Bu çalışma Ödülü Numarası R01HG006785 altında Ulusal Sağlık Enstitüleri Ulusal İnsan Genomu Araştırma Enstitüsü tarafından desteklenmiştir.

1. Dizi Tasarımı ve Sentezi <ol><li> Dizilerin tasarımı ve sentezi ile başlar MPRA düzenleyici aktivitesi için tahlil edilecek. PMPRA vektör serisi ile uyumluluk için, aşağıdaki şablonu kullanarak her sekansı tasarımı: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- etiketi -AGATCGGAAGAGCGTCG-3 var denenecek diziyi temsil eder ve etiketi bir veya daha tanımlayıcı etiketleri gösterir &#39;. </li><li> Iki değişken bölgeleri (var ve etiket) aralarında bir raportör gen fragmanının ligasyonu yönsel kolaylaştırmak için Kpnl (GGTACC) ve Xbal (TCTAGA) kısıtlama sitelerinin bir çift ile ayrılır. Buna ek olarak, iki ayrı Sfil (GGCCNNNNNGGCC) siteleri pMPRA omurgasına yönlü bağlanmasını sağlamak için, PCR ile eklenir. Bu değişken bölgeler restriksiyon siteleri ek kopyalarını içermemelidir. Gerekirse, bu sınırlama enzimlerinin bir veya daha fazla ikame edilmiş olabilir, Uzun ve yedek olarak 1) yakın bir DNA moleküllerinin uçları etkili kesme sağlar, ve 2) vektör dizisi dışında kesme. Ek ayrıntılar için Tartışma bakın. </li><li> Ticari bir satıcıdan Tablo 1&#39;de listelenen gerekli primerler elde edilir. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [index] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tablo 1. Primer dizileri. [Index] çoğullanmış dizileme için kullanılan bir 6 ila 8 nt endeksi diziyi temsil eder. Farklı endeksleri ile en az 8 TagSeq-P2 primerler edinin. TümPrimerlerin HPLC veya PAGE ile arındırılmalıdır. <ol start="4"><li> Oligonükleotid kütüphaneler ticari bir satıcıdan veya çekirdek tesisinden elde edilen, ya da üretici tarafından tarif edildiği gibi, bir programlanabilir mikro-dizi-bazlı oligonükleotit sentezleyici kullanılarak üretilebilir. 100 ul TE 0.1 tamponunda EKK ürünleri süspanse. </li><li> Denatüre edici poliakrilamid jel% 10 TBE-Üre üzerinde oligonükleotid kütüphaneleri çalıştırın. Kalite (Şekil 2A) değerlendirmek için ssDA duyarlı floresan boyası ile şeritli ve leke başına yaklaşık 1 pmol yükleyin. </li><li> Tam uzunlukta oligonükleotitlerin karşılık gelen ayrı bir bant görselleştirilebilir durumunda (Şekil 2A, kulvarlar 1 ve 2), karşılık gelen akrilamid jel dilim kesip ve çalkalama ile oda sıcaklığında gece boyunca 100 ul TE 0,1 oligonükleotitlere aynlır. Aksi takdirde, en küçük kareler ham süspansiyonu kullanılarak devam edin. </li><li> Yükseltmek ve PCR 9 emülsiyonu kullanılarak oligonükleotid kütüphaneye Sfil kuyrukları eklemek </<html> &gt; sup. </li><li> Tablo 2&#39;de tarif edildiği gibi 50 ul PCR reaksiyon karışımları ayarlayın. Daha sonra 4 ° C&#39;de 5 dakika boyunca 300 ul DNA, Micellula Emülsiyon yağ ve yüzey aktif madde karışımı ile saflaştırma kiti ve vorteks ile birleştirir. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Reaktif </td><td> 1x Hacmi (ul) </td></tr><tr><td> Herculase II Füzyon DNA Polimeraz </td><td> 0.5 </td></tr><tr><td> 5x Herculase II Reaksiyon Tamponu </td><td> 10 </td></tr><tr><td> dNTP (10 mM) </td><td> 1.25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1.25 </td></tr><tr><td> Astar MPRA_SfiI_F (25 uM) </td><td> 0.25 </td></tr><tr><td> Astar MPRA_SfiI_R (25 uM) </td><td> 0.25 </td></tr><tr><td> EKK şablonu (1-10 attomol) </td><td> değişir </td></tr><tr><td> Nükleazlar içermeyen su </td><td> 50 </td></tr></tbody></table>ve_content &quot;&gt; Tablo 2. Emülsiyon PCR reaksiyon karışımı (su fazı). <ol start="9"><li> Eser ortaya çıkmadan amplifikasyon ürünlerinin azami bir verim sağladığını konsantrasyonunu kullanarak (bölüm 1.12 bakınız). </li><li> PCR tüpleri içine koyun ve elde edilen emülsiyonun 95 ° C (2 dakika, 20 PCR döngüsünden yerine, 20 cm x [95 ° C&#39;de 20 saniye, 55 ° C, 72 ° C de 30 sn 20 sn], 95 ° C&#39;de 3 dakika ° C). </li><li> Havuz vorteks kısa bir süre 1 mi izobütanol ilave edilmesi ve her bir 350 ul emülsiyon PCR reaksiyonunu kırmak, ve daha sonra bir DNA arıtma kolonu kullanılarak amplifikasyon ürünün arıtılması ve. </li><li> Artifakt amplifikasyon (Şekil 2B) kontrol etmek için bir% 2 veya% 4 agaroz jel üzerinde bir kesir çalıştırın. </li></ol><img alt="Şekil 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Oligonükleotit sentezi kütüphanelerinin Şekil 2. hazırlanması a.) </strong&gt; Üç farklı ham oligonükleotid sentezi kütüphaneleri (EKK)% 10 TBE-Üre poliakrilamid jelleri üzerinde çalıştırın. Tam uzunlukta oligonükleotitlerin (*) karşılık gelen bantları görsel ve kütüphanelerden 1 den kesilmiş ve 2. Library 3 SAYFA arıtma müdahale kontaminatlar edilebilir. Bu durumda ise, bir agaroz jel üzerinde, aynı oligonükleotid kütüphane çalışmasının açık ve emülsiyon PCR amplifikasyonu PCR amplifikasyonu. Ürünler, b) doğrudan devam edin. Karmaşık oligonükleotid kütüphanelerin PCR sık kimerik ürünler ve daha yüksek ve daha düşük bantları gibi görünebilir diğer eserler oluşturur. Emülsiyon PCR, bu eserler en aza indirebilirsiniz. 2. Kütüphane İnşaatı <ol><li> , Bir% 1 agaroz jel üzerinde yapılmıştır, 2 saat için, 50 ° C de bir Sfil ile sindirilerek vektör pMPRA1 ile doğrusallaştırılmış plazmit omurga hazırlanması (Bu durumda, 2,5-kb olarak) bant kesip omurga ve bir jel saflaştırma spin-sütunu kullanarak arıtın. </li><li> Digest2 saat boyunca 50 ° C&#39;de bir Sfil ile adım 1.4 emülsiyon PCR ürünleri ve DNA saflaştırma kolonları kullanılarak saflaştırılması. </li><li> , Doğrusallaştırılmış vektör omurgasına promotör-etiketi kitaplığı birbirine bağlamak için sindirilmiş PCR ürünü, 100 ng, lineerize vektör omurgası ve T4 DNA ligazı ihtiva eden 50 ng tepkileri oluşturmuştur. 20 dakika ligazı inaktivasyonu için 65 ° C sıcaklıkta daha sonra ısı 16 ° C de bir gece inkübe ve. </li><li> E. Transform Ligasyon reaksiyonu E. coli ile. Kütüphane karmaşıklığı korumak için, tasarlanan kütüphanede farklı promotör-etiketi kombinasyonları vardır en az 10x daha cfu elde etmek hedefliyoruz. </li><li> Etiketler toplam sayısı yaklaşık 100,000 olduğunda, tipik haliyle, hedef CFU kütüphane başına 6-8 paralel dönüşümlerinin gerçekleştirilmesi suretiyle elde edilebilir. </li><li> Her bir dönüşüm, E. elektrouyumlu 50 ul birleştirme Buz üzerinde ligasyon karışımı 2 ul E. coli hücreleri. 800 ul SOC hücreleri elektroporasyon ile transforme kurtarmakParalel dönüşümler hücreleri birleştirir sonra 1 saat boyunca 37 ° C&#39;de çalkalanarak ve orta tarafından. </li><li> Transformasyon etkinliğini değerlendirmek için, 50-100 ug / ml karbenisilin LB agar plakaları üzerinde elde edilen hücreler bir alinquot kadar seri seyreltiler plaka ve gece boyunca 37 ° C&#39;de inkübe edin. / V V v ve elde edilen hücreler toplam hacmi olan seri seyreltiler için alınan kan hacmi olan - toplam CFU olarak (gözlenen cfu), x (seyreltme faktörü) x (v V) tahmin edilmesi. </li><li> Aynı zamanda, geri kalan hücrelerin 100 ug / ml karbenisilin ile desteklenmiş 200ml LB aşılamak için kullanılır. Çalkalamalı bir inkübatör içinde gece boyunca 37 ° C&#39;de hücrelerin büyümesine ve sonra standart yöntemler kullanılarak, plazmid DNA izole eder. </li><li> 2 saat boyunca 50 ° C&#39;de bir Sfil ile izole edilen plazmid kütüphanesinin bir kısım sindirimi ve insertlerin varlığı teyit etmek için bir% 1 agaroz jel üzerinde yapılmıştır. </li><li> C plazma kütüphanesi linearizeKpnl ve Xbal kullanarak promotör varyantları ve etiketleri arasında esme. Sindirim verimliliğini maksimize etmek için, seri sindirimler gerçekleştirin: </li><li> İlk olarak, 1 saat boyunca 37 ° C&#39;de Kpnl ile sindirmek ve manyetik boncuklar kullanılarak saflaştırılması. İkinci olarak, 2 saat boyunca 37 ° C &#39;de, 1 U karides alkalin fosfatazı ilavesiyle Xbal ile sindirilmesi, ısı 5 dakika boyunca 65 ° C&#39;de etkisiz hale ve daha sonra manyetik boncuklar kullanılarak saflaştırılması. </li><li> Tam doğrusallaştınlmasının kontrol etmek için bir% 1 agaroz jeli üzerinde bir kesir çalıştırın. Kesilmemiş plazmid görülebiliyorsa, doğrusallaştırılmış fragmanı jel arındırılmalıdır. </li><li> Memeli hücreleri içine transfeksiyonu için uygun bir MPRA kütüphanesi oluşturmak için, ara doğrusallaştırılmış kitaplığa Kpnl / Xbal uçları ile uyumlu bir bir ORF ligate. </li><li> PMPRAdonor1 uyumlu bir luc2 ORF fragmanını hazırlamak için, 1 saat boyunca 37 ° C&#39;de Kpnl ve Xbal ile sindirimi plasmid ve bir% 1 agaroz jel üzerinde yapılmıştır. ORF parçasını kesip (1.7 kBu durumda, b) ve bir jel saflaştırma spin kolon kullanılarak saflaştırılması. </li><li> 2,3-2,8 adımda tarif edildiği gibi doğrusallaştırılmış ara kitaplığa ORF parçası, klon. </li><li> 1 saat boyunca 37 ° C&#39;de Kpnl ile MPRA kütüphanenin (1-2 ug tekabül eden) bir tümbölen sindirmekte ve ürünleri bir% 1 agaroz jel üzerinde yapılmıştır. Sindirilmiş kütüphane tek bir bant olarak çalışıyorsa, ilave bantların (tipik olarak ara yapıların taşınmadan karşılık gelir), kütüphanesi aşağıdaki gibi bir daha antılabilir gözlenirse, Bölüm 3. edin: </li><li> 1 saat boyunca 37 ° C&#39;de Kpnl ile kirlenmiş kütüphanenin 3-5 ug sindirimi ve 4 ° C&#39;de gece boyunca,% 0.8 agaroz jel üzerinde yapılmıştır. </li><li> , Doğru kitaplığı grubu kesip çıkarmak jel saflaştırma spin kolon kullanılarak DNA&#39;nın arıtılması ve 1 saat boyunca 37 ° C &#39;de yüksek konsantrasyonlu T4 DNA ligazı kullanılarak kendi kendine bağlanmasını gerçekleştirmek. Adım 2.8 &#39;de açıklandığı gibi Sonra dönüşüm ve nihai kütüphane DNA izolasyonu tekrarlayın. </li></ol> 3. Transfection, Perturbasyon, ve RNA İzolasyonu <ol><li> Her bir bağımsız transfeksiyon, kültür, uygun bir ortam içindeki hücre istenilen sayıda (MPRA kütüphane karmaşıklığı ile tespit edildiği üzere, Tartışma) için. Örneğin DMEM kültür HEK293T / 17 hücreleri,% 10 FBS ve L-glutamin / penisilin / streptomisin ile takviye edilmiştir. Her bir kütüphaneden ve deneysel koşul için en azından iki bağımsız Transfeksiyonlar için kültür hücreleri. </li><li> MPRA plazmid ile kültürlenmiş hücrelerin transfekte. Transfeksiyon yöntemi ve koşulları, her hücre tipi için optimize edilmelidir. Her transfekte edilmiş bir örnek için, eşleştirilmiş bir kontrol olarak plazmid DNA bir kısım (50-100 ng) muhafaza eder. </li><li> Örneğin, 0.5 x 10 7 HEK293T / yetişen 17 hücrelerini transfekte etmek için 30 ul ul Lipofektamin LTX&#39;i ve 10 ul Plus tepkin maddesi kullanılarak İndirgenmiş Serum Ortamı 1 mi Opti-MEM içinde 10 ug plazmit DNA&#39;sı ile 10 cm&#39;lik bir kültür kabı içinde% 50 birleşir. 5 saat sonra transfeksiyon karışımı çıkarın ve sağlarhücreler 24-48 saat kurtarmak için. </li><li> İsteğe bağlı olarak, tasarlanan kütüphanede, bağlama veya sinyal bağımlı düzenleyici sekansları aktif hale getirmek için gerekli olan herhangi bir karışıklığa gerçekleştirin. </li><li> Hücreler hasat ve üreticinin talimatlarını kullanarak standart oligo (dT) selüloz sütunları veya boncuklar kullanılarak poli (A) + mRNA izole eder. </li><li> Sütun veya boncukların maksimum bağlama kapasitesi Toplanan hücrelerden mRNA beklenen toplam miktarını aşan emin olun. Örneğin, bölüm 3,3 beklenen verim yaklaşık 0,5-2,5 mikrogram mRNA. </li></ol> 4. Etiket-Sıra <ol><li> Transfekte edilmiş hücre lizatları vektör DNA taşınmasını ortadan kaldırmak için, önceki 2.4 ul turbo DNaz inaktivasyonu reaktifi, 1 saat boyunca 37 ° C &#39;de 1 ul Turbo DNaz (2 U) ve 2.3 ul 10x turbo DNaz tampon maddesi ile her biri 20 ul numune mRNA&#39;sı tedavi eklemek RT daha sonra 5 dakika karıştırma ile, 90 saniye boyunca 10,000 g&#39;da santrifüj ve bir tüpe olarak solüsyon. </li><li> Doğrulayın<html> bir agaroz jeli üzerinde ürün mRNA&#39;nın her numunenin 60-100 ng bölüm 4.6 de tarif edildiği gibi PCR yapılması, ve daha sonra çalıştırarak saflık. (Luc2 ile pMPRA1 kullanıyorsanız 0.25 kb) özel amplikonlar görünmüyorsa, sütun tedavi mRNA arındırmak ve ardından Dnaz tedaviyi tekrarlayın. </li><li> , Etiket-Dizi sıralama kütüphaneleri oluşturmak cDNA&#39;sına muhabiri mRNA dönüştürmek ve PCR ile dizileme bağdaştırıcısı eklemek. </li><li> Tablo 3&#39;te tarif edilen mRNA / RT primer karışımları ayarlayın. Sonra buz üzerine yerleştirin, 5 dakika boyunca 65 ° C&#39;de inkübe edilir. Tablo 4&#39;te tarif edildiği gibi paralel olarak, cDNA sentez reaksiyonları ayarlayın. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reaktif </td><td> 1x Hacmi (ul) </td></tr><tr><td> mRNA numunesi (400-700 ng toplam) </td><td> 8 </td></tr><tr><td> Oligo 0DT (50 uM) </td><td> 1 </td></tr><tr><td> dNTP (10 mM) </td><td> 1 </td></tr></tbody></table>cDNA sentezi için ove_content &quot;&gt; Tablo 3. RNA / Ters transkripsiyon primer karışımını içerir. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reaktif </td><td> 1x Hacmi (ul) </td></tr><tr><td> 10x SuperScriptTM III RT Tampon </td><td> 2 </td></tr><tr><td> MgCI2 (25mM) </td><td> 4 </td></tr><tr><td> DTT (0.1 M) </td><td> 2 </td></tr><tr><td> RNaseOut (40 U / ml) </td><td> 1 </td></tr><tr><td> Üst Simge III (200 U / ml) </td><td> 1 </td></tr></tbody></table> Tablo 4. cDNA sentez reaksiyon karışımı. <ol start="5"><li> Yavaşça mRNA / RT primer cDNA sentezi karışımları ile karışır birleştirir. 50 dakika sonra, 5 dakika boyunca 85 ° C boyunca 50 ° C&#39;de inkübe edilir ve daha sonra buz üzerine yerleştirin. Son olarak, 20 dakika boyunca, 37 ° C&#39;de 2 U ribonükleaz H kuluçkalayın. </li><li> 4-6 ul, Tablo 5&#39;te tarif edildiği gibi PCR reaksiyonları ayarlamaReaksiyon karışımı, bir cDNA ