Name: massively parallel reporter assays in cultured mammalian cells
Uploaded: 2014-08-17T16:00:00.000+00:00
Duration: 11 min 3 s
Description: Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Questo lavoro è stato sostenuto dal National Human Genome Research Institute dei National Institutes of Health sotto Award Numero R01HG006785.

1 Progettazione Sequenza e Sintesi <ol><li> Inizia MPRA con la progettazione e la sintesi di sequenze da dosare per attività di regolamentazione. Per la compatibilità con la serie vettore pMPRA, progettare ogni sequenza utilizzando la seguente configurazione: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- tag -AGATCGGAAGAGCGTCG-3 &#39;, dove var indica la sequenza da dosare e tag denota uno o più tag di identificazione. </li><li> Le due regioni variabili (var e tag) sono separate da una coppia di KpnI (GGTACC) e XbaI (TCTAGA) siti di restrizione per facilitare la legatura direzionale di un frammento di gene reporter tra loro. Inoltre, due SFII (GGCCNNNNNGGCC) siti distinti saranno aggiunti mediante PCR per permettere la legatura direzionale nella spina dorsale pMPRA. Le regioni variabili non devono contenere ulteriori copie di qualsiasi di questi siti di restrizione. Se necessario, uno o più di questi enzimi di restrizione possono essere sostituiti, Fino a quando le sostituzioni 1) consentire il taglio efficiente vicino alle estremità di molecole di DNA, e 2) non tagliare altrove nella sequenza vettoriale. Vedi di discussione per ulteriori dettagli. </li><li> Ottenere i primer richiesti elencati nella tabella 1 da un fornitore commerciale. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [index] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tabella 1. sequenze di primer. [Indice] denota una sequenza indice 6-8 nt utilizzato per il sequenziamento multiplex. Ottenere almeno 8 primer TagSeq-P2 con indici differenti. Tuttodei primer deve essere purificata mediante HPLC o PAGE. <ol start="4"><li> Librerie oligonucleotide possono essere ottenuti da un fornitore o nucleo struttura commerciale, o generati utilizzando un programmabile basato microarray-oligonucleotide sintetizzatore come descritto dal produttore. Risospendere i prodotti OLS in 100 microlitri di buffer TE 0.1. </li><li> Eseguire le librerie oligonucleotidiche su un TBE-Urea 10% denaturazione gel di poliacrilamide. Caricare circa 1 pmol per corsia e macchia con macchia fluorescente ssDNA-sensibile per valutare la qualità (Figura 2A). </li><li> Se una band discreta corrispondente alle oligonucleotidi full-length può essere visualizzato (Figura 2A, corsie 1 e 2), asportare il corrispondente fetta gel di acrilammide ed eluire oligonucleotidi in 100 microlitri TE 0.1 notte a temperatura ambiente con agitazione. In caso contrario, procedere con l&#39;OLS sospensione crudo. </li><li> Amplifica e aggiungere le code SFII alla libreria oligonucleotide con emulsione PCR 9 </<html> sup&gt;. </li><li> Impostare 50 microlitri di miscele di reazione PCR come descritto nella Tabella 2. Poi si combinano con 300 ml di olio e miscela di tensioattivo dal DNA emulsione Micellula e kit di purificazione e vortex per 5 minuti a 4 ° C. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Reagente </td><td> 1x Volume (ml) </td></tr><tr><td> Herculase II Fusion DNA polimerasi </td><td> 0.5 </td></tr><tr><td> Tampone di reazione 5x Herculase II </td><td> 10 </td></tr><tr><td> dNTP (10 mm ciascuno) </td><td> 1.25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1.25 </td></tr><tr><td> MPRA_SfiI_F Primer (25 micron) </td><td> 0.25 </td></tr><tr><td> MPRA_SfiI_R Primer (25 micron) </td><td> 0.25 </td></tr><tr><td> Modello OLS (1-10 attomol) </td><td> varia </td></tr><tr><td> Acqua priva di nucleasi </td><td> 50 </td></tr></tbody></table>ve_content &quot;&gt; Tabella 2 Emulsion PCR mix di reazione (fase acquosa). <ol start="9"><li> Utilizzare la concentrazione che dà la resa massima di prodotti di amplificazione senza la comparsa di artefatti (vedi sezione 1.12). </li><li> Versare l&#39;emulsione risultante in provette per PCR ed eseguire 20 cicli di PCR (2 min a 95 ° C, 20 x [20 sec a 95 ° C, 20 sec a 55 ° C, 30 sec a 72 ° C], 3 min a 95 ° C). </li><li> Piscina e rompere ogni 350 ml di emulsione reazione di PCR con l&#39;aggiunta di 1 ml di isobutanolo e brevemente vortex, e poi purificare il prodotto di amplificazione utilizzando una colonna di purificazione del DNA. </li><li> Eseguire una aliquota su un gel di agarosio al 2% o 4% per verificare privo di artefatti di amplificazione (Figura 2B). </li></ol><img alt="Figura 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Figura 2 Preparazione di librerie di sintesi di oligonucleotidi. A) </sTrong&gt; Tre diverse biblioteche di sintesi di oligonucleotidi prime (OLS) eseguito su denaturazione del 10% TBE-urea gel di poliacrilammide. Bande corrispondenti a oligonucleotidi di lunghezza completa (*) possono essere visualizzati e asportati dalle librerie 1 e 2 Libreria 3 contiene contaminanti che interferiscono con la purificazione PAGE. Se questo è il caso, procedere direttamente al B amplificazione PCR.) Prodotti di aperto ed emulsione amplificazione PCR della stessa seduta biblioteca oligonucleotidi su un gel di agarosio. Amplificazione PCR di librerie di oligonucleotidi complessi crea frequentemente prodotti chimerici e altri artefatti che possono apparire come bande superiori e inferiori. Emulsione PCR può minimizzare questi manufatti. 2. Costruzione Biblioteca <ol><li> Preparare una spina dorsale plasmide linearizzato da digerire vettore pMPRA1 con Street Fighter II a 50 ° C per 2 ore, eseguito su un gel di agarosio 1%, asportare la fascia dorsale (in questo caso, 2,5 kb) e purificarlo utilizzando una colonna di spin di gel-purificazione. </li><li> Digerirei prodotti di PCR emulsione dal punto 1.4 con Street Fighter II a 50 ° C per 2 ore e purificano utilizzando le colonne di purificazione del DNA. </li><li> Per legare la libreria promotore tag nella spina dorsale vettore linearizzato, istituito reazioni contenenti 100 ng del prodotto della PCR digerito, 50 ng del vettore backbone linearizzato e DNA ligasi T4. Incubare per una notte a 16 ° C e poi il calore a 65 ° C per 20 minuti per inattivare la ligasi. </li><li> Trasforma E. coli con la reazione legatura. Per preservare la complessità biblioteca, mirano a ottenere almeno 10x più cfu che ci sono distinte combinazioni promotore-tag nella libreria progettata. </li><li> Quando il numero totale di tag è di circa 100.000, il cfu bersaglio può tipicamente essere ottenuto eseguendo 6-8 trasformazioni parallele per libreria. </li><li> Per ogni trasformazione, unire 50 ml electrocompetent E. coli con 2 ml di mix legatura su ghiaccio. Trasformazione mediante elettroporazione, recuperare le cellule in 800 microlitri SOCsupporto con agitazione a 37 ° C per 1 ora, e poi unire celle dalle trasformazioni parallele. </li><li> Per valutare l&#39;efficienza di trasformazione, piastra diluizioni seriali da un alinquot di cellule recuperate su piastre di agar LB con 50-100 mg / ml carbenicillina e incubare una notte a 37 ° C. Stimare cfu totale come (cfu osservato) × (fattore di diluizione) × (V - v) / v, dove V è il volume totale delle cellule recuperati e v è il volume dell&#39;aliquota prelevata per le diluizioni seriali. </li><li> Al tempo stesso, utilizzare il resto delle cellule recuperate per inoculare 200 ml di LB integrato con 100 mg / ml carbenicillina. Crescere le cellule a 37 ° C per una notte in un incubatore shaker e poi isolare il DNA plasmidico secondo procedure standard. </li><li> Digest un&#39;aliquota della biblioteca isolata plasmide con SFII a 50 ° C per 2 ore e correre su un gel di agarosio 1% per confermare la presenza di inserti. </li><li> Linearizzare la libreria plasmide da cUtting tra le varianti del promotore e tag utilizzando KpnI e XbaI. Per massimizzare l&#39;efficienza di digestione, eseguire digestioni di serie: </li><li> In primo luogo, digerire con KpnI a 37 ° C per 1 ora e purificare mediante biglie magnetiche. In secondo luogo, digerire con XbaI con l&#39;aggiunta di 1 U Gambero fosfatasi alcalina a 37 ° C per 2 ore, il calore inattivare a 65 ° C per 5 minuti, e poi purificare con biglie magnetiche. </li><li> Eseguire una aliquota su un gel di agarosio 1% per verificare completa linearizzazione. Se plasmide uncut è visibile, il frammento linearizzato va gel purificato. </li><li> Per generare una libreria MPRA adatto per trasfezione in cellule di mammifero, legare un ORF con KpnI / XbaI estremità compatibili nella biblioteca intermedio linearizzato. </li><li> Per preparare un luc2 ORF frammento compatibile da pMPRAdonor1, digerire il plasmide con KpnI e XbaI a 37 ° C per 1 ora e correre su un gel di agarosio 1%. Accise il frammento ORF (1,7 kb in questo caso) e la purificazione mediante colonna di gel di depurazione centrifuga. </li><li> Clonare il frammento ORF nella libreria intermedio linearizzato come descritto nei passaggi 2,3-2,8. </li><li> Digest un&#39;aliquota (corrispondente a 1-2 mg) della biblioteca MPRA con KpnI a 37 ° C per 1 ora e correre su un gel di agarosio all&#39;1%. Se la libreria digerito viene eseguito come una singola banda, passare alla sezione 3 Se si osservano bande addizionali (tipicamente corrispondente al riporto di costrutti intermedi), la libreria può essere ulteriormente purificato come segue: </li><li> Digest 3-5 mg di biblioteca contaminato con KpnI a 37 ° C per 1 ora e correre su un gel di agarosio 0,8% per una notte a 4 ° C. </li><li> Accise banda libreria corretta, purificare il DNA usando una colonna di spin purificazione gel ed eseguire auto-ligazione con alta concentrazione di T4 DNA ligasi a 37 ° C per 1 ora. Quindi ripetere la trasformazione e la biblioteca ultima estrazione del DNA come descritto al punto 2.8. </li></ol> 3 Transfection, Perturbazione, e RNA Isolation <ol><li> Per ogni trasfezione indipendente, la cultura il numero di cellule (come determinato dalla complessità biblioteca MPRA, vedi Discussione) in mezzo appropriato. Ad esempio, la cultura HEK293T / 17 cellule in DMEM supplementato con 10% FBS e L-glutammina / penicillina / streptomicina. Cellule di coltura per almeno due transfezioni indipendenti per ogni libreria e condizione sperimentale. </li><li> Trasfezione le cellule in coltura con plasmidi MPRA. Il metodo e le condizioni di trasfezione devono essere ottimizzati per ogni tipo cellulare. Per ogni campione transfettate, mantenere una aliquota (50-100 ng) di DNA plasmide come controllo abbinato. </li><li> Ad esempio, transfettare 0,5 x 10 7 HEK293T / 17 cellule cresciute al ~ 50% di confluenza in un piatto di cultura 10 centimetri con 10 mg DNA plasmidico in 1 ml di Opti-MEM ho ridotto siero Media utilizzando 30 microlitri Lipofectamine LTX e 10 ml più reagente. Rimuovere la miscela di trasfezione dopo 5 ore e permettere l&#39;cellule di recuperare per 24-48 ore. </li><li> Facoltativamente, eseguire qualsiasi perturbazione necessaria ad attivare sequenze regolatrici contestuali o segnale-dipendente nella libreria progettata. </li><li> Raccogliere le cellule e isolare poli (A) + mRNA utilizzando colonne di cellulosa oligo (dT) standard o perline usando le istruzioni del loro produttore. </li><li> Assicurarsi che la capacità massima di legame delle colonne o perline superare l&#39;importo totale di mRNA previsto dalle cellule raccolte. Ad esempio, il rendimento atteso dalla sezione 3.3 è di circa 0,5-2,5 mg mRNA. </li></ol> 4. Tag-Seq <ol><li> Per eliminare i residui di vettore DNA dai lisati cellulari trasfettate, trattare ogni campione di mRNA 20 microlitri con 1 ml Turbo DNasi (2 U) e 2,3 microlitri di buffer 10x Turbo DNasi a 37 ° C per 1 ora, aggiungere 2,4 microlitri DNasi Turbo Inattivazione reagente a RT per 5 min con miscelazione, centrifugare a 10.000 g per 90 secondi, e poi trasferire la soluzione in una nuova provetta. </li><li> Verificare<html> purezza eseguendo PCR come descritto nel capitolo 4.6 da 60-100 ng di ciascun campione di mRNA, e quindi eseguendo i prodotti su un gel di agarosio. Se ampliconi specifici sono visibili (0,25 kb se si utilizza pMPRA1 con luc2), colonna purificare l&#39;mRNA trattata e poi ripetere il trattamento DNasi. </li><li> Per generare librerie di sequenziamento Tag-Seq, convertire giornalista mRNA in cDNA e aggiungere schede di sequenziamento mediante PCR. </li><li> Impostare miscele di primer mRNA / RT come descritto nella Tabella 3. Incubare a 65 ° C per 5 minuti, poi disporli sul ghiaccio. In parallelo, impostare reazioni di sintesi di cDNA, come descritto nella Tabella 4. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (ml) </td></tr><tr><td> campione di mRNA (400-700 ng totale) </td><td> 8 </td></tr><tr><td> Oligo-0DT (50 micron) </td><td> 1 </td></tr><tr><td> dNTP (10 mm ciascuno) </td><td> 1 </td></tr></tbody></table>ove_content &quot;&gt; Tabella 3 RNA / trascrizione inversa miscela di primer per la sintesi del DNA. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (ml) </td></tr><tr><td> 10x SuperScript III RT Buffer </td><td> 2 </td></tr><tr><td> MgCl 2 (25 mm) </td><td> 4 </td></tr><tr><td> DTT (0.1 M) </td><td> 2 </td></tr><tr><td> RNaseOut (40 U / ml) </td><td> 1 </td></tr><tr><td> SuperScript III (200 U / ml) </td><td> 1 </td></tr></tbody></table> Tabella 4 cDNA mix di reazione di sintesi. <ol start="5"><li> Unire delicatamente mRNA / RT Primer mescola con miscele di sintesi cDNA. Incubare a 50 ° C per 50 min, 85 ° C per 5 minuti e poi posto su ghiaccio. Infine, incubare con 2 U di ribonucleasi H a 37 ° C per 20 min. </li><li> Impostare reazioni PCR, come descritto nella Tabella 5 con 4-6 microlitricDNA miscela di reazione o 50 ng plasmide giornalista come modelli. Quindi eseguire amplificazione PCR (95 ° C per 2 min, 26 x [95 ° C per 30 sec, 55 ° C per 30 sec, 72 ° C per 30 sec], 72 ° C per 3 min). </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (ml) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> TagSeq_P1 Primer (25 micron) </td><td> 0.5 </td></tr><tr><td> TagSeq_P2 Primer (25 micron) </td><td> 0.5 </td></tr><tr><td> Template (mRNA, cDNA mix o plasmide DNA) </td><td> varia </td></tr><tr><td> Acqua priva di nucleasi </td><td> 50 </td></tr></tbody></table> Tabella 5 Tag-Seq Miscela di reazione PCR. <ol start="7"><li> Eseguire i prodotti di PCR attraverso un gel di agarosio al 2%, bande di accisa corrispondenti alle ampliconi libreria di tag-Seq (0,25 kb se si utilizzapMPRA1 con luc2) e purificare queste utilizzano colonne di spin purificazione gel. </li><li> Piscina, denaturare e sequenziare i ampliconi Tag-Seq purificate direttamente con uno strumento di sequenziamento Illumina. </li><li> Filtro di bassa qualità si legge eliminando tutto ciò che a) contenere uno o più posizione con una qualità Phred punteggio inferiore a 30 all&#39;interno del tag in sequenza o b) non corrisponde esattamente un tag progettato. Contare il numero di volte che ogni tag rimanente appare in ogni libreria. Normalizzare i conteggi tag di TPM (tag per milione tag sequenziati) e quindi calcolare il rapporto tra i conteggi tag mRNA derivati ​​over-plasmide derivato tag conteggi per ogni coppia di librerie di sequenziamento. Se più tag diversi sono stati collegati per ogni variante di sequenza, utilizzare i loro rapporti mediani per l&#39;analisi a valle. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Gli autori dichiarano di non avere interessi finanziari in competizione.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Saggi Reporter Massively Parallel (MPRA) consentono la misurazione multiplex delle attività di regolamentazione trascrizionali di migliaia a centinaia di migliaia di sequenze di DNA 1- 7. Nella sua implementazione più comune, multiplazione è ottenuta accoppiando ogni sequenza di interesse ad un gene reporter sintetico che contiene un tag di sequenza che identifica a valle di un open reading frame (ORF; la figura 1). A seguito di trasfezione, l&#39;isolamento di RNA e profondo sequenziamento dei fini del 3 &#39;dei trascritti del gene reporter, le relative attività delle sequenze accoppiati possono essere dedotte dalla relativa abbondanza di loro tag di identificazione. <img alt="Figura 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> Figura 1 Panoramica di MPRA. Una libreria di MPRA giornalista costruisce è costruito accoppiando putative sequenze di regolamentazione sinteticogeni reporter che consistono di un &quot;inerte&quot; ORF (come GFP o luciferasi) seguito da una sequenza di tag di identificazione. La biblioteca è transfettato in massa in una popolazione di cellule in coltura e trascritto mRNA giornalista viene successivamente recuperata. Sequenziamento profondo viene utilizzato per contare il numero di occorrenze di ogni tag tra i mRNA giornalista e plasmidi trasfettate. Il rapporto tra mRNA risiedono su conti plasmid possono essere usate per dedurre l&#39;attività della corrispondente sequenza regolatrice. Adattato con il permesso di Melnikov, et al 2. MPRA può essere adattato a una vasta gamma di disegni sperimentali, di cui 1) la mutagenesi completa dei geni dell&#39;individuo elementi regolatori, 2) la scansione di elementi regolatori nuovi attraverso un luogo di interesse, 3) testare l&#39;effetto della variazione genetica naturale in un insieme di putative promotori, enhancer o silenziatori, e 4) ingegneria semi-razionale di elementi regolatori sintetici. Libraries di varianti di sequenza possono essere generati utilizzando una varietà di metodi, tra cui la sintesi biblioteca oligonucleotidi (OLS) su microarray programmabili 2,3,6,7, assemblaggio di oligonucleotidi degenerati 1,4, legatura combinatoria 8 e frammentazione del DNA genomico 5. Questo protocollo descrive la costruzione di una libreria di promotore varianti con OLS e vettori pMPRA1 e pMPRAdonor1 (Addgene ID 49349 e 49352, rispettivamente; http://www.addgene.org), trasfezione transiente di questa biblioteca in cellule di mammifero in coltura e la successiva quantificazione delle attività di promotore di sequenziamento profondo dei relativi tag (Tag-Seq). Le versioni precedenti di questo protocollo sono stati utilizzati nella ricerca riportata nel Melnikov et al. Nature Biotechnology 30, 271-277 (2012) e in Kheradpour et al. Genome Research 23, 800-811 (2013).

<table><tbody><tr><td>Oligonucleotide library synthesis</td><td>Agilent, CustomArray, or other OLS vendors</td><td>custom</td><td>If using OLS construction method</td></tr><tr><td>pMPRA1</td><td>Addgene</td><td>49349</td><td>MPRA plasmid backbone</td></tr><tr><td>pMPRAdonor1</td><td>Addgene</td><td>49352</td><td>luc2 ORF donor plasmid</td></tr><tr><td>TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td><td>Generic</td><td>n/a</td><td>OLS buffer</td></tr><tr><td>Novex TBE-Urea Gels, 10%</td><td>Life Technologies</td><td>EC6875BOX</td><td>PAGE purification of OLS products</td></tr><tr><td>Novex TBA-Urea Sample Buffer</td><td>Life Technologies</td><td>LC6876</td><td>PAGE purification of OLS products</td></tr><tr><td>SYBR Gold Nucleic Acid Gel Stain</td><td>Life Technologies</td><td>S-11494</td><td>PAGE purification of OLS products</td></tr><tr><td>Micellula DNA Emulsion &amp;amp; Purification Kit</td><td>EURx/CHIMERx</td><td>3600-01</td><td>Library amplification by emulsion PCR</td></tr><tr><td>Herculase II Fusion DNA Polymerase</td><td>Agilent</td><td>600675</td><td>Polymerase for emulsion PCR</td></tr><tr><td>SfiI</td><td>New England Biolabs</td><td>R0123S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>KpnI-HF</td><td>New England Biolabs</td><td>R3142S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>XbaI</td><td>New England Biolabs</td><td>R0145S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>T4 DNA Ligase (2,000,000 units/ml)</td><td>New England Biolabs</td><td>M0202T</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>One Shot TOP10 Electrocomp &lt;em&gt;E. coli&lt;/em&gt;</td><td>Life Technologies</td><td>C4040-50</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>LB agar and liquid media with carbenicllin</td><td>Generic</td><td>n/a</td><td>Growth media for cloning</td></tr><tr><td>E-Gel EX Gels 1%</td><td>Life Technologies</td><td>G4010-01</td><td>Library verification and purification</td></tr><tr><td>E-Gel EX Gels, 2%</td><td>Life Technologies</td><td>G4010-02</td><td>Library verification and purification</td></tr><tr><td>MinElute Gel Extraction Kit</td><td>Qiagen</td><td>28604</td><td>Library and backbone purification</td></tr><tr><td>EndoFree Plasmid Maxi Kit</td><td>Qiagen</td><td>12362</td><td>Library DNA isolation</td></tr><tr><td>Cell culture media</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>Transfection reagents</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>MicroPoly(A)Purist Kit</td><td>Life Technologies</td><td>AM1919</td><td>mRNA isolation</td></tr><tr><td>TURBO DNA-free Kit</td><td>Life Technologies</td><td>AM1907</td><td>Plasmid DNA removal</td></tr><tr><td>SuperScript III First-Strand Synthesis System</td><td>Life Technologies</td><td>18080-051</td><td>cDNA synthesis</td></tr><tr><td>PfuUltra II Hotstart PCR Master Mix</td><td>Agilent</td><td>600850</td><td>Polymerase for Tag-Seq PCR</td></tr><tr><td>Primers (see text)</td><td>IDT</td><td>custom</td><td>PAGE purify Tag-Seq primers</td></tr></tbody></table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA facilita ad alta risoluzione, dissezione quantitativa delle relazioni sequenza-attività di elementi di regolazione trascrizionale. Un esperimento MPRA prescelto sarà tipicamente misurazioni risulteranno altamente riproducibili per la maggior parte delle sequenze nella libreria transfettate (Figura 3A). Se scarsa riproducibilità si osserva (Figura 3B), ciò è indicativo di una concentrazione troppo bassa di mRNA del reporter nei campioni di RNA recuperati, a causa sia 1) bassa attività assoluto tra le sequenze dosati, o 2) bassa efficienza di trasfezione. La Figura 4 mostra un rappresentante &quot;informazione impronta&quot; 1,2 generato analizzando ~ 37.000 varianti casuali di una sequenza di 145 bp a monte del gene IFNB umano in cellule HEK293 con o senza esposizione al virus Sendai. Il promotore TATA-box e noto esaltatore prossimale 10 possono essere chiaramente identificati come regi ricco di informazionions in maniera virus-dipendente. <img alt="Figura 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Figura 3 Tag-Seq riproducibilità. Diagrammi a dispersione mostrano esempi di dati Tag-Seq da due transfezioni replicati indipendenti con alta (A) e bassa (B) riproducibilità. Il secondo grafico mostra molti tag outlier con elevato numero di mRNA in una sola delle due repliche. Tali manufatti in genere indicano che le concentrazioni di mRNA giornalista erano troppo bassi per PCR quantitativa, sia a causa di bassa attività assoluti tra i costrutti reporter, o bassa efficienza di trasfezione. <img alt="Figura 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> Figura 4. Informazioni footprinting del sito di inizio della trascrizione IFNB umana e potenziatore prossimale. </strong&gt; Circa 37.000 varianti casuali di 145 nucleotidi (nt) regione a monte del gene IFNB umana sono stati analizzati utilizzando MPRA in cellule HEK293 con (A) e senza (B) esposizione al virus Sendai. Le barre blu indicano la reciproca informazione tra l&#39;uscita giornalista e il nucleotide in ogni posizione. Il potenziatore prossimale e TATA-box si distinguono come regioni ad alto contenuto informativo su infezione virale.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Saggi Reporter massicciamente parallelo in cellule di mammifero in coltura

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.4K Views.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Video: Massively Parallel Reporter Assays in Cultured Mammalian Cells

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in vitro analysis are well suited to study of large numbers of cells (&ge;105) in milliliter-scale volumes (&ge;0.1 ml). However, there are many instances in which it is necessary or desirable to scale down culture size to reduce consumption of the cells of interest and/or reagents required for their culture, stimulation, or processing. Unfortunately, conventional approaches do not support precise and reproducible manipulation of micro-scale cultures, and the microfluidics-based automated systems currently available are too complex and specialized for routine use by most laboratories. To address this problem, we have developed a simple and versatile technology platform for automated culture, stimulation, and recovery of small populations of cells (100 - 2,000 cells) in micro-scale volumes (1 - 20 &mu;l). The platform consists of a set of fibronectin-coated microcapillaries ("cell perfusion chambers"), within which micro-scale cultures are established, maintained, and stimulated; a digital microfluidics (DMF) device outfitted with "transfer" microcapillaries ("central hub"), which routes cells and reagents to and from the perfusion chambers; a high-precision syringe pump, which powers transport of materials between the perfusion chambers and the central hub; and an electronic interface that provides control over transport of materials, which is coordinated and automated via pre-determined scripts. As an example, we used the platform to facilitate study of transcriptional responses elicited in immune cells upon challenge with bacteria. Use of the platform enabled us to reduce consumption of cells and reagents, minimize experiment-to-experiment variability, and re-direct hands-on labor. Given the advantages that it confers, as well as its accessibility and versatility, our platform should find use in a wide variety of laboratories and applications, and prove especially useful in facilitating analysis of cells and stimuli that are available in only limited quantities.

