
		</tr>
		<tr>
			<td>Herculase II Fusion DNA Polymerase </td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>5x Herculase II Reaction Buffer</td>
			<td>10</td>
		</tr>
		<tr>
			<td>dNTP (10 mM each)</td>
			<td>1.25</td>
		</tr>
		<tr>
			<td>BSA (20 mg/ml)</td>
			<td>1.25</td>
		</tr>
		<tr>
			<td>Primer MPRA_SfiI_F (25 µM)</td>
			<td>0.25</td>
		</tr>
		<tr>
			<td>Primer MPRA_SfiI_R (25 µM)</td>
			<td>0.25</td>
		</tr>
		<tr>
			<td>OLS template (1-10 attomol)</td>
			<td>varies</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>to 50 </td>
		</tr>
	</tbody>
</table>
Table 2. Emulsion PCR reaction mix (water phase).
<ol start="9">
	<li>Use the concentration that gives the maximal yield of amplification products without the appearance of artifacts (see section 1.12).</li>
	<li>Dispense the resulting emulsion into PCR tubes and perform 20 cycles of PCR (2 min at 95 °C, 20 x[20 sec at 95 °C, 20 sec at 55 °C, 30 sec at 72 °C], 3 min at 95 °C).</li>
	<li>Pool and break each 350 µl emulsion PCR reaction by adding 1 ml isobutanol and briefly vortexing, and then purify the amplification product using a DNA purification column.</li>
	<li>Run an aliquot on a 2% or 4% agarose gel to verify artifact-free amplification (Figure 2B).</li>
</ol>
<img alt="Electrophoresis gel showing OLS and PCR products; DNA separation and molecular weight analysis." src="/files/ftp_upload/51719/51719fig2highres.jpg" data-altupdatedat="1747911167000" data-alt="Figure 2"> 
Figure 2. Preparation of oligonucleotide synthesis libraries. A) Three different raw oligonucleotide synthesis libraries (OLS) run on denaturing 10% TBE-Urea polyacrylamide gels. Bands corresponding to full length oligonucleotides (*) can be visualized and excised from libraries 1 and 2. Library 3 contains contaminants that interfere with PAGE purification. If this is the case, proceed directly to PCR amplification. B) Products of open and emulsion PCR amplification of the same oligonucleotide library run on an agarose gel. PCR amplification of complex oligonucleotide libraries frequently creates chimeric products and other artifacts that may appear as higher and lower bands. Emulsion PCR can minimize these artifacts.
2. Library Construction
<ol>
	<li>Prepare a linearized plasmid backbone by digesting vector pMPRA1 with SfiI at 50 °C for 2 hr, run on a 1% agarose gel, excise the backbone band (in this case, 2.5 kb) and purify it using a gel-purification spin column.</li>
	<li>Digest the emulsion PCR products from step 1.4 with SfiI at 50 °C for 2 hr and purify using DNA purification columns.</li>
	<li>To ligate the promoter-tag library into the linearized vector backbone, set up reactions containing 100 ng of the digested PCR product, 50 ng of linearized vector backbone and T4 DNA ligase. Incubate overnight at 16 °C and then heat at 65 °C for 20 min to inactivate the ligase.</li>
	<li>Transform E. coli with the ligation reaction. To preserve library complexity, aim to obtain at least 10x more cfu than there are distinct promoter-tag combinations in the designed library.</li>
	<li>When the total number of tags is approximately 100,000, the target cfu can typically be achieved by performing 6-8 parallel transformations per library.</li>
	<li>For each transformation, combine 50 µl electrocompetent E. coli cells with 2 µl of ligation mix on ice. Transform by electroporation, recover the cells in 800 µl SOC medium by shaking at 37 °C for 1 hr, and then combine cells from the parallel transformations.</li>
	<li>To evaluate the transformation efficiency, plate serial dilutions from an alinquot of recovered cells on LB agar plates with 50-100 µg/ml carbenicillin and incubate overnight at 37 °C. Estimate total cfu as (observed cfu) × (dilution factor) × (V - v) / v, where V is the total volume of recovered cells and v is the volume of the aliquot taken for the serial dilutions.</li>
	<li>At the same time, use the remainder of the recovered cells to inoculate 200 ml LB supplemented with 100 µg/ml carbenicillin. Grow cells at 37 °C overnight in a shaker incubator and then isolate the plasmid DNA following standard procedures.</li>
	<li>Digest an aliquot of the isolated plasmid library with SfiI at 50 °C for 2 hr and run on a 1% agarose gel to confirm the presence of inserts.</li>
	<li>Linearize the plasmid library by cutting between the promoter variants and tags using KpnI and XbaI. To maximize the digestion efficiency, perform serial digestions:</li>
	<li>First, digest with KpnI at 37 °C for 1 hr and purify using magnetic beads. Second, digest with XbaI with addition of 1 U Shrimp Alkaline Phosphatase at 37 °C for 2 hr, heat inactivate at 65 °C for 5 min, and then purify using magnetic beads.</li>
	<li>Run an aliquot on a 1% agarose gel to verify complete linearization. If uncut plasmid is visible, the linearized fragment should be gel purified.</li>
	<li>To generate an MPRA library suitable for transfection into mammalian cells, ligate an ORF with KpnI/XbaI-compatible ends into the linearized intermediate library.</li>
	<li>To prepare a compatible luc2 ORF fragment from pMPRAdonor1, digest this plasmid with KpnI and XbaI at 37 °C for 1 hr and run on a 1% agarose gel. Excise the ORF fragment (1.7 kb in this case) and purify using a gel purification spin column.</li>
	<li>Clone the ORF fragment into the linearized intermediate library as described in steps 2.3-2.8.</li>
	<li>Digest an aliquot (corresponding to 1-2 µg) of the MPRA library with KpnI at 37 °C for 1 hr and run on a 1% agarose gel. If the digested library runs as a single band, proceed to section 3. If additional bands are observed (typically corresponding to carryover of intermediate constructs), the library can be further purified as follows:</li>
	<li>Digest 3-5 µg of the contaminated library with KpnI at 37 °C for 1 hr and run on a 0.8% agarose gel overnight at 4 °C.</li>
	<li>Excise the correct library band, purify the DNA using a gel purification spin column and perform self-ligation using high-concentration T4 DNA ligase at 37 °C for 1 hr. Then repeat the transformation and final library DNA isolation as described in step 2.8.</li>
</ol>
3. Transfection, Perturbation, and RNA Isolation
<ol>
	<li>For each independent transfection, culture the required number of cells (as determined by the MPRA library complexity, see Discussion) in appropriate medium. For example, culture HEK293T/17 cells in DMEM supplemented with 10% FBS and L-glutamine/penicillin/streptomycin. Culture cells for at least two independent transfections for each library and experimental condition.</li>
	<li>Transfect the cultured cells with MPRA plasmids. The transfection method and conditions must be optimized for each cell type. For each transfected sample, retain an aliquot (50-100 ng) of the plasmid DNA as a matched control.</li>
	<li>For example, transfect 0.5 x 107 HEK293T/17 cells grown to ~50% confluence in a 10 cm culture dish with 10 µg plasmid DNA in 1 ml Opti-MEM I Reduced Serum Medium using 30 µl Lipofectamine LTX and 10 µl Plus Reagent. Remove the transfection mixture after 5 hours and allow the cells to recover for 24-48 hr.</li>
	<li>Optionally, perform any perturbation required to activate context- or signal-dependent regulatory sequences in the designed library.</li>
	<li>Harvest the cells and isolate poly(A)+ mRNA using standard oligo(dT) cellulose columns or beads using their manufacturer’s instructions.</li>
	<li>Ensure that the maximum binding capacity of the columns or beads exceed the total amount of mRNA expected from the harvested cells. For example, the expected yield from section 3.3 is approximately 0.5-2.5 µg mRNA.</li>
</ol>
4. Tag-Seq
<ol>
	<li>To eliminate carryover of vector DNA from the transfected cell lysates, treat each 20 µl mRNA sample with 1 µl Turbo DNase (2 U) and 2.3 µl 10x Turbo DNase buffer at 37 °C for 1 hr, add 2.4 µl Turbo DNase Inactivation Reagent at RT for 5 min with mixing, centrifuge at 10,000 g for 90 sec, and then transfer the solution to a fresh tube.</li>
	<li>Verify purity by performing PCR as described in section 4.6 on 60-100 ng of each mRNA sample, and then running the products on an agarose gel. If specific amplicons are visible (0.25 kb if using pMPRA1 with luc2), column purify the treated mRNA and then repeat the DNase treatment.</li>
	<li>To generate Tag-Seq sequencing libraries, convert reporter mRNA to cDNA and add sequencing adapters by PCR.</li>
	<li>Set up mRNA/RT primer mixtures as described in Table 3. Incubate at 65 °C for 5 min, then place on ice. In parallel, set up cDNA synthesis reactions as described in Table 4.</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="428">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>1x Volume (µl)</td>
		</tr>
		<tr>
			<td>mRNA sample (400-700 ng total)</td>
			<td>8</td>
		</tr>
		<tr>
			<td>Oligo-0dT (50 µM)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>dNTP (10 mM each)</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 3. RNA/Reverse transcription primer mix for cDNA synthesis.
<table border="0" cellpadding="0" cellspacing="0" width="428">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>1x Volume (µl)</td>
		</tr>
		<tr>
			<td>10x SuperScript III RT Buffer</td>
			<td>2</td>
		</tr>
		<tr>
			<td>MgCl2 (25 mM)</td>
			<td>4</td>
		</tr>
		<tr>
			<td>DTT (0.1 M)</td>
			<td>2</td>
		</tr>
		<tr>
			<td>RNaseOut (40 U/µl)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>SuperScript III (200 U/µl)</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 4. cDNA synthesis reaction mix.
<ol start="5">
	<li>Gently combine mRNA/RT primer mixes with cDNA synthesis mixes. Incubate at 50 °C for 50 min, 85 °C for 5 min and then place on ice. Finally, incubate with 2 U of Ribonuclease H at 37 °C for 20 min.</li>
	<li>Set up PCR reactions as described in Table 5 with 4-6 µl cDNA reaction mixture or 50 ng reporter plasmid as templates. Then perform PCR amplification (95 °C for 2 min, 26 x [95 °C for 30 sec, 55 °C for 30 sec, 72 °C for 30 sec], 72 °C for 3 min).</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="428">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>1x Volume (µl)</td>
		</tr>
		<tr>
			<td>2x PfuUltra II HotStart PCR Master Mix</td>
			<td>25</td>
		</tr>
		<tr>
			<td>Primer TagSeq_P1 (25 µM)</td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>Primer TagSeq_P2 (25 µM)</td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>Template (mRNA, cDNA mix or plasmid DNA)</td>
			<td>varies</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>to 50 </td>
		</tr>
	</tbody>
</table>
Table 5. Tag-Seq PCR reaction mix. 
<ol start="7">
	<li>Run the PCR products through a 2% agarose gel, excise bands corresponding to the Tag-Seq library amplicons (0.25 kb if using pMPRA1 with luc2) and purify these using gel purification spin columns.</li>
	<li>Pool, denature and sequence the purified Tag-Seq amplicons directly with an Illumina sequencing instrument.</li>
	<li>Filter low-quality reads by removing all that a) contain one or more position with a Phred quality score less than 30 within the sequenced tag or b) does not exactly match a designed tag. Count the number of times each remaining tag appears in each library. Normalize the tag counts to TPM (tags per million sequenced tags) and then compute the ratio of mRNA-derived tag counts over plasmid-derived tag counts for each pair of sequencing libraries. If multiple different tags were linked to each sequence variant, use their median ratios for downstream analysis.</li>
</ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

The authors declare that they have no competing financial interests.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Massively Parallel Reporter Assays (MPRA) allow multiplexed measurement of the transcriptional regulatory activities of thousands to hundreds of thousands of DNA sequences1-7. In their most common implementation, multiplexing is achieved by coupling each sequence of interest to a synthetic reporter gene that contains an identifying sequence tag downstream of an open reading frame (ORF; Figure 1). Following transfection, RNA isolation and deep sequencing of the 3’ ends of the reporter gene transcripts, the relative activities of the coupled sequences can be inferred from the relative abundance of their identifying tags.
<img alt="Plasmid transfection diagram; co-transfection, tag counting; plasmid and mRNA, genetic study." src="/files/ftp_upload/51719/51719fig1highres.jpg" data-altupdatedat="1747911167000" data-alt="Figure 1"> 
Figure 1. Overview of MPRA. A library of MPRA reporter constructs is constructed by coupling putative regulatory sequences to synthetic reporter genes that consist of an “inert” ORF (such as GFP or luciferase) followed by an identifying sequence tag. The library is transfected en masse into a population of cultured cells and transcribed reporter mRNA is subsequently recovered. Deep sequencing is used to count the number of occurrences of each tag among the reporter mRNAs and the transfected plasmids. The ratio of mRNA counts over plasmid counts can be used to infer the activity of the corresponding regulatory sequence. Adapted with permission from Melnikov, et al2.
MPRA can be adapted to a wide variety of experimental designs, including 1) comprehensive mutagenesis of individual gene regulatory elements, 2) scanning for novel regulatory elements across a locus of interest, 3) testing the effect of natural genetic variation in a set of putative promoters, enhancers or silencers, and 4) semi-rational engineering of synthetic regulatory elements. Libraries of sequence variants can be generated using a variety of methods, including oligonucleotide library synthesis (OLS) on programmable microarrays2,3,6,7, assembly of degenerate oligonucleotides1,4, combinatorial ligation8 and fragmentation of genomic DNA5.
This protocol describes construction of a library of promoter variants using OLS and the pMPRA1 and pMPRAdonor1 vectors (Addgene IDs 49349 and 49352, respectively; http://www.addgene.org), transient transfection of this library into cultured mammalian cells and subsequent quantitation of the promoter activities by deep sequencing of their associated tags (Tag-Seq). Earlier versions of this protocol were used in the research reported in Melnikov et al. Nature Biotechnology 30, 271-277 (2012) and in Kheradpour et al. Genome Research 23, 800-811 (2013).

<table><tbody><tr><td>Oligonucleotide library synthesis</td><td>Agilent, CustomArray, or other OLS vendors</td><td>custom</td><td>If using OLS construction method</td></tr><tr><td>pMPRA1</td><td>Addgene</td><td>49349</td><td>MPRA plasmid backbone</td></tr><tr><td>pMPRAdonor1</td><td>Addgene</td><td>49352</td><td>luc2 ORF donor plasmid</td></tr><tr><td>TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td><td>Generic</td><td>n/a</td><td>OLS buffer</td></tr><tr><td>Novex TBE-Urea Gels, 10%</td><td>Life Technologies</td><td>EC6875BOX</td><td>PAGE purification of OLS products</td></tr><tr><td>Novex TBA-Urea Sample Buffer</td><td>Life Technologies</td><td>LC6876</td><td>PAGE purification of OLS products</td></tr><tr><td>SYBR Gold Nucleic Acid Gel Stain</td><td>Life Technologies</td><td>S-11494</td><td>PAGE purification of OLS products</td></tr><tr><td>Micellula DNA Emulsion &amp;amp; Purification Kit</td><td>EURx/CHIMERx</td><td>3600-01</td><td>Library amplification by emulsion PCR</td></tr><tr><td>Herculase II Fusion DNA Polymerase</td><td>Agilent</td><td>600675</td><td>Polymerase for emulsion PCR</td></tr><tr><td>SfiI</td><td>New England Biolabs</td><td>R0123S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>KpnI-HF</td><td>New England Biolabs</td><td>R3142S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>XbaI</td><td>New England Biolabs</td><td>R0145S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>T4 DNA Ligase (2,000,000 units/ml)</td><td>New England Biolabs</td><td>M0202T</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>One Shot TOP10 Electrocomp &lt;em&gt;E. coli&lt;/em&gt;</td><td>Life Technologies</td><td>C4040-50</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>LB agar and liquid media with carbenicllin</td><td>Generic</td><td>n/a</td><td>Growth media for cloning</td></tr><tr><td>E-Gel EX Gels 1%</td><td>Life Technologies</td><td>G4010-01</td><td>Library verification and purification</td></tr><tr><td>E-Gel EX Gels, 2%</td><td>Life Technologies</td><td>G4010-02</td><td>Library verification and purification</td></tr><tr><td>MinElute Gel Extraction Kit</td><td>Qiagen</td><td>28604</td><td>Library and backbone purification</td></tr><tr><td>EndoFree Plasmid Maxi Kit</td><td>Qiagen</td><td>12362</td><td>Library DNA isolation</td></tr><tr><td>Cell culture media</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>Transfection reagents</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>MicroPoly(A)Purist Kit</td><td>Life Technologies</td><td>AM1919</td><td>mRNA isolation</td></tr><tr><td>TURBO DNA-free Kit</td><td>Life Technologies</td><td>AM1907</td><td>Plasmid DNA removal</td></tr><tr><td>SuperScript III First-Strand Synthesis System</td><td>Life Technologies</td><td>18080-051</td><td>cDNA synthesis</td></tr><tr><td>PfuUltra II Hotstart PCR Master Mix</td><td>Agilent</td><td>600850</td><td>Polymerase for Tag-Seq PCR</td></tr><tr><td>Primers (see text)</td><td>IDT</td><td>custom</td><td>PAGE purify Tag-Seq primers</td></tr></tbody></table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA facilitates high-resolution, quantitative dissection of the sequence-activity relationships of transcriptional regulatory elements. A successful MPRA experiment will typically yield highly reproducible measurements for the majority of sequences in the transfected library (Figure 3A). If poor reproducibility is observed (Figure 3B), this is indicative of a too low concentration of reporter mRNAs in the recovered RNA samples, due to either 1) low absolute activity among the assayed sequences, or 2) low transfection efficiency.
Figure 4 shows a representative “information footprint”1,2 generated by assaying ~37,000 random variants of a 145 bp sequence upstream of the human IFNB gene in HEK293 cells with or without exposure to Sendai virus. The promoter TATA-box and known proximal enhancer10 can be clearly identified as information-rich regions in a virus-dependent manner. 
<img alt="Scatter plot comparison of mRNA/DNA ratio replicates; data correlation analysis with R-squared values." src="/files/ftp_upload/51719/51719fig3highres.jpg" data-altupdatedat="1747911167000" data-alt="Figure 3"> 
Figure 3. Tag-Seq reproducibility. Scatter plots showing examples of Tag-Seq data from two independent replicate transfections with high (A) and low (B) reproducibility. The latter plot shows many outlier tags with high mRNA counts in only one of the two replicates. Such artifacts typically indicate that the concentrations of reporter mRNAs were too low for quantitative PCR amplification, either due to low absolute activities among the reporter constructs, or low transfection efficiencies.
<img alt="Sendai virus vs control expression analysis; enhancer, TATA-box loci; gene expression graph." src="/files/ftp_upload/51719/51719fig4highres.jpg" data-altupdatedat="1747911167000" data-alt="Figure 4"> 
Figure 4. Information footprinting of the human IFNB transcription start site and proximal enhancer. Approximately 37,000 random variants of a 145 nucleotide (nt) region upstream of the human IFNB gene were assayed using MPRA in HEK293 cells with (A) and without (B) exposure to Sendai virus. The blue bars show the mutual information between the reporter output and the nucleotide at each position. The proximal enhancer and TATA-box stand out as regions of high information content upon viral infection.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.5K Views.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Video: Massively Parallel Reporter Assays in Cultured Mammalian Cells

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in vitro analysis are well suited to study of large numbers of cells (&ge;105) in milliliter-scale volumes (&ge;0.1 ml). However, there are many instances in which it is necessary or desirable to scale down culture size to reduce consumption of the cells of interest and/or reagents required for their culture, stimulation, or processing. Unfortunately, conventional approaches do not support precise and reproducible manipulation of micro-scale cultures, and the microfluidics-based automated systems currently available are too complex and specialized for routine use by most laboratories. To address this problem, we have developed a simple and versatile technology platform for automated culture, stimulation, and recovery of small populations of cells (100 - 2,000 cells) in micro-scale volumes (1 - 20 &mu;l). The platform consists of a set of fibronectin-coated microcapillaries ("cell perfusion chambers"), within which micro-scale cultures are established, maintained, and stimulated; a digital microfluidics (DMF) device outfitted with "transfer" microcapillaries ("central hub"), which routes cells and reagents to and from the perfusion chambers; a high-precision syringe pump, which powers transport of materials between the perfusion chambers and the central hub; and an electronic interface that provides control over transport of materials, which is coordinated and automated via pre-determined scripts. As an example, we used the platform to facilitate study of transcriptional responses elicited in immune cells upon challenge with bacteria. Use of the platform enabled us to reduce consumption of cells and reagents, minimize experiment-to-experiment variability, and re-direct hands-on labor. Given the advantages that it confers, as well as its accessibility and versatility, our platform should find use in a wide variety of laboratories and applications, and prove especially useful in facilitating analysis of cells and stimuli that are available in only limited quantities.

We have developed an automated cell culture and interrogation platform for micro-scale cell stimulation experiments. The platform offers simple, versatile, and precise control in cultivating and stimulating small populations of cells, and recovering lysates for molecular analyses. The platform is well suited to studies that use precious cells and/or reagents.

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in ...

Bioengineering

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

Chemistry

A Multiplexed Luciferase-based Screening Platform for Interrogating Cancer-associated Signal Transduction in Cultured Cells

Genome-scale interrogation of gene function using RNA interference (RNAi) holds tremendous promise for the rapid identification of chemically tractable cancer cell vulnerabilities. Limiting the potential of this technology is the inability to rapidly delineate the mechanistic basis of phenotypic outcomes and thus inform the development of molecularly targeted therapeutic strategies. We outline here methods to deconstruct cellular phenotypes induced by RNAi-mediated gene targeting using multiplexed reporter systems that allow monitoring of key cancer cell-associated processes. This high-content screening methodology is versatile and can be readily adapted for the screening of other types of large molecular libraries.

Achieving a systems level understanding of cellular processes is a goal of modern-day cell biology. We describe here strategies for multiplexing luciferase reporters of various cellular function end-points to interrogate gene function using genome-scale RNAi libraries.

Genome-scale interrogation of gene function using RNA interference (RNAi)  holds tremendous promise for the rapid identification of chemically tractable  ...

Medicine

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since several decades, the sudden burst of multi- and extensively-drug resistant strains is a serious threat for the control of tuberculosis. Therefore, it is essential to identify new targets and pathways critical for the causative agent of the tuberculosis, Mycobacterium tuberculosis (Mtb) and to search for novel chemicals that could become TB drugs. One approach is to set&#160;up methods suitable for the genetic and chemical screens of large scale libraries enabling the search of a needle in a haystack. To this end, we developed a phenotypic assay relying on the detection of fluorescently labeled Mtb within fluorescently labeled host&#160;cells using automated confocal microscopy. This in vitro assay allows an image based quantification of the colonization process of Mtb&#160;into the host and was optimized for the 384-well microplate format, which is proper for screens of siRNA-, chemical compound- or Mtb mutant-libraries. The images are then processed for multiparametric analysis, which provides read&#160;out inferring on the pathogenesis of Mtb&#160;within host cells.

Here, we describe a phenotypic assay applicable to the High-throughput/High-content screens of small-interfering synthetic RNA (siRNA), chemical compound, and Mycobacterium tuberculosis mutant libraries. This method relies on the detection of fluorescently labeled Mycobacterium tuberculosis within fluorescently labeled host&#160;cell using automated confocal microscopy.

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

Immunology and Infection

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

Cancer Research

High Throughput, Real-time, Dual-readout Testing of Intracellular Antimicrobial Activity and Eukaryotic Cell Cytotoxicity

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require several additional experimental steps prior to readout, such as cell lysis, colony forming unit determination, or reagent addition. When performing thousands of assays, for example, during high-throughput screening, the downstream effort required for these types of assays is considerable. Therefore, to facilitate high-throughput antimicrobial discovery, we developed a real-time assay to simultaneously identify inhibitors of intracellular bacterial growth and assess eukaryotic cell cytotoxicity. Specifically, real-time intracellular bacterial growth detection was enabled by marking bacterial screening strains with either a bacterial lux operon (1st generation assay) or fluorescent protein reporters (2nd generation, orthogonal assay). A non-toxic, cell membrane-impermeant, nucleic acid-binding dye was also added during initial infection of macrophages. These dyes are excluded from viable cells. However, non-viable host cells lose membrane integrity permitting entry and fluorescent labeling of nuclear DNA (deoxyribonucleic acid). Notably, DNA binding is associated with a large increase in fluorescent quantum yield that provides a solution-based readout of host cell death. We have used this combined assay to perform a high-throughput screen in microplate format, and to assess intracellular growth and cytotoxicity by microscopy. Notably, antimicrobials may demonstrate synergy in which the combined effect of two or more antimicrobials when applied together is greater than when applied separately. Testing for in vitro synergy against intracellular pathogens is normally a prodigious task as combinatorial permutations of antibiotics at different concentrations must be assessed. However, we found that our real-time assay combined with automated, digital dispensing technology permitted facile synergy testing. Using these approaches, we were able to systematically survey action of a large number of antimicrobials alone and in combination against the intracellular pathogen, Legionella pneumophila.

A high throughput, real-time assay was developed to simultaneously identify (1) eukaryotic cell-penetrant antimicrobials targeting an intracellular bacterial pathogen, and (2) assess eukaryotic cell cytotoxicity. A variation on the same technology was thereafter combined with digital dispensing technology to enable facile, high-resolution, dose-response, and two- and three-dimensional synergy studies.

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require ...

Monitoring Plasmid Replication in Live Mammalian Cells over Multiple Generations by Fluorescence Microscopy

Few naturally-occurring plasmids are maintained in mammalian cells. Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus (EBV) and Kaposi's Sarcoma-associated herpesvirus (KSHV), which cause multiple human malignancies 1-3. These two genomes are replicated in a licensed manner, each using a single viral protein and cellular replication machinery, and are passed to daughter cells during cell division despite their lacking traditional centromeres 4-8.
Much work has been done to characterize the replications of these plasmid genomes using methods such as Southern blotting and fluorescence in situ hybridization (FISH). These methods are limited, though. Quantitative PCR and Southern blots provide information about the average number of plasmids per cell in a population of cells. FISH is a single-cell assay that reveals both the average number and the distribution of plasmids per cell in the population of cells but is static, allowing no information about the parent or progeny of the examined cell.
Here, we describe a method for visualizing plasmids in live cells. This method is based on the binding of a fluorescently tagged lactose repressor protein to multiple sites in the plasmid of interest 9. The DNA of interest is engineered to include approximately 250 tandem repeats of the lactose operator (LacO) sequence. LacO is specifically bound by the lactose repressor protein (LacI), which can be fused to a fluorescent protein. The fusion protein can either be expressed from the engineered plasmid or introduced by a retroviral vector. In this way, the DNA molecules are fluorescently tagged and therefore become visible via fluorescence microscopy. The fusion protein is blocked from binding the plasmid DNA by culturing cells in the presence of IPTG until the plasmids are ready to be viewed.
This system allows the plasmids to be monitored in living cells through several generations, revealing properties of their synthesis and partitioning to daughter cells. Ideal cells are adherent, easily transfected, and have large nuclei. This technique has been used to determine that 84% of EBV-derived plasmids are synthesized each generation and 88% of the newly synthesized plasmids partition faithfully to daughter cells in HeLa cells. Pairs of these EBV plasmids were seen to be tethered to or associated with sister chromatids after their synthesis in S-phase until they were seen to separate as the sister chromatids separated in Anaphase10. The method is currently being used to study replication of KSHV genomes in HeLa cells and SLK cells. HeLa cells are immortalized human epithelial cells, and SLK cells are immortalized human endothelial cells. Though SLK cells were originally derived from a KSHV lesion, neither the HeLa nor SLK cell line naturally harbors KSHV genomes11. In addition to studying viral replication, this visualization technique can be used to investigate the effects of the addition, removal, or mutation of various DNA sequence elements on synthesis, localization, and partitioning of other recombinant plasmid DNAs.

A method of observing individual DNA molecules in live cells is described. The technique is based on the binding of a fluorescently tagged lac repressor protein to binding sites engineered into the DNA of interest. This method can be adapted to follow many recombinant DNAs in live cells over time.

Few naturally-occurring plasmids are maintained in mammalian cells.  Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus  (EBV) ...

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with Parkinson&#39;s disease. 293T cells are transiently transfected with plasmids from an arrayed ORF expression library, together with luciferase reporter plasmids, in a one-gene-per-well microplate format. Firefly luciferase activity is assayed after 48 hr to determine the effects of each library gene upon alpha-synuclein transcription, normalized to expression from an internal control construct (a hCMV promoter directing Renilla luciferase). This protocol is facilitated by a bench-top robot enclosed in a biosafety cabinet, which performs aseptic liquid handling in 96-well format. Our automated transfection protocol is readily adaptable to high-throughput lentiviral library production or other functional screening protocols requiring triple-transfections of large numbers of unique library plasmids in conjunction with a common set of helper plasmids. We also present an inexpensive and validated alternative to commercially-available, dual luciferase reagents which employs PTC124, EDTA, and pyrophosphate to suppress firefly luciferase activity prior to measurement of Renilla luciferase. Using these methods, we screened 7,670 human genes and identified 68 regulators of alpha-synuclein. This protocol is easily modifiable to target other genes of interest.

We present a rapid and inexpensive screening method for identifying transcriptional regulators using high-throughput robotic transfections and a homemade dual-glow luciferase assay. This protocol rapidly generates direct side-by-side functional data for thousands of genes and is easily modifiable to target any gene of interest.

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Screening Peptides that Activate MRGPRX2 using Engineered HEK Cells

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new therapeutics. Mas related G-protein receptor-X2 (MRGPRX2) is an important receptor that regulates mast cell activation and, thus, directs the general immune response. Numerous ligands for MRGPRX2 have been identified and include endogenous peptides like PAMPs, defensins, LL-37 and other protein fragments (i.e., degraded albumin). Further identification of MRGPRX2 specific ligands requires the screening of a large number of peptides (i.e., peptide library); however, mast cells are difficult and expensive to maintain in vitro and, therefore, not economical to use for screening large numbers of molecules. The present paper demonstrates a method to design, develop, and screen a library of small peptide molecules using MRGPRX2 expressing HEK cells. This cell line is relatively easy and inexpensive to maintain and can be used for in vitro high-throughput analysis. A calcium sensitive Fura-2 fluorescent dye to mark intracellular calcium flux upon activation was used to monitor the activation. The ratio of fluorescence intensity of Fura-2 at 510 nm against excitation wavelengths of 340 and 380 nm was used to calculate calcium concentration. The peptide library used to verify this system was based on the endogenous proadrenomedullin N-terminal 12 (PAMP-12) secretagogue, which is known to bind MRGPRX2 with high specificity and affinity. Subsequent peptides were generated through amino acid truncation and alanine scanning techniques applied to PAMP-12. The method described here is simple and inexpensive yet robust for screening a large library of compounds to identify binding domains and other important parameters that play an important role in receptor activation.

Techniques for generating a library of short peptides that can activate mast cells via the MRGPRX2 receptor are described. Associated techniques are easy, inexpensive, and can be extended to other cell receptors.

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new ...

Autonomously Bioluminescent Mammalian Cells for Continuous and Real-time Monitoring of Cytotoxicity

Mammalian cell-based in vitro assays have been widely employed as alternatives to animal testing for toxicological studies but have been limited due to the high monetary and time costs of parallel sample preparation that are necessitated due to the destructive nature of firefly luciferase-based screening methods. This video describes the utilization of autonomously bioluminescent mammalian cells, which do not require the destructive addition of a luciferin substrate, as an inexpensive and facile method for monitoring the cytotoxic effects of a compound of interest. Mammalian cells stably expressing the full bacterial bioluminescence (luxCDABEfrp) gene cassette autonomously produce an optical signal that peaks at 490 nm without the addition of an expensive and possibly interfering luciferin substrate, excitation by an external energy source, or destruction of the sample that is traditionally performed during optical imaging procedures. This independence from external stimulation places the burden for maintaining the bioluminescent reaction solely on the cell, meaning that the resultant signal is only detected during active metabolism. This characteristic makes the lux-expressing cell line an excellent candidate for use as a biosentinel against cytotoxic effects because changes in bioluminescent production are indicative of adverse effects on cellular growth and metabolism. Similarly, the autonomous nature and lack of required sample destruction permits repeated imaging of the same sample in real-time throughout the period of toxicant exposure and can be performed across multiple samples using existing imaging equipment in an automated fashion.

Mammalian cells expressing the bacterial bioluminescence gene cassette (lux) produce light autonomously. The resulting bioluminescent dynamics upon chemical exposure have been demonstrated to reflect the treatment effects on cellular growth and metabolism, making these cells an inexpensive, continuous, real-time toxicity screening tool that can easily be adapted for high-throughput automation.

Mammalian  cell-based in vitro assays have been  widely employed as alternatives to animal testing for toxicological studies but  have been limited due to ...

Massively Parallel Reporter Assays in Cultured Mammalian Cells

Samenvatting

Meer video's verkennen