Ce travail a été financé par l&#39;Institut National Human Genome Research des National Institutes of Health sous Prix Nombre R01HG006785.

1 Séquence Conception et synthèse <ol><li> Commencez CARP avec la conception et la synthèse de séquences à doser l&#39;activité réglementaire. Pour la compatibilité avec la série vecteur pMPRA, concevoir chaque séquence en utilisant le modèle suivant: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- tag -AGATCGGAAGAGCGTCG-3 &#39;où var représente la séquence à doser et l&#39;étiquette désigne une ou plusieurs étiquettes d&#39;identification. </li><li> Les deux régions variables (var) et les étiquettes sont séparées par une paire de Kpnl (GGTACC) et Xbal (TCTAGA), des sites de restriction pour faciliter la ligature directionnelle d&#39;un fragment du gène rapporteur entre eux. En outre, deux Sfil (GGCCNNNNNGGCC) sites distincts seront ajoutés par PCR pour permettre une ligature directionnelle dans le squelette pMPRA. Les régions variables ne doivent pas contenir des copies additionnelles de l&#39;un de ces sites de restriction. Si nécessaire, une ou plusieurs de ces enzymes de restriction peut être remplacée, Tant que les remplacements 1) permettent une coupe efficace à proximité des extrémités des molécules d&#39;ADN, et 2) ne coupe pas ailleurs dans la séquence de vecteur. Voir discussion pour plus de détails. </li><li> Obtenir les amorces nécessaires énumérées dans le tableau 1 à partir d&#39;un fournisseur commercial. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [index] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tableau 1: séquences d&#39;amorces. [Index] désigne une séquence d&#39;index de 6 à 8 nt utilisé pour le séquençage multiplexé. Obtenir au moins 8 amorces TagSeq-P2 avec différents indices. Tousdes amorces doivent être purifiés par HPLC ou PAGE. <ol start="4"><li> bibliothèques d&#39;oligonucléotides peuvent être obtenus à partir d&#39;une installation de fournisseur commercial ou noyau, ou généré en utilisant un synthétiseur d&#39;oligonucléotides programmable à base de puces à ADN, comme décrit par le fabricant. Remettre en suspension les produits MCO dans 100 ul de TE 0,1 tampon. </li><li> Exécuter les bibliothèques d&#39;oligonucléotides sur un TBE-urée à 10% gel de polyacrylamide dénaturant. Chargez environ 1 pmol par voie et colorer avec colorant fluorescent ADN simple brin sensible pour évaluer leur qualité (figure 2A). </li><li> Si une bande distincte correspondant à des oligonucleotides de longueur totale peut être visualisée (figure 2A, voies 1 et 2), l&#39;excision de la tranche de gel d&#39;acrylamide et on élue les oligonucléotides correspondant dans 100 ul de TE 0,1 pendant une nuit à température ambiante sous agitation. Sinon, passez à l&#39;aide du MCO suspension brut. </li><li> Amplifier et ajouter les queues Sfil à la banque d&#39;oligonucléotides en utilisant une émulsion PCR 9 </<html> sup&gt;. </li><li> Mettre en place 50 pl des mélanges réactionnels de PCR, comme décrit dans le tableau 2. Ensuite combiner avec 300 ul de mélange d&#39;huile et de tensioactif dans le Micellula Emulsion ADN et un kit de purification et vortex pendant 5 min à 4 ° C. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Réactif </td><td> 1x Volume (pi) </td></tr><tr><td> Herculase II Fusion DNA Polymerase </td><td> 0,5 </td></tr><tr><td> Reaction Buffer II 5x Herculase </td><td> 10 </td></tr><tr><td> dNTP (10 mM chacun) </td><td> 1,25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1,25 </td></tr><tr><td> MPRA_SfiI_F amorce (25 pM) </td><td> 0,25 </td></tr><tr><td> MPRA_SfiI_R amorce (25 pM) </td><td> 0,25 </td></tr><tr><td> MCO modèle (1-10 attomol) </td><td> varie </td></tr><tr><td> Eau sans nucléase </td><td> 50 </td></tr></tbody></table>ve_content »&gt; Tableau 2 PCR Emulsion mélange réactionnel (phase aqueuse). <ol start="9"><li> Utiliser la concentration qui donne le rendement maximal de produits d&#39;amplification sans l&#39;apparition d&#39;artefacts (voir la section 1.12). </li><li> Répartir l&#39;émulsion obtenue dans des tubes de PCR et effectuer 20 cycles de PCR (2 min à 95 ° C, 20 x [20 sec à 95 ° C, 20 sec à 55 ° C, 30 secondes à 72 ° C], 3 min à 95 ° C). </li><li> Piscine et casser l&#39;émulsion chaque réaction de PCR de 350 ul par addition de 1 ml d&#39;isobutanol et brièvement au vortex, puis purifier le produit d&#39;amplification en utilisant une colonne de purification d&#39;ADN. </li><li> Exécuter une partie aliquote sur un gel d&#39;agarose à 2% ou 4% pour vérifier l&#39;amplification sans artefact (figure 2B). </li></ol><img alt="Figure 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Figure 2: Préparation de bibliothèques de synthèse d&#39;oligonucléotides. A) </strong&gt; Trois bibliothèques de synthèse d&#39;oligonucléotides premières différentes (MCO) exécuté sur dénaturant 10% TBE-urée gels de polyacrylamide. Les bandes correspondant à des oligonucleotides de longueur totale (*) peuvent être visualisées et excisé à partir de banques 1 et 2 Bibliothèque 3 contient des contaminants qui interfèrent avec la purification PAGE. Si tel est le cas, passer directement à l&#39;amplification des produits de PCR. B) d&#39;amplification PCR émulsion ouverte et de la même banque d&#39;oligonucléotides sur un gel d&#39;agarose. Amplification par PCR des bibliothèques d&#39;oligonucléotides complexes crée souvent des produits chimères et autres objets qui peuvent apparaître comme des bandes supérieures et inférieures. PCR émulsion peut minimiser ces artefacts. 2. Construction Bibliothèque <ol><li> Préparer un squelette plasmidique linéarisé par digestion vecteur pMPRA1 avec Sfil à 50 ° C pendant 2 heures, sur un gel d&#39;agarose à 1%, l&#39;excision de la bande dorsale (dans ce cas, 2,5 kb) et la purifier en utilisant une colonne spin gel purification. </li><li> Résuméles produits de PCR en émulsion de l&#39;étape avec Sfil 1,4 à 50 ° C pendant 2 heures et on purifie en utilisant des colonnes de purification d&#39;ADN. </li><li> Pour ligaturer la bibliothèque promoteur balise dans le squelette du vecteur linéarisé, mettre en place des réactions contenant 100 ng de produit PCR digéré, 50 ng de linéarisé squelette du vecteur et l&#39;ADN ligase T4. Incuber pendant une nuit à 16 ° C et ensuite la chaleur à 65 ° C pendant 20 min pour inactiver la ligase. </li><li> Transformer E. coli avec la réaction de ligature. Afin de préserver la complexité bibliothèque, visent à obtenir au moins 10x plus ufc que il ya des combinaisons distinctes promoteur-tag dans la bibliothèque conçue. </li><li> Lorsque le nombre total d&#39;étiquettes est d&#39;environ 100 000, la cfu cible peut généralement être obtenue en effectuant des transformations parallèles par 6-8 bibliothèque. </li><li> Pour chaque transformation, mélanger 50 pi électrocompétent E. cellules de E. coli avec 2 pi de mélange de ligature sur la glace. Transformer par électroporation, récupérer les cellules dans 800 ul SOCmilieu par agitation à 37 ° C pendant 1 heure, et ensuite combiner les cellules des transformations parallèles. </li><li> Pour évaluer l&#39;efficacité de la transformation, l&#39;assiette des dilutions en série d&#39;un alinquot de cellules récupérées sur LB agar plaques avec 50-100 mg / ml de carbénicilline et incuber pendant la nuit à 37 ° C. Estimer cfu totale (ufc observé) x (facteur de dilution) x (V - v) / v, où V est le volume total de cellules récupérées et v est le volume de l&#39;aliquote prélevée pour les dilutions en série. </li><li> Dans le même temps, utiliser le reste des cellules récupérées à inoculer 200 ml de LB supplémenté avec 100 ug / ml de carbénicilline. Cultiver les cellules à 37 ° C pendant une nuit dans un incubateur à secousses, puis isoler l&#39;ADN de plasmide selon les procédures standard. </li><li> Digérer une aliquote de la bibliothèque de plasmide isolé avec Sfil à 50 ° C pendant 2 heures et sur ​​un gel d&#39;agarose à 1% pour confirmer la présence d&#39;inserts. </li><li> Linéariser la bibliothèque de plasmide par cUtting entre les variants de promoteurs et balises à l&#39;aide Kpnl et Xbal. Afin de maximiser l&#39;efficacité de la digestion, effectuer des digestions série: </li><li> Tout d&#39;abord, la digestion par Kpnl à 37 ° C pendant 1 heure et on purifie en utilisant des billes magnétiques. Deuxièmement, la digestion avec XbaI avec addition d&#39;une phosphatase alcaline de crevette U à 37 ° C pendant 2 heures, à la chaleur inactiver à 65 ° C pendant 5 min, puis à purifier en utilisant des billes magnétiques. </li><li> Exécuter une partie aliquote sur un gel d&#39;agarose à 1% afin de vérifier la linéarisation complète. Si plasmide non coupé est visible, le fragment linéarisé doit être purifié sur gel. </li><li> Pour générer une bibliothèque CARP approprié pour la transfection dans des cellules de mammifères, ligaturer un ORF avec Kpnl / Xbal extrémités compatibles avec le standard dans la bibliothèque intermédiaire linéarisé. </li><li> Pour préparer un luc2 ORF fragment compatible de pMPRAdonor1, digérer ce plasmide avec Kpnl et Xbal à 37 ° C pendant 1 heure et sur ​​un gel agarose à 1%. Exciser le fragment ORF (1,7 kb dans ce cas) et de purifier l&#39;aide d&#39;une colonne de gel de purification de spin. </li><li> Cloner le fragment ORF dans la bibliothèque intermédiaire linéarisé comme décrit dans les étapes 02.03 à 02.08. </li><li> Digérer une aliquote (correspondant à 1-2 pg) de la bibliothèque CARP avec Kpnl à 37 ° C pendant 1 heure et sur ​​un gel agarose à 1%. Si la bibliothèque digéré fonctionne comme une seule bande, passez à la section 3 Si bandes supplémentaires sont observés (correspondant typiquement à report des constructions intermédiaires), la bibliothèque peut être purifié comme suit: </li><li> Digérer 3-5 pg de la bibliothèque contaminés par Kpnl à 37 ° C pendant 1 heure et sur ​​un gel d&#39;agarose à 0,8% durant la nuit à 4 ° C. </li><li> L&#39;excision de la bande de bibliothèque appropriée, de purifier l&#39;ADN en utilisant une colonne de centrifugation de la purification sur gel et effectuer l&#39;auto-ligature à l&#39;aide de haute concentration de l&#39;ADN ligase de T4 à 37 ° C pendant 1 heure. Ensuite, répétez l&#39;isolement de l&#39;ADN de transformation et de bibliothèque finale telle que décrite à l&#39;étape 2.8. </li></ol> 3 Transfection, perturbation, et l&#39;ARN isolement <ol><li> Pour chaque transfection indépendante, la culture le nombre de cellules (tel que déterminé par la complexité de la bibliothèque CARP, voir Discussion) dans un milieu approprié. Par exemple, la culture des cellules HEK293T / 17 dans du DMEM supplémenté avec 10% de FBS et L-glutamine / pénicilline / streptomycine. cellules de culture pour au moins deux transfections indépendantes pour chaque bibliothèque et l&#39;état expérimental. </li><li> Transfecter les cellules cultivées avec des plasmides CARP. La méthode et les conditions de transfection doivent être optimisées pour chaque type de cellule. Pour chaque échantillon transfecté, de conserver une partie aliquote (50 à 100 ng) de l&#39;ADN plasmidique en tant que témoin apparié. </li><li> Par exemple, la transfection de 0,5 x 10 7 HEK293T / 17 cellules cultivées à ~ 50% de confluence dans une boîte de culture de 10 cm avec 10 ug d&#39;ADN de plasmide dans 1 ml d&#39;Opti-MEM I milieu sérique réduit en utilisant 30 ul de Lipofectamine LTX et 10 pi plus réactif. Retirer le mélange de transfection après 5 heures et permettre à l&#39;cellules à récupérer pendant 24-48 h. </li><li> Eventuellement, effectuer toute perturbation nécessaire pour activer des séquences régulatrices au contexte ou fonction du signal dans la bibliothèque conçue. </li><li> Récolter les cellules et isoler le poly (A) + ARNm en utilisant la norme d&#39;oligo (dT) cellulose ou des colonnes de billes en utilisant les instructions de leur fabricant. </li><li> S&#39;assurer que la capacité de liaison maximale des colonnes ou des billes dépasse pas la quantité totale de l&#39;ARNm attendu des cellules récoltées. Par exemple, le rendement attendu de la section 3.3 est d&#39;environ 0,5-2,5 mg ARNm. </li></ol> 4. Tag-Seq <ol><li> Pour éliminer le report de l&#39;ADN de vecteur à partir des lysats de cellules transfectées, traiter chaque échantillon d&#39;ARNm de 20 pi avec 1 pl Turbo DNase (2 U) et 2,3 pi de tampon 10x Turbo DNase à 37 ° C pendant 1 heure, ajouter 2,4 pi Turbo DNase inactivation réactif à RT pendant 5 minutes en mélangeant, centrifuger à 10 000 g pendant 90 secondes, puis transférer la solution dans un nouveau tube. </li><li> Vérifier<html> pureté en effectuant une PCR comme décrit dans la section 4.6 sur 60-100 ng de chaque échantillon d&#39;ARNm, et puis en exécutant les produits sur un gel d&#39;agarose. Si amplicons spécifiques sont visibles (0,25 kb si vous utilisez pMPRA1 avec luc2), colonne purifier l&#39;ARNm traité et puis répétez le traitement à la DNase. </li><li> Pour générer des bibliothèques de séquençage Tag-Seq, convertir reporter ARNm en ADNc et ajouter des cartes de séquençage par PCR. </li><li> Mise en place de l&#39;ARNm / RT mélanges d&#39;amorces tel que décrit dans le tableau 3. Incuber à 65 ° C pendant 5 min, puis placer sur la glace. En parallèle, mettre en place des réactions de synthèse d&#39;ADNc comme décrit dans le tableau 4. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Réactif </td><td> 1x Volume (pi) </td></tr><tr><td> échantillon d&#39;ARNm (400-700 ng total) </td><td> 8 </td></tr><tr><td> Oligo-0DT (50 M) </td><td> 1 </td></tr><tr><td> dNTP (10 mM chacun) </td><td> 1 </td></tr></tbody></table>ove_content »&gt; Tableau 3 ARN / transcription inverse mélange d&#39;amorces pour la synthèse de l&#39;ADNc. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Réactif </td><td> 1x Volume (pi) </td></tr><tr><td> 10x SuperScript RT Buffer III </td><td> 2 </td></tr><tr><td> MgCl 2 (25 mM) </td><td> 4 </td></tr><tr><td> TNT (0,1 M) </td><td> 2 </td></tr><tr><td> RNaseOut (40 U / pl) </td><td> 1 </td></tr><tr><td> SuperScript III (200 U / pl) </td><td> 1 </td></tr></tbody></table> Tableau 4 ADNc mélange réactionnel de synthèse. <ol start="5"><li> Mélanger délicatement ARNm / amorce RT mélange avec des mélanges de synthèse d&#39;ADNc. Incuber à 50 ° C pendant 50 min, 85 ° C pendant 5 min, puis placer sur la glace. Enfin, incuber avec 2 U de ribonucléase H à 37 ° C pendant 20 min. </li><li> Mettre en place des réactions de PCR comme décrit dans le tableau 5 avec 4-6 pimélange réactionnel d&#39;ADNc ou 50 ng plasmide rapporteur en tant que modèles. Puis, effectuer une amplification par PCR (95 ° C pendant 2 min, 26 x [95 ° C pendant 30 sec, 55 ° C pendant 30 sec, 72 ° C pendant 30 s], à 72 ° C pendant 3 min). </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Réactif </td><td> 1x Volume (pi) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> TagSeq_P1 amorce (25 pM) </td><td> 0,5 </td></tr><tr><td> TagSeq_P2 amorce (25 pM) </td><td> 0,5 </td></tr><tr><td> Modèle (ARNm, ADNc mélange ou de l&#39;ADN plasmidique) </td><td> varie </td></tr><tr><td> Eau sans nucléase </td><td> 50 </td></tr></tbody></table> Tableau 5 Tag-Seq mélange réactionnel de PCR. <ol start="7"><li> Exécuter les produits de PCR sur un gel d&#39;agarose à 2%, des bandes d&#39;accise correspondant à la bibliothèque amplicons Tag-Seq (0,25 kb si l&#39;aidepMPRA1 avec luc2) et purifier ces utilisant purification de gel des colonnes de centrifugation. </li><li> Piscine, dénaturer et séquencer les amplicons Tag-Seq purifiés directement avec un instrument de séquençage Illumina. </li><li> Filtre de faible qualité se lit en supprimant tout ce qui a) contenir un ou plusieurs position avec une qualité Phred marquer moins de 30 dans la balise séquence ou b) ne correspond pas exactement une étiquette conçue. Comptez le nombre de fois que chaque balise restante apparaît dans chaque bibliothèque. Normaliser les balises compte de TPM (balises par million d&#39;étiquettes en séquence), puis calculer le ratio de tag compte ARNm dérivés sur tag nombre de plasmides dérivés pour chaque paire de bibliothèques de séquençage. Si ont été liés à chaque variante de séquence multiples étiquettes différentes, utiliser leurs ratios médians pour l&#39;analyse en aval. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Les auteurs déclarent qu&#39;ils n&#39;ont aucun intérêt financier concurrents.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Essais Reporter massivement parallèles (CARP) permettent la mesure multiplexée des activités régulatrices de la transcription de milliers à des centaines de milliers de séquences d&#39;ADN 1-7. Dans leur application la plus courante, le multiplexage est réalisé par le couplage de chaque séquence d&#39;intérêt à un gène rapporteur synthétique qui contient une étiquette d&#39;identification de séquence en aval d&#39;un cadre de lecture ouvert (ORF, figure 1). Après la transfection, l&#39;isolement de l&#39;ARN et séquençage profond des extrémités 3 &#39;de la transcription de gènes rapporteurs, les activités relatives des séquences couplées peuvent être déduites de l&#39;abondance relative de leurs étiquettes d&#39;identification. <img alt="Figure 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> Figure 1: Vue d&#39;ensemble de CARP. Une bibliothèque de CARP constructions rapporteurs est construite en couplant par des séquences régulatrices putatives à synthèsedes gènes rapporteurs qui sont constitués d&#39;un &quot;inerte&quot; ORF (tels que la GFP ou la luciférase), suivie d&#39;une étiquette d&#39;identification de séquence. La bibliothèque est transfectée en masse dans une population de cellules cultivées et transcrit ARNm rapporteur est ensuite récupéré. Séquençage profonde est utilisée pour compter le nombre d&#39;occurrences de chaque étiquette parmi les ARNm rapporteurs et les plasmides transfectés. Le rapport de l&#39;ARNm qui compte plus de chiffres de plasmide peuvent être utilisées pour déduire l&#39;activité de la séquence régulatrice correspondante. Adapté avec la permission de Melnikov, et al 2. ARP peut être adapté à une grande variété de modèles expérimentaux, comprenant 1) la mutagenèse d&#39;ensemble d&#39;éléments régulateurs de gènes particuliers, 2) de balayage pour des éléments de régulation de nouveaux travers un locus d&#39;intérêt, 3) tester l&#39;effet de la variation génétique naturelle dans un ensemble de putatif promoteurs, des amplificateurs ou des silencieux, et 4) l&#39;ingénierie semi-rationnelle d&#39;éléments de régulation de synthèse. Libiblio- de variants de séquence peuvent être générés en utilisant une variété de méthodes, y compris la synthèse de la bibliothèque d&#39;oligonucléotides (MCO) sur puces programmables 2,3,6,7, l&#39;assemblage d&#39;oligonucléotides dégénérés, 1,4 ligature combinatoire 8 et fragmentation de l&#39;ADN génomique 5. Ce protocole décrit la construction d&#39;une bibliothèque de variants de promoteur en utilisant les vecteurs et OLS pMPRA1 et pMPRAdonor1 (Addgene ID 49349 et 49352, respectivement; http://www.addgene.org), la transfection transitoire de la bibliothèque dans des cellules de mammifère en culture et la quantification ultérieure des activités de promoteur par séquençage profond de leurs variables correspondantes (Tag-Seq). Les versions antérieures de ce protocole ont été utilisés dans la recherche présentée dans Melnikov et al. Nature Biotechnology 30, 271-277 (2012) et dans Kheradpour et al. Genome Research 23, 800-811 (2013).

<table border="0" cellpadding="0" cellspacing="0" width="954">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:359px;">Oligonucleotide library synthesis</td>
			<td style="width:201px;">Agilent, CustomArray or other OLS vendors</td>
			<td style="width:119px;">custom</td>
			<td style="width:275px;">If using OLS construction method</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">pMPRA1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49349</td>
			<td>MPRA plasmid backbone</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">pMPRAdonor1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49352</td>
			<td>luc2 ORF donor plasmid</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>OLS buffer</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">Novex TBE-Urea Gels, 10%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">EC6875BOX</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Novex TBA-Urea Sample Buffer</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">LC6876</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SYBR Gold Nucleic Acid Gel Stain</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">S-11494</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Micellula DNA Emulsion &#38; Purification Kit</td>
			<td style="width:201px;">EURx/CHIMERx</td>
			<td style="width:119px;">3600-01</td>
			<td>Library amplification by emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Herculase II Fusion DNA Polymerase</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600675</td>
			<td>Polymerase for emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SfiI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0123S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">KpnI-HF</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R3142S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">XbaI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0145S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">T4 DNA Ligase (2,000,000 units/ml)</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">M0202T</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">One Shot TOP10 Electrocomp E. coli</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">C4040-50</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">LB agar and liquid media with carbenicllin</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>Growth media for cloning</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels 1%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-01</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels, 2%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-02</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MinElute Gel Extraction Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">28604</td>
			<td>Library and backbone purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">EndoFree Plasmid Maxi Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">12362</td>
			<td>Library DNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Cell culture media</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Transfection reagents</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MicroPoly(A)Purist Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1919</td>
			<td>mRNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TURBO DNA-free Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1907</td>
			<td>Plasmid DNA removal</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SuperScript III First-Strand Synthesis System</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">18080-051</td>
			<td>cDNA synthesis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">PfuUltra II Hotstart PCR Master Mix</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600850</td>
			<td>Polymerase for Tag-Seq PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Primers (see text)</td>
			<td style="width:201px;">IDT</td>
			<td style="width:119px;">custom</td>
			<td>PAGE purify Tag-Seq primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:201px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

ARP facilite haute résolution, dissection quantitative de la relation séquence-activité des éléments régulateurs de la transcription. Une expérience réussie ARP donne habituellement des mesures hautement reproductibles pour la majorité des séquences de la bibliothèque transfectées (figure 3A). Si on observe une mauvaise reproductibilité (figure 3B), ce qui témoigne d&#39;une trop faible concentration des ARNm rapporteurs dans les échantillons d&#39;ARN récupérés, soit en raison de 1) une faible activité absolue parmi les séquences dosés, ou 2) la faible efficacité de transfection. La figure 4 montre un représentant &quot;l&#39;information empreinte&quot; générée par le dosage de 1,2 ~ 37 000 variantes aléatoires d&#39;une séquence de 145 pb en amont du gène de l&#39;interféron bêta humain dans des cellules HEK293 avec ou sans exposition au virus Sendai. La boîte TATA du promoteur et connu activateur proximale 10 peuvent être clairement identifiés en tant que riche en informations régions d&#39;une manière dépendante de virus. <img alt="Figure 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Figure 3 Tag-Seq reproductibilité. Diagrammes de dispersion montrant des exemples de données de la balise-Seq de deux transfections répétées indépendantes avec élevée (A) et bas (B) la reproductibilité. Le dernier graphique montre de nombreux points de aberrantes avec nombre élevé d&#39;ARNm dans une seule des deux répétitions. Ces objets indiquent généralement que les concentrations d&#39;ARNm rapporteurs étaient trop faibles pour une amplification PCR quantitative, que ce soit en raison de faibles activités absolues entre les constructions rapporteurs ou faibles efficacités de transfection. <img alt="Figure 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> La figure 4 de l&#39;empreinte de l&#39;information du site d&#39;initiation de la transcription interféron bêta humain et activateur proximale. </strong&gt; Environ 37.000 variantes aléatoires d&#39;une région de 145 nucléotides (nt) en amont du gène de l&#39;interféron bêta humain ont été analysés en utilisant ARP dans des cellules HEK293 avec (A) et sans (B) l&#39;exposition à des virus Sendai. Les barres bleues indiquent l&#39;information mutuelle entre la sortie du reporter et le nucléotide à chaque position. L&#39;activateur proximale et la boîte TATA ressortent comme les régions de forte teneur de l&#39;information lors d&#39;une infection virale.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Essais Reporter massivement parallèles dans des cellules de mammifères en culture

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.3K vues.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Vidéo: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Trypsinizing and Subculturing Mammalian Cells

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in cell death. The first step in subculturing is to detach cells from the surface of the primary culture vessel by trypsinization or mechanical means. The resultant cell suspension is then subdivided, or reseeded, into fresh cultures. Secondary cultures are checked for growth and fed periodically, and may be subsequently subcultured to produce tertiary cultures. The time between passaging of cells varies with the cell line and depends on the growth rate.

As cells reach confluency, they must be subcultured or passaged. This video will demonstrate a procedure for subculturing both adherent and suspension cells.

Trypsinisation et Repiquage des cellules de mammifères

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

Recherche

Biologie

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

EsiRNA MISSION pour le dépistage de l&#39;ARNi dans les cellules de mammifères

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

MISSION LentiPlex Pooled shRNA Library Screening in Mammalian Cells

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies.
There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids 1. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library.
The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes 2. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 108 TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification.
Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line 3, 4. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

Here we use a human LentiPlex pooled library and traditional sequencing methods to identify gene targets promoting cell survival. We demonstrate how to set up and deconvolute a LentiPlex screen and validate the results.

LentiPlex MISSION dépistage sur mélange d&#39;Bibliothèque shRNA dans les cellules de mammifères

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to ...

Analysis of Cell Cycle Position in Mammalian Cells

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of cell proliferation underlies the pathology of diseases like cancer. As such there is great need to be able to investigate cell proliferation and quantitate the proportion of cells in each phase of the cell cycle. It is also of vital importance to indistinguishably identify cells that are replicating their DNA within a larger population. Since a cell&prime;s decision to proliferate is made in the G1 phase immediately before initiating DNA synthesis and progressing through the rest of the cell cycle, detection of DNA synthesis at this stage allows for an unambiguous determination of the status of growth regulation in cell culture experiments.
DNA content in cells can be readily quantitated by flow cytometry of cells stained with propidium iodide, a fluorescent DNA intercalating dye. Similarly, active DNA synthesis can be quantitated by culturing cells in the presence of radioactive thymidine, harvesting the cells, and measuring the incorporation of radioactivity into an acid insoluble fraction. We have considerable expertise with cell cycle analysis and recommend a different approach. We Investigate cell proliferation using bromodeoxyuridine/fluorodeoxyuridine (abbreviated simply as BrdU) staining that detects the incorporation of these thymine analogs into recently synthesized DNA. Labeling and staining cells with BrdU, combined with total DNA staining by propidium iodide and analysis by flow cytometry1 offers the most accurate measure of cells in the various stages of the cell cycle. It is our preferred method because it combines the detection of active DNA synthesis, through antibody based staining of BrdU, with total DNA content from propidium iodide. This allows for the clear separation of cells in G1 from early S phase, or late S phase from G2/M. Furthermore, this approach can be utilized to investigate the effects of many different cell stimuli and pharmacologic agents on the regulation of progression through these different cell cycle phases.
In this report we describe methods for labeling and staining cultured cells, as well as their analysis by flow cytometry. We also include experimental examples of how this method can be used to measure the effects of growth inhibiting signals from cytokines such as TGF-&beta;1, and proliferative inhibitors such as the cyclin dependent kinase inhibitor, p27KIP1. We also include an alternate protocol that allows for the analysis of cell cycle position in a sub-population of cells within a larger culture5. In this case, we demonstrate how to detect a cell cycle arrest in cells transfected with the retinoblastoma gene even when greatly outnumbered by untransfected cells in the same culture. These examples illustrate the many ways that DNA staining and flow cytometry can be utilized and adapted to investigate fundamental questions of mammalian cell cycle control.

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol. We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

Analyse de la situation du cycle cellulaire dans les cellules de mammifères

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of ...

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum (ER). However, the visualization of these mRNAs can be challenging. This is especially true when only a fraction of the mRNA is ER-associated and their distribution to this organelle is obstructed by non-targeted (i.e. "free") transcripts. In order to monitor ER-associated mRNAs, we have developed a method in which cells are treated with a short exposure to a digitonin extraction solution that selectively permeabilizes the plasma membrane, and thus removes the cytoplasmic contents, while simultaneously maintaining the integrity of the ER. When this method is coupled with fluorescent in situ hybridization (FISH), one can clearly visualize ER-bound mRNAs by fluorescent microscopy. Using this protocol the degree of ER-association for either bulk poly(A) transcripts or specific mRNAs can be assessed and even quantified. In the process, one can use this assay to investigate the nature of mRNA-ER interactions.

Here we describe a method to visualize endoplasmic reticulum-associated mRNAs in mammalian tissue culture cells. This technique involves the selective permeabilization of the plasma membrane with digitonin to remove cytoplasmic contents followed by fluorescent in situ hybridization to detect either bulk poly(A) mRNA or specific transcripts.

Visualisation des ARNm localisés dans le réticulum endoplasmique des cellules de mammifères

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum ...

Chromosome Preparation From Cultured Cells

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as fluorescence in situ hybridization (FISH), this assay has the powerful ability to analyze individual cells for aberrations that involve gains or losses of portions of the genome&#160;and rearrangements involving one or more chromosomes. In humans, chromosome abnormalities occur in approximately 1 per 160 live births1,2, 60-80% of all miscarriages3,4, 10% of stillbirths2,5, 13% of individuals with congenital heart disease6, 3-6% of infertility cases2, and in many patients with developmental delay&#160;and birth defects7. Cytogenetic analysis of malignancy is routinely used by researchers and clinicians, as observations of clonal chromosomal abnormalities have been shown to have both diagnostic and prognostic significance8,9.&#160; Chromosome isolation is invaluable for gene therapy and stem cell research of organisms including nonhuman primates and rodents10-13.
Chromosomes can be isolated from cells of live tissues, including blood lymphocytes, skin fibroblasts, amniocytes, placenta, bone marrow, and tumor specimens. Chromosomes are analyzed at the metaphase stage of mitosis, when they are most condensed and therefore more clearly visible. The first step of the chromosome isolation technique involves the disruption of the spindle fibers by incubation with Colcemid, to prevent the cells from proceeding to the subsequent anaphase stage. The cells are then treated with a hypotonic solution and preserved in their swollen state with Carnoy&#39;s fixative. The cells are then dropped on to slides and can then be utilized for a variety of procedures. G-banding involves trypsin treatment followed by staining with Giemsa to create characteristic light and dark bands. The same procedure to isolate chromosomes can be used for the preparation of cells for procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY)14,15.

Chromosomes can be isolated from live cells such as lymphocytes or skin fibroblasts, and from organisms including humans or mice. These chromosome preparations can be further utilized for routine G-banding and molecular cytogenetic procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY).

Chromosome Préparation partir des cellules cultivées

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as ...

Viability Assays for Cells in Culture

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized viability assays are expensive in terms of equipment but can be faster and more objective than manual cell counts. The present report describes the use of three such viability assays. Two of these assays are infrared and one is luminescent. Both infrared assays rely on a 16&#160;bit Odyssey Imager. One infrared assay uses the DRAQ5 stain for nuclei combined with the Sapphire stain for cytosol and is visualized in the 700 nm channel. The other infrared assay, an In-Cell Western, uses antibodies against cytoskeletal proteins (&#945;-tubulin or microtubule associated protein 2) and labels them in the 800 nm channel. The third viability assay is a commonly used luminescent assay for ATP, but we use a quarter of the recommended volume to save on cost. These measurements are all linear and correlate with the number of cells plated, but vary in sensitivity. All three assays circumvent time-consuming microscopy and sample the entire well, thereby reducing sampling error. Finally, all of the assays can easily be completed within one day of the end of the experiment, allowing greater numbers of experiments to be performed within short timeframes. However, they all rely on the assumption that cell numbers remain in proportion to signal strength after treatments, an assumption that is sometimes not met, especially for cellular ATP. Furthermore, if cells increase or decrease in size after treatment, this might affect signal strength without affecting cell number. We conclude that all viability assays, including manual counts, suffer from a number of caveats, but that computerized viability assays are well worth the initial investment. Using all three assays together yields a comprehensive view of cellular structure and function.

Therapeutic compounds are often first examined in vitro with viability assays. Blind cell counts by a human observer can be highly sensitive to small changes in cell number but do not assess function. Computerized viability assays, as described here, can assess both structure and function in an objective manner.

Les analyses de viabilité de cellules en culture

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized ...

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Détecter des altérations génétiques somatiques dans des échantillons de tumeurs par Exon et le séquençage massivement parallèle

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Visualization of Endoplasmic Reticulum Subdomains in Cultured Cells

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and functions despite the intense interorganelle molecular traffic. The techniques described in this paper are powerful means of studying protein and lipid mobility and trafficking in vivo and in their physiological environment. Fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP) are widely used live-cell imaging techniques for studying intracellular trafficking through the exo-endocytic pathway, the continuity between organelles or subcompartments, the formation of protein complexes, and protein localization in lipid microdomains, all of which can be observed under physiological and pathological conditions. The limitations of these approaches are mainly due to the use of fluorescent fusion proteins, and their potential drawbacks include artifactual over-expression in cells and the possibility of differences in the folding and localization of tagged and native proteins. Finally, as the limit of resolution of optical microscopy (about 200 nm) does not allow investigation of the fine structure of the ER or the specific subcompartments that can originate in cells under stress (i.e. hypoxia, drug administration, the over-expression of transmembrane ER resident proteins) or under pathological conditions, we combine live-cell imaging of cultured transfected cells with ultrastructural analyses based on transmission electron microscopy.

We describe the imaging approaches we use to investigate the distribution and mobility of the transfected fluorescent proteins resident in the endoplasmic reticulum (ER) by means of the confocal imaging of living cells. We also ultrastructurally analyze the effect of their expression on the architecture of this subcellular compartment.

Visualisation de réticulum endoplasmique sous-domaines dans les cellules cultivées

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

siRNA contrôle pour la ubiquitine et les régulateurs du système ubiquitine-comme des voies biologiques dans des cellules de mammifères en culture

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...