We have developed an automated cell culture and interrogation platform for micro-scale cell stimulation experiments. The platform offers simple, versatile, and precise control in cultivating and stimulating small populations of cells, and recovering lysates for molecular analyses. The platform is well suited to studies that use precious cells and/or reagents.

Una piattaforma automatizzata versatile per micro-scala Cellulari esperimenti di stimolazione

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in ...

Ricerca

Bioingegneria

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

Ottimizzando la costituzione genetica di chimico sonde in GPCR per foto-reticolazione Mapping e chimica di Bioorthogonal in cellule di mammiferi dal vivo

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

Chimica

A Multiplexed Luciferase-based Screening Platform for Interrogating Cancer-associated Signal Transduction in Cultured Cells

Genome-scale interrogation of gene function using RNA interference (RNAi) holds tremendous promise for the rapid identification of chemically tractable cancer cell vulnerabilities. Limiting the potential of this technology is the inability to rapidly delineate the mechanistic basis of phenotypic outcomes and thus inform the development of molecularly targeted therapeutic strategies. We outline here methods to deconstruct cellular phenotypes induced by RNAi-mediated gene targeting using multiplexed reporter systems that allow monitoring of key cancer cell-associated processes. This high-content screening methodology is versatile and can be readily adapted for the screening of other types of large molecular libraries.

Achieving a systems level understanding of cellular processes is a goal of modern-day cell biology. We describe here strategies for multiplexing luciferase reporters of various cellular function end-points to interrogate gene function using genome-scale RNAi libraries.

Una piattaforma di screening Luciferase basata multiplex per interrogare il cancro-associata trasduzione del segnale in cellule in coltura

Genome-scale interrogation of gene function using RNA interference (RNAi)  holds tremendous promise for the rapid identification of chemically tractable  ...

Medicina

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since several decades, the sudden burst of multi- and extensively-drug resistant strains is a serious threat for the control of tuberculosis. Therefore, it is essential to identify new targets and pathways critical for the causative agent of the tuberculosis, Mycobacterium tuberculosis (Mtb) and to search for novel chemicals that could become TB drugs. One approach is to set&#160;up methods suitable for the genetic and chemical screens of large scale libraries enabling the search of a needle in a haystack. To this end, we developed a phenotypic assay relying on the detection of fluorescently labeled Mtb within fluorescently labeled host&#160;cells using automated confocal microscopy. This in vitro assay allows an image based quantification of the colonization process of Mtb&#160;into the host and was optimized for the 384-well microplate format, which is proper for screens of siRNA-, chemical compound- or Mtb mutant-libraries. The images are then processed for multiparametric analysis, which provides read&#160;out inferring on the pathogenesis of Mtb&#160;within host cells.

Here, we describe a phenotypic assay applicable to the High-throughput/High-content screens of small-interfering synthetic RNA (siRNA), chemical compound, and Mycobacterium tuberculosis mutant libraries. This method relies on the detection of fluorescently labeled Mycobacterium tuberculosis within fluorescently labeled host&#160;cell using automated confocal microscopy.

Un test fenotipico microscopico per la quantificazione dei micobatteri intracellulari adattati per lo screening ad alta produttività / alto contenuto

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

Immunologia e infezioni

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

Un saggio reporter per analizzare la maturazione dei microRNA intronici in cellule di mammifero

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

Ricerca sul cancro

High Throughput, Real-time, Dual-readout Testing of Intracellular Antimicrobial Activity and Eukaryotic Cell Cytotoxicity

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require several additional experimental steps prior to readout, such as cell lysis, colony forming unit determination, or reagent addition. When performing thousands of assays, for example, during high-throughput screening, the downstream effort required for these types of assays is considerable. Therefore, to facilitate high-throughput antimicrobial discovery, we developed a real-time assay to simultaneously identify inhibitors of intracellular bacterial growth and assess eukaryotic cell cytotoxicity. Specifically, real-time intracellular bacterial growth detection was enabled by marking bacterial screening strains with either a bacterial lux operon (1st generation assay) or fluorescent protein reporters (2nd generation, orthogonal assay). A non-toxic, cell membrane-impermeant, nucleic acid-binding dye was also added during initial infection of macrophages. These dyes are excluded from viable cells. However, non-viable host cells lose membrane integrity permitting entry and fluorescent labeling of nuclear DNA (deoxyribonucleic acid). Notably, DNA binding is associated with a large increase in fluorescent quantum yield that provides a solution-based readout of host cell death. We have used this combined assay to perform a high-throughput screen in microplate format, and to assess intracellular growth and cytotoxicity by microscopy. Notably, antimicrobials may demonstrate synergy in which the combined effect of two or more antimicrobials when applied together is greater than when applied separately. Testing for in vitro synergy against intracellular pathogens is normally a prodigious task as combinatorial permutations of antibiotics at different concentrations must be assessed. However, we found that our real-time assay combined with automated, digital dispensing technology permitted facile synergy testing. Using these approaches, we were able to systematically survey action of a large number of antimicrobials alone and in combination against the intracellular pathogen, Legionella pneumophila.

A high throughput, real-time assay was developed to simultaneously identify (1) eukaryotic cell-penetrant antimicrobials targeting an intracellular bacterial pathogen, and (2) assess eukaryotic cell cytotoxicity. A variation on the same technology was thereafter combined with digital dispensing technology to enable facile, high-resolution, dose-response, and two- and three-dimensional synergy studies.

High Throughput, in tempo reale, Dual-lettura Prove di intracellulare antimicrobica attività e eucariotica citotossicità cellulare

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require ...

Monitoring Plasmid Replication in Live Mammalian Cells over Multiple Generations by Fluorescence Microscopy

Few naturally-occurring plasmids are maintained in mammalian cells. Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus (EBV) and Kaposi's Sarcoma-associated herpesvirus (KSHV), which cause multiple human malignancies 1-3. These two genomes are replicated in a licensed manner, each using a single viral protein and cellular replication machinery, and are passed to daughter cells during cell division despite their lacking traditional centromeres 4-8.
Much work has been done to characterize the replications of these plasmid genomes using methods such as Southern blotting and fluorescence in situ hybridization (FISH). These methods are limited, though. Quantitative PCR and Southern blots provide information about the average number of plasmids per cell in a population of cells. FISH is a single-cell assay that reveals both the average number and the distribution of plasmids per cell in the population of cells but is static, allowing no information about the parent or progeny of the examined cell.
Here, we describe a method for visualizing plasmids in live cells. This method is based on the binding of a fluorescently tagged lactose repressor protein to multiple sites in the plasmid of interest 9. The DNA of interest is engineered to include approximately 250 tandem repeats of the lactose operator (LacO) sequence. LacO is specifically bound by the lactose repressor protein (LacI), which can be fused to a fluorescent protein. The fusion protein can either be expressed from the engineered plasmid or introduced by a retroviral vector. In this way, the DNA molecules are fluorescently tagged and therefore become visible via fluorescence microscopy. The fusion protein is blocked from binding the plasmid DNA by culturing cells in the presence of IPTG until the plasmids are ready to be viewed.
This system allows the plasmids to be monitored in living cells through several generations, revealing properties of their synthesis and partitioning to daughter cells. Ideal cells are adherent, easily transfected, and have large nuclei. This technique has been used to determine that 84% of EBV-derived plasmids are synthesized each generation and 88% of the newly synthesized plasmids partition faithfully to daughter cells in HeLa cells. Pairs of these EBV plasmids were seen to be tethered to or associated with sister chromatids after their synthesis in S-phase until they were seen to separate as the sister chromatids separated in Anaphase10. The method is currently being used to study replication of KSHV genomes in HeLa cells and SLK cells. HeLa cells are immortalized human epithelial cells, and SLK cells are immortalized human endothelial cells. Though SLK cells were originally derived from a KSHV lesion, neither the HeLa nor SLK cell line naturally harbors KSHV genomes11. In addition to studying viral replication, this visualization technique can be used to investigate the effects of the addition, removal, or mutation of various DNA sequence elements on synthesis, localization, and partitioning of other recombinant plasmid DNAs.

A method of observing individual DNA molecules in live cells is described. The technique is based on the binding of a fluorescently tagged lac repressor protein to binding sites engineered into the DNA of interest. This method can be adapted to follow many recombinant DNAs in live cells over time.

Monitoraggio replica plasmide in cellule di mammifero in diretta nel corso di generazioni multiple mediante microscopia a fluorescenza

Few naturally-occurring plasmids are maintained in mammalian cells.  Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus  (EBV) ...

Biologia

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with Parkinson&#39;s disease. 293T cells are transiently transfected with plasmids from an arrayed ORF expression library, together with luciferase reporter plasmids, in a one-gene-per-well microplate format. Firefly luciferase activity is assayed after 48 hr to determine the effects of each library gene upon alpha-synuclein transcription, normalized to expression from an internal control construct (a hCMV promoter directing Renilla luciferase). This protocol is facilitated by a bench-top robot enclosed in a biosafety cabinet, which performs aseptic liquid handling in 96-well format. Our automated transfection protocol is readily adaptable to high-throughput lentiviral library production or other functional screening protocols requiring triple-transfections of large numbers of unique library plasmids in conjunction with a common set of helper plasmids. We also present an inexpensive and validated alternative to commercially-available, dual luciferase reagents which employs PTC124, EDTA, and pyrophosphate to suppress firefly luciferase activity prior to measurement of Renilla luciferase. Using these methods, we screened 7,670 human genes and identified 68 regulators of alpha-synuclein. This protocol is easily modifiable to target other genes of interest.

We present a rapid and inexpensive screening method for identifying transcriptional regulators using high-throughput robotic transfections and a homemade dual-glow luciferase assay. This protocol rapidly generates direct side-by-side functional data for thousands of genes and is easily modifiable to target any gene of interest.

High-throughput screening funzionale utilizzando una casalinga Dual-glow Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Screening Peptides that Activate MRGPRX2 using Engineered HEK Cells

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new therapeutics. Mas related G-protein receptor-X2 (MRGPRX2) is an important receptor that regulates mast cell activation and, thus, directs the general immune response. Numerous ligands for MRGPRX2 have been identified and include endogenous peptides like PAMPs, defensins, LL-37 and other protein fragments (i.e., degraded albumin). Further identification of MRGPRX2 specific ligands requires the screening of a large number of peptides (i.e., peptide library); however, mast cells are difficult and expensive to maintain in vitro and, therefore, not economical to use for screening large numbers of molecules. The present paper demonstrates a method to design, develop, and screen a library of small peptide molecules using MRGPRX2 expressing HEK cells. This cell line is relatively easy and inexpensive to maintain and can be used for in vitro high-throughput analysis. A calcium sensitive Fura-2 fluorescent dye to mark intracellular calcium flux upon activation was used to monitor the activation. The ratio of fluorescence intensity of Fura-2 at 510 nm against excitation wavelengths of 340 and 380 nm was used to calculate calcium concentration. The peptide library used to verify this system was based on the endogenous proadrenomedullin N-terminal 12 (PAMP-12) secretagogue, which is known to bind MRGPRX2 with high specificity and affinity. Subsequent peptides were generated through amino acid truncation and alanine scanning techniques applied to PAMP-12. The method described here is simple and inexpensive yet robust for screening a large library of compounds to identify binding domains and other important parameters that play an important role in receptor activation.

Techniques for generating a library of short peptides that can activate mast cells via the MRGPRX2 receptor are described. Associated techniques are easy, inexpensive, and can be extended to other cell receptors.

Peptidi di screening che attivano MRGPRX2 utilizzando cellule HEK ingegnerizzate

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new ...

Autonomously Bioluminescent Mammalian Cells for Continuous and Real-time Monitoring of Cytotoxicity

Mammalian cell-based in vitro assays have been widely employed as alternatives to animal testing for toxicological studies but have been limited due to the high monetary and time costs of parallel sample preparation that are necessitated due to the destructive nature of firefly luciferase-based screening methods. This video describes the utilization of autonomously bioluminescent mammalian cells, which do not require the destructive addition of a luciferin substrate, as an inexpensive and facile method for monitoring the cytotoxic effects of a compound of interest. Mammalian cells stably expressing the full bacterial bioluminescence (luxCDABEfrp) gene cassette autonomously produce an optical signal that peaks at 490 nm without the addition of an expensive and possibly interfering luciferin substrate, excitation by an external energy source, or destruction of the sample that is traditionally performed during optical imaging procedures. This independence from external stimulation places the burden for maintaining the bioluminescent reaction solely on the cell, meaning that the resultant signal is only detected during active metabolism. This characteristic makes the lux-expressing cell line an excellent candidate for use as a biosentinel against cytotoxic effects because changes in bioluminescent production are indicative of adverse effects on cellular growth and metabolism. Similarly, the autonomous nature and lack of required sample destruction permits repeated imaging of the same sample in real-time throughout the period of toxicant exposure and can be performed across multiple samples using existing imaging equipment in an automated fashion.

Mammalian cells expressing the bacterial bioluminescence gene cassette (lux) produce light autonomously. The resulting bioluminescent dynamics upon chemical exposure have been demonstrated to reflect the treatment effects on cellular growth and metabolism, making these cells an inexpensive, continuous, real-time toxicity screening tool that can easily be adapted for high-throughput automation.

Autonomamente bioluminescenti cellule di mammifero per la continua e monitoraggio in tempo reale di citotossicità

Mammalian  cell-based in vitro assays have been  widely employed as alternatives to animal testing for toxicological studies but  have been limited due to ...