Questo lavoro è stato sostenuto dal National Human Genome Research Institute dei National Institutes of Health sotto Award Numero R01HG006785.

1 Progettazione Sequenza e Sintesi <ol><li> Inizia MPRA con la progettazione e la sintesi di sequenze da dosare per attività di regolamentazione. Per la compatibilità con la serie vettore pMPRA, progettare ogni sequenza utilizzando la seguente configurazione: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- tag -AGATCGGAAGAGCGTCG-3 &#39;, dove var indica la sequenza da dosare e tag denota uno o più tag di identificazione. </li><li> Le due regioni variabili (var e tag) sono separate da una coppia di KpnI (GGTACC) e XbaI (TCTAGA) siti di restrizione per facilitare la legatura direzionale di un frammento di gene reporter tra loro. Inoltre, due SFII (GGCCNNNNNGGCC) siti distinti saranno aggiunti mediante PCR per permettere la legatura direzionale nella spina dorsale pMPRA. Le regioni variabili non devono contenere ulteriori copie di qualsiasi di questi siti di restrizione. Se necessario, uno o più di questi enzimi di restrizione possono essere sostituiti, Fino a quando le sostituzioni 1) consentire il taglio efficiente vicino alle estremità di molecole di DNA, e 2) non tagliare altrove nella sequenza vettoriale. Vedi di discussione per ulteriori dettagli. </li><li> Ottenere i primer richiesti elencati nella tabella 1 da un fornitore commerciale. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [index] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tabella 1. sequenze di primer. [Indice] denota una sequenza indice 6-8 nt utilizzato per il sequenziamento multiplex. Ottenere almeno 8 primer TagSeq-P2 con indici differenti. Tuttodei primer deve essere purificata mediante HPLC o PAGE. <ol start="4"><li> Librerie oligonucleotide possono essere ottenuti da un fornitore o nucleo struttura commerciale, o generati utilizzando un programmabile basato microarray-oligonucleotide sintetizzatore come descritto dal produttore. Risospendere i prodotti OLS in 100 microlitri di buffer TE 0.1. </li><li> Eseguire le librerie oligonucleotidiche su un TBE-Urea 10% denaturazione gel di poliacrilamide. Caricare circa 1 pmol per corsia e macchia con macchia fluorescente ssDNA-sensibile per valutare la qualità (Figura 2A). </li><li> Se una band discreta corrispondente alle oligonucleotidi full-length può essere visualizzato (Figura 2A, corsie 1 e 2), asportare il corrispondente fetta gel di acrilammide ed eluire oligonucleotidi in 100 microlitri TE 0.1 notte a temperatura ambiente con agitazione. In caso contrario, procedere con l&#39;OLS sospensione crudo. </li><li> Amplifica e aggiungere le code SFII alla libreria oligonucleotide con emulsione PCR 9 </<html> sup&gt;. </li><li> Impostare 50 microlitri di miscele di reazione PCR come descritto nella Tabella 2. Poi si combinano con 300 ml di olio e miscela di tensioattivo dal DNA emulsione Micellula e kit di purificazione e vortex per 5 minuti a 4 ° C. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Reagente </td><td> 1x Volume (ml) </td></tr><tr><td> Herculase II Fusion DNA polimerasi </td><td> 0.5 </td></tr><tr><td> Tampone di reazione 5x Herculase II </td><td> 10 </td></tr><tr><td> dNTP (10 mm ciascuno) </td><td> 1.25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1.25 </td></tr><tr><td> MPRA_SfiI_F Primer (25 micron) </td><td> 0.25 </td></tr><tr><td> MPRA_SfiI_R Primer (25 micron) </td><td> 0.25 </td></tr><tr><td> Modello OLS (1-10 attomol) </td><td> varia </td></tr><tr><td> Acqua priva di nucleasi </td><td> 50 </td></tr></tbody></table>ve_content &quot;&gt; Tabella 2 Emulsion PCR mix di reazione (fase acquosa). <ol start="9"><li> Utilizzare la concentrazione che dà la resa massima di prodotti di amplificazione senza la comparsa di artefatti (vedi sezione 1.12). </li><li> Versare l&#39;emulsione risultante in provette per PCR ed eseguire 20 cicli di PCR (2 min a 95 ° C, 20 x [20 sec a 95 ° C, 20 sec a 55 ° C, 30 sec a 72 ° C], 3 min a 95 ° C). </li><li> Piscina e rompere ogni 350 ml di emulsione reazione di PCR con l&#39;aggiunta di 1 ml di isobutanolo e brevemente vortex, e poi purificare il prodotto di amplificazione utilizzando una colonna di purificazione del DNA. </li><li> Eseguire una aliquota su un gel di agarosio al 2% o 4% per verificare privo di artefatti di amplificazione (Figura 2B). </li></ol><img alt="Figura 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Figura 2 Preparazione di librerie di sintesi di oligonucleotidi. A) </sTrong&gt; Tre diverse biblioteche di sintesi di oligonucleotidi prime (OLS) eseguito su denaturazione del 10% TBE-urea gel di poliacrilammide. Bande corrispondenti a oligonucleotidi di lunghezza completa (*) possono essere visualizzati e asportati dalle librerie 1 e 2 Libreria 3 contiene contaminanti che interferiscono con la purificazione PAGE. Se questo è il caso, procedere direttamente al B amplificazione PCR.) Prodotti di aperto ed emulsione amplificazione PCR della stessa seduta biblioteca oligonucleotidi su un gel di agarosio. Amplificazione PCR di librerie di oligonucleotidi complessi crea frequentemente prodotti chimerici e altri artefatti che possono apparire come bande superiori e inferiori. Emulsione PCR può minimizzare questi manufatti. 2. Costruzione Biblioteca <ol><li> Preparare una spina dorsale plasmide linearizzato da digerire vettore pMPRA1 con Street Fighter II a 50 ° C per 2 ore, eseguito su un gel di agarosio 1%, asportare la fascia dorsale (in questo caso, 2,5 kb) e purificarlo utilizzando una colonna di spin di gel-purificazione. </li><li> Digerirei prodotti di PCR emulsione dal punto 1.4 con Street Fighter II a 50 ° C per 2 ore e purificano utilizzando le colonne di purificazione del DNA. </li><li> Per legare la libreria promotore tag nella spina dorsale vettore linearizzato, istituito reazioni contenenti 100 ng del prodotto della PCR digerito, 50 ng del vettore backbone linearizzato e DNA ligasi T4. Incubare per una notte a 16 ° C e poi il calore a 65 ° C per 20 minuti per inattivare la ligasi. </li><li> Trasforma E. coli con la reazione legatura. Per preservare la complessità biblioteca, mirano a ottenere almeno 10x più cfu che ci sono distinte combinazioni promotore-tag nella libreria progettata. </li><li> Quando il numero totale di tag è di circa 100.000, il cfu bersaglio può tipicamente essere ottenuto eseguendo 6-8 trasformazioni parallele per libreria. </li><li> Per ogni trasformazione, unire 50 ml electrocompetent E. coli con 2 ml di mix legatura su ghiaccio. Trasformazione mediante elettroporazione, recuperare le cellule in 800 microlitri SOCsupporto con agitazione a 37 ° C per 1 ora, e poi unire celle dalle trasformazioni parallele. </li><li> Per valutare l&#39;efficienza di trasformazione, piastra diluizioni seriali da un alinquot di cellule recuperate su piastre di agar LB con 50-100 mg / ml carbenicillina e incubare una notte a 37 ° C. Stimare cfu totale come (cfu osservato) × (fattore di diluizione) × (V - v) / v, dove V è il volume totale delle cellule recuperati e v è il volume dell&#39;aliquota prelevata per le diluizioni seriali. </li><li> Al tempo stesso, utilizzare il resto delle cellule recuperate per inoculare 200 ml di LB integrato con 100 mg / ml carbenicillina. Crescere le cellule a 37 ° C per una notte in un incubatore shaker e poi isolare il DNA plasmidico secondo procedure standard. </li><li> Digest un&#39;aliquota della biblioteca isolata plasmide con SFII a 50 ° C per 2 ore e correre su un gel di agarosio 1% per confermare la presenza di inserti. </li><li> Linearizzare la libreria plasmide da cUtting tra le varianti del promotore e tag utilizzando KpnI e XbaI. Per massimizzare l&#39;efficienza di digestione, eseguire digestioni di serie: </li><li> In primo luogo, digerire con KpnI a 37 ° C per 1 ora e purificare mediante biglie magnetiche. In secondo luogo, digerire con XbaI con l&#39;aggiunta di 1 U Gambero fosfatasi alcalina a 37 ° C per 2 ore, il calore inattivare a 65 ° C per 5 minuti, e poi purificare con biglie magnetiche. </li><li> Eseguire una aliquota su un gel di agarosio 1% per verificare completa linearizzazione. Se plasmide uncut è visibile, il frammento linearizzato va gel purificato. </li><li> Per generare una libreria MPRA adatto per trasfezione in cellule di mammifero, legare un ORF con KpnI / XbaI estremità compatibili nella biblioteca intermedio linearizzato. </li><li> Per preparare un luc2 ORF frammento compatibile da pMPRAdonor1, digerire il plasmide con KpnI e XbaI a 37 ° C per 1 ora e correre su un gel di agarosio 1%. Accise il frammento ORF (1,7 kb in questo caso) e la purificazione mediante colonna di gel di depurazione centrifuga. </li><li> Clonare il frammento ORF nella libreria intermedio linearizzato come descritto nei passaggi 2,3-2,8. </li><li> Digest un&#39;aliquota (corrispondente a 1-2 mg) della biblioteca MPRA con KpnI a 37 ° C per 1 ora e correre su un gel di agarosio all&#39;1%. Se la libreria digerito viene eseguito come una singola banda, passare alla sezione 3 Se si osservano bande addizionali (tipicamente corrispondente al riporto di costrutti intermedi), la libreria può essere ulteriormente purificato come segue: </li><li> Digest 3-5 mg di biblioteca contaminato con KpnI a 37 ° C per 1 ora e correre su un gel di agarosio 0,8% per una notte a 4 ° C. </li><li> Accise banda libreria corretta, purificare il DNA usando una colonna di spin purificazione gel ed eseguire auto-ligazione con alta concentrazione di T4 DNA ligasi a 37 ° C per 1 ora. Quindi ripetere la trasformazione e la biblioteca ultima estrazione del DNA come descritto al punto 2.8. </li></ol> 3 Transfection, Perturbazione, e RNA Isolation <ol><li> Per ogni trasfezione indipendente, la cultura il numero di cellule (come determinato dalla complessità biblioteca MPRA, vedi Discussione) in mezzo appropriato. Ad esempio, la cultura HEK293T / 17 cellule in DMEM supplementato con 10% FBS e L-glutammina / penicillina / streptomicina. Cellule di coltura per almeno due transfezioni indipendenti per ogni libreria e condizione sperimentale. </li><li> Trasfezione le cellule in coltura con plasmidi MPRA. Il metodo e le condizioni di trasfezione devono essere ottimizzati per ogni tipo cellulare. Per ogni campione transfettate, mantenere una aliquota (50-100 ng) di DNA plasmide come controllo abbinato. </li><li> Ad esempio, transfettare 0,5 x 10 7 HEK293T / 17 cellule cresciute al ~ 50% di confluenza in un piatto di cultura 10 centimetri con 10 mg DNA plasmidico in 1 ml di Opti-MEM ho ridotto siero Media utilizzando 30 microlitri Lipofectamine LTX e 10 ml più reagente. Rimuovere la miscela di trasfezione dopo 5 ore e permettere l&#39;cellule di recuperare per 24-48 ore. </li><li> Facoltativamente, eseguire qualsiasi perturbazione necessaria ad attivare sequenze regolatrici contestuali o segnale-dipendente nella libreria progettata. </li><li> Raccogliere le cellule e isolare poli (A) + mRNA utilizzando colonne di cellulosa oligo (dT) standard o perline usando le istruzioni del loro produttore. </li><li> Assicurarsi che la capacità massima di legame delle colonne o perline superare l&#39;importo totale di mRNA previsto dalle cellule raccolte. Ad esempio, il rendimento atteso dalla sezione 3.3 è di circa 0,5-2,5 mg mRNA. </li></ol> 4. Tag-Seq <ol><li> Per eliminare i residui di vettore DNA dai lisati cellulari trasfettate, trattare ogni campione di mRNA 20 microlitri con 1 ml Turbo DNasi (2 U) e 2,3 microlitri di buffer 10x Turbo DNasi a 37 ° C per 1 ora, aggiungere 2,4 microlitri DNasi Turbo Inattivazione reagente a RT per 5 min con miscelazione, centrifugare a 10.000 g per 90 secondi, e poi trasferire la soluzione in una nuova provetta. </li><li> Verificare<html> purezza eseguendo PCR come descritto nel capitolo 4.6 da 60-100 ng di ciascun campione di mRNA, e quindi eseguendo i prodotti su un gel di agarosio. Se ampliconi specifici sono visibili (0,25 kb se si utilizza pMPRA1 con luc2), colonna purificare l&#39;mRNA trattata e poi ripetere il trattamento DNasi. </li><li> Per generare librerie di sequenziamento Tag-Seq, convertire giornalista mRNA in cDNA e aggiungere schede di sequenziamento mediante PCR. </li><li> Impostare miscele di primer mRNA / RT come descritto nella Tabella 3. Incubare a 65 ° C per 5 minuti, poi disporli sul ghiaccio. In parallelo, impostare reazioni di sintesi di cDNA, come descritto nella Tabella 4. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (ml) </td></tr><tr><td> campione di mRNA (400-700 ng totale) </td><td> 8 </td></tr><tr><td> Oligo-0DT (50 micron) </td><td> 1 </td></tr><tr><td> dNTP (10 mm ciascuno) </td><td> 1 </td></tr></tbody></table>ove_content &quot;&gt; Tabella 3 RNA / trascrizione inversa miscela di primer per la sintesi del DNA. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (ml) </td></tr><tr><td> 10x SuperScript III RT Buffer </td><td> 2 </td></tr><tr><td> MgCl 2 (25 mm) </td><td> 4 </td></tr><tr><td> DTT (0.1 M) </td><td> 2 </td></tr><tr><td> RNaseOut (40 U / ml) </td><td> 1 </td></tr><tr><td> SuperScript III (200 U / ml) </td><td> 1 </td></tr></tbody></table> Tabella 4 cDNA mix di reazione di sintesi. <ol start="5"><li> Unire delicatamente mRNA / RT Primer mescola con miscele di sintesi cDNA. Incubare a 50 ° C per 50 min, 85 ° C per 5 minuti e poi posto su ghiaccio. Infine, incubare con 2 U di ribonucleasi H a 37 ° C per 20 min. </li><li> Impostare reazioni PCR, come descritto nella Tabella 5 con 4-6 microlitricDNA miscela di reazione o 50 ng plasmide giornalista come modelli. Quindi eseguire amplificazione PCR (95 ° C per 2 min, 26 x [95 ° C per 30 sec, 55 ° C per 30 sec, 72 ° C per 30 sec], 72 ° C per 3 min). </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (ml) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> TagSeq_P1 Primer (25 micron) </td><td> 0.5 </td></tr><tr><td> TagSeq_P2 Primer (25 micron) </td><td> 0.5 </td></tr><tr><td> Template (mRNA, cDNA mix o plasmide DNA) </td><td> varia </td></tr><tr><td> Acqua priva di nucleasi </td><td> 50 </td></tr></tbody></table> Tabella 5 Tag-Seq Miscela di reazione PCR. <ol start="7"><li> Eseguire i prodotti di PCR attraverso un gel di agarosio al 2%, bande di accisa corrispondenti alle ampliconi libreria di tag-Seq (0,25 kb se si utilizzapMPRA1 con luc2) e purificare queste utilizzano colonne di spin purificazione gel. </li><li> Piscina, denaturare e sequenziare i ampliconi Tag-Seq purificate direttamente con uno strumento di sequenziamento Illumina. </li><li> Filtro di bassa qualità si legge eliminando tutto ciò che a) contenere uno o più posizione con una qualità Phred punteggio inferiore a 30 all&#39;interno del tag in sequenza o b) non corrisponde esattamente un tag progettato. Contare il numero di volte che ogni tag rimanente appare in ogni libreria. Normalizzare i conteggi tag di TPM (tag per milione tag sequenziati) e quindi calcolare il rapporto tra i conteggi tag mRNA derivati ​​over-plasmide derivato tag conteggi per ogni coppia di librerie di sequenziamento. Se più tag diversi sono stati collegati per ogni variante di sequenza, utilizzare i loro rapporti mediani per l&#39;analisi a valle. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Gli autori dichiarano di non avere interessi finanziari in competizione.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Saggi Reporter Massively Parallel (MPRA) consentono la misurazione multiplex delle attività di regolamentazione trascrizionali di migliaia a centinaia di migliaia di sequenze di DNA 1- 7. Nella sua implementazione più comune, multiplazione è ottenuta accoppiando ogni sequenza di interesse ad un gene reporter sintetico che contiene un tag di sequenza che identifica a valle di un open reading frame (ORF; la figura 1). A seguito di trasfezione, l&#39;isolamento di RNA e profondo sequenziamento dei fini del 3 &#39;dei trascritti del gene reporter, le relative attività delle sequenze accoppiati possono essere dedotte dalla relativa abbondanza di loro tag di identificazione. <img alt="Figura 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> Figura 1 Panoramica di MPRA. Una libreria di MPRA giornalista costruisce è costruito accoppiando putative sequenze di regolamentazione sinteticogeni reporter che consistono di un &quot;inerte&quot; ORF (come GFP o luciferasi) seguito da una sequenza di tag di identificazione. La biblioteca è transfettato in massa in una popolazione di cellule in coltura e trascritto mRNA giornalista viene successivamente recuperata. Sequenziamento profondo viene utilizzato per contare il numero di occorrenze di ogni tag tra i mRNA giornalista e plasmidi trasfettate. Il rapporto tra mRNA risiedono su conti plasmid possono essere usate per dedurre l&#39;attività della corrispondente sequenza regolatrice. Adattato con il permesso di Melnikov, et al 2. MPRA può essere adattato a una vasta gamma di disegni sperimentali, di cui 1) la mutagenesi completa dei geni dell&#39;individuo elementi regolatori, 2) la scansione di elementi regolatori nuovi attraverso un luogo di interesse, 3) testare l&#39;effetto della variazione genetica naturale in un insieme di putative promotori, enhancer o silenziatori, e 4) ingegneria semi-razionale di elementi regolatori sintetici. Libraries di varianti di sequenza possono essere generati utilizzando una varietà di metodi, tra cui la sintesi biblioteca oligonucleotidi (OLS) su microarray programmabili 2,3,6,7, assemblaggio di oligonucleotidi degenerati 1,4, legatura combinatoria 8 e frammentazione del DNA genomico 5. Questo protocollo descrive la costruzione di una libreria di promotore varianti con OLS e vettori pMPRA1 e pMPRAdonor1 (Addgene ID 49349 e 49352, rispettivamente; http://www.addgene.org), trasfezione transiente di questa biblioteca in cellule di mammifero in coltura e la successiva quantificazione delle attività di promotore di sequenziamento profondo dei relativi tag (Tag-Seq). Le versioni precedenti di questo protocollo sono stati utilizzati nella ricerca riportata nel Melnikov et al. Nature Biotechnology 30, 271-277 (2012) e in Kheradpour et al. Genome Research 23, 800-811 (2013).

<table border="0" cellpadding="0" cellspacing="0" width="954">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:359px;">Oligonucleotide library synthesis</td>
			<td style="width:201px;">Agilent, CustomArray or other OLS vendors</td>
			<td style="width:119px;">custom</td>
			<td style="width:275px;">If using OLS construction method</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">pMPRA1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49349</td>
			<td>MPRA plasmid backbone</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">pMPRAdonor1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49352</td>
			<td>luc2 ORF donor plasmid</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>OLS buffer</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">Novex TBE-Urea Gels, 10%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">EC6875BOX</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Novex TBA-Urea Sample Buffer</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">LC6876</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SYBR Gold Nucleic Acid Gel Stain</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">S-11494</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Micellula DNA Emulsion &#38; Purification Kit</td>
			<td style="width:201px;">EURx/CHIMERx</td>
			<td style="width:119px;">3600-01</td>
			<td>Library amplification by emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Herculase II Fusion DNA Polymerase</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600675</td>
			<td>Polymerase for emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SfiI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0123S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">KpnI-HF</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R3142S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">XbaI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0145S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">T4 DNA Ligase (2,000,000 units/ml)</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">M0202T</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">One Shot TOP10 Electrocomp E. coli</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">C4040-50</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">LB agar and liquid media with carbenicllin</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>Growth media for cloning</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels 1%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-01</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels, 2%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-02</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MinElute Gel Extraction Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">28604</td>
			<td>Library and backbone purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">EndoFree Plasmid Maxi Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">12362</td>
			<td>Library DNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Cell culture media</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Transfection reagents</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MicroPoly(A)Purist Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1919</td>
			<td>mRNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TURBO DNA-free Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1907</td>
			<td>Plasmid DNA removal</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SuperScript III First-Strand Synthesis System</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">18080-051</td>
			<td>cDNA synthesis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">PfuUltra II Hotstart PCR Master Mix</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600850</td>
			<td>Polymerase for Tag-Seq PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Primers (see text)</td>
			<td style="width:201px;">IDT</td>
			<td style="width:119px;">custom</td>
			<td>PAGE purify Tag-Seq primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:201px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA facilita ad alta risoluzione, dissezione quantitativa delle relazioni sequenza-attività di elementi di regolazione trascrizionale. Un esperimento MPRA prescelto sarà tipicamente misurazioni risulteranno altamente riproducibili per la maggior parte delle sequenze nella libreria transfettate (Figura 3A). Se scarsa riproducibilità si osserva (Figura 3B), ciò è indicativo di una concentrazione troppo bassa di mRNA del reporter nei campioni di RNA recuperati, a causa sia 1) bassa attività assoluto tra le sequenze dosati, o 2) bassa efficienza di trasfezione. La Figura 4 mostra un rappresentante &quot;informazione impronta&quot; 1,2 generato analizzando ~ 37.000 varianti casuali di una sequenza di 145 bp a monte del gene IFNB umano in cellule HEK293 con o senza esposizione al virus Sendai. Il promotore TATA-box e noto esaltatore prossimale 10 possono essere chiaramente identificati come regi ricco di informazionions in maniera virus-dipendente. <img alt="Figura 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Figura 3 Tag-Seq riproducibilità. Diagrammi a dispersione mostrano esempi di dati Tag-Seq da due transfezioni replicati indipendenti con alta (A) e bassa (B) riproducibilità. Il secondo grafico mostra molti tag outlier con elevato numero di mRNA in una sola delle due repliche. Tali manufatti in genere indicano che le concentrazioni di mRNA giornalista erano troppo bassi per PCR quantitativa, sia a causa di bassa attività assoluti tra i costrutti reporter, o bassa efficienza di trasfezione. <img alt="Figura 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> Figura 4. Informazioni footprinting del sito di inizio della trascrizione IFNB umana e potenziatore prossimale. </strong&gt; Circa 37.000 varianti casuali di 145 nucleotidi (nt) regione a monte del gene IFNB umana sono stati analizzati utilizzando MPRA in cellule HEK293 con (A) e senza (B) esposizione al virus Sendai. Le barre blu indicano la reciproca informazione tra l&#39;uscita giornalista e il nucleotide in ogni posizione. Il potenziatore prossimale e TATA-box si distinguono come regioni ad alto contenuto informativo su infezione virale.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Saggi Reporter massicciamente parallelo in cellule di mammifero in coltura

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.4K Views.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Video: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Trypsinizing and Subculturing Mammalian Cells

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in cell death. The first step in subculturing is to detach cells from the surface of the primary culture vessel by trypsinization or mechanical means. The resultant cell suspension is then subdivided, or reseeded, into fresh cultures. Secondary cultures are checked for growth and fed periodically, and may be subsequently subcultured to produce tertiary cultures. The time between passaging of cells varies with the cell line and depends on the growth rate.

As cells reach confluency, they must be subcultured or passaged. This video will demonstrate a procedure for subculturing both adherent and suspension cells.

Trypsinizing e Trapianto cellule di mammifero

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

Ricerca

Biologia

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

EsiRNA MISSIONE per lo screening RNAi in cellule di mammifero

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

MISSION LentiPlex Pooled shRNA Library Screening in Mammalian Cells

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies.
There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids 1. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library.
The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes 2. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 108 TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification.
Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line 3, 4. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

Here we use a human LentiPlex pooled library and traditional sequencing methods to identify gene targets promoting cell survival. We demonstrate how to set up and deconvolute a LentiPlex screen and validate the results.

LentiPlex MISSIONE pool di screening Biblioteca shRNA in cellule di mammifero

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to ...

Analysis of Cell Cycle Position in Mammalian Cells

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of cell proliferation underlies the pathology of diseases like cancer. As such there is great need to be able to investigate cell proliferation and quantitate the proportion of cells in each phase of the cell cycle. It is also of vital importance to indistinguishably identify cells that are replicating their DNA within a larger population. Since a cell&prime;s decision to proliferate is made in the G1 phase immediately before initiating DNA synthesis and progressing through the rest of the cell cycle, detection of DNA synthesis at this stage allows for an unambiguous determination of the status of growth regulation in cell culture experiments.
DNA content in cells can be readily quantitated by flow cytometry of cells stained with propidium iodide, a fluorescent DNA intercalating dye. Similarly, active DNA synthesis can be quantitated by culturing cells in the presence of radioactive thymidine, harvesting the cells, and measuring the incorporation of radioactivity into an acid insoluble fraction. We have considerable expertise with cell cycle analysis and recommend a different approach. We Investigate cell proliferation using bromodeoxyuridine/fluorodeoxyuridine (abbreviated simply as BrdU) staining that detects the incorporation of these thymine analogs into recently synthesized DNA. Labeling and staining cells with BrdU, combined with total DNA staining by propidium iodide and analysis by flow cytometry1 offers the most accurate measure of cells in the various stages of the cell cycle. It is our preferred method because it combines the detection of active DNA synthesis, through antibody based staining of BrdU, with total DNA content from propidium iodide. This allows for the clear separation of cells in G1 from early S phase, or late S phase from G2/M. Furthermore, this approach can be utilized to investigate the effects of many different cell stimuli and pharmacologic agents on the regulation of progression through these different cell cycle phases.
In this report we describe methods for labeling and staining cultured cells, as well as their analysis by flow cytometry. We also include experimental examples of how this method can be used to measure the effects of growth inhibiting signals from cytokines such as TGF-&beta;1, and proliferative inhibitors such as the cyclin dependent kinase inhibitor, p27KIP1. We also include an alternate protocol that allows for the analysis of cell cycle position in a sub-population of cells within a larger culture5. In this case, we demonstrate how to detect a cell cycle arrest in cells transfected with the retinoblastoma gene even when greatly outnumbered by untransfected cells in the same culture. These examples illustrate the many ways that DNA staining and flow cytometry can be utilized and adapted to investigate fundamental questions of mammalian cell cycle control.

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol. We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

Analisi della posizione ciclo cellulare nelle cellule di mammifero

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of ...

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum (ER). However, the visualization of these mRNAs can be challenging. This is especially true when only a fraction of the mRNA is ER-associated and their distribution to this organelle is obstructed by non-targeted (i.e. "free") transcripts. In order to monitor ER-associated mRNAs, we have developed a method in which cells are treated with a short exposure to a digitonin extraction solution that selectively permeabilizes the plasma membrane, and thus removes the cytoplasmic contents, while simultaneously maintaining the integrity of the ER. When this method is coupled with fluorescent in situ hybridization (FISH), one can clearly visualize ER-bound mRNAs by fluorescent microscopy. Using this protocol the degree of ER-association for either bulk poly(A) transcripts or specific mRNAs can be assessed and even quantified. In the process, one can use this assay to investigate the nature of mRNA-ER interactions.

Here we describe a method to visualize endoplasmic reticulum-associated mRNAs in mammalian tissue culture cells. This technique involves the selective permeabilization of the plasma membrane with digitonin to remove cytoplasmic contents followed by fluorescent in situ hybridization to detect either bulk poly(A) mRNA or specific transcripts.

Visualizzazione di mRNA reticolo endoplasmatico localizzate in cellule di mammifero

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum ...

Chromosome Preparation From Cultured Cells

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as fluorescence in situ hybridization (FISH), this assay has the powerful ability to analyze individual cells for aberrations that involve gains or losses of portions of the genome&#160;and rearrangements involving one or more chromosomes. In humans, chromosome abnormalities occur in approximately 1 per 160 live births1,2, 60-80% of all miscarriages3,4, 10% of stillbirths2,5, 13% of individuals with congenital heart disease6, 3-6% of infertility cases2, and in many patients with developmental delay&#160;and birth defects7. Cytogenetic analysis of malignancy is routinely used by researchers and clinicians, as observations of clonal chromosomal abnormalities have been shown to have both diagnostic and prognostic significance8,9.&#160; Chromosome isolation is invaluable for gene therapy and stem cell research of organisms including nonhuman primates and rodents10-13.
Chromosomes can be isolated from cells of live tissues, including blood lymphocytes, skin fibroblasts, amniocytes, placenta, bone marrow, and tumor specimens. Chromosomes are analyzed at the metaphase stage of mitosis, when they are most condensed and therefore more clearly visible. The first step of the chromosome isolation technique involves the disruption of the spindle fibers by incubation with Colcemid, to prevent the cells from proceeding to the subsequent anaphase stage. The cells are then treated with a hypotonic solution and preserved in their swollen state with Carnoy&#39;s fixative. The cells are then dropped on to slides and can then be utilized for a variety of procedures. G-banding involves trypsin treatment followed by staining with Giemsa to create characteristic light and dark bands. The same procedure to isolate chromosomes can be used for the preparation of cells for procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY)14,15.

Chromosomes can be isolated from live cells such as lymphocytes or skin fibroblasts, and from organisms including humans or mice. These chromosome preparations can be further utilized for routine G-banding and molecular cytogenetic procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY).

Cromosoma Preparazione da cellule in coltura

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as ...

Viability Assays for Cells in Culture

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized viability assays are expensive in terms of equipment but can be faster and more objective than manual cell counts. The present report describes the use of three such viability assays. Two of these assays are infrared and one is luminescent. Both infrared assays rely on a 16&#160;bit Odyssey Imager. One infrared assay uses the DRAQ5 stain for nuclei combined with the Sapphire stain for cytosol and is visualized in the 700 nm channel. The other infrared assay, an In-Cell Western, uses antibodies against cytoskeletal proteins (&#945;-tubulin or microtubule associated protein 2) and labels them in the 800 nm channel. The third viability assay is a commonly used luminescent assay for ATP, but we use a quarter of the recommended volume to save on cost. These measurements are all linear and correlate with the number of cells plated, but vary in sensitivity. All three assays circumvent time-consuming microscopy and sample the entire well, thereby reducing sampling error. Finally, all of the assays can easily be completed within one day of the end of the experiment, allowing greater numbers of experiments to be performed within short timeframes. However, they all rely on the assumption that cell numbers remain in proportion to signal strength after treatments, an assumption that is sometimes not met, especially for cellular ATP. Furthermore, if cells increase or decrease in size after treatment, this might affect signal strength without affecting cell number. We conclude that all viability assays, including manual counts, suffer from a number of caveats, but that computerized viability assays are well worth the initial investment. Using all three assays together yields a comprehensive view of cellular structure and function.

Therapeutic compounds are often first examined in vitro with viability assays. Blind cell counts by a human observer can be highly sensitive to small changes in cell number but do not assess function. Computerized viability assays, as described here, can assess both structure and function in an objective manner.

I saggi di redditività per le cellule in coltura

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized ...

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Rilevamento somatici genetiche Alterazioni in campioni tumorali da Exon Capture e Sequencing Massively Parallel

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Visualization of Endoplasmic Reticulum Subdomains in Cultured Cells

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and functions despite the intense interorganelle molecular traffic. The techniques described in this paper are powerful means of studying protein and lipid mobility and trafficking in vivo and in their physiological environment. Fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP) are widely used live-cell imaging techniques for studying intracellular trafficking through the exo-endocytic pathway, the continuity between organelles or subcompartments, the formation of protein complexes, and protein localization in lipid microdomains, all of which can be observed under physiological and pathological conditions. The limitations of these approaches are mainly due to the use of fluorescent fusion proteins, and their potential drawbacks include artifactual over-expression in cells and the possibility of differences in the folding and localization of tagged and native proteins. Finally, as the limit of resolution of optical microscopy (about 200 nm) does not allow investigation of the fine structure of the ER or the specific subcompartments that can originate in cells under stress (i.e. hypoxia, drug administration, the over-expression of transmembrane ER resident proteins) or under pathological conditions, we combine live-cell imaging of cultured transfected cells with ultrastructural analyses based on transmission electron microscopy.

We describe the imaging approaches we use to investigate the distribution and mobility of the transfected fluorescent proteins resident in the endoplasmic reticulum (ER) by means of the confocal imaging of living cells. We also ultrastructurally analyze the effect of their expression on the architecture of this subcellular compartment.

Visualizzazione del reticolo endoplasmatico sottodomini in cellule in coltura

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

siRNA screening per identificare ubiquitina e ubiquitina-come regolatori del sistema di percorsi biologici in cellule di mammifero coltivate

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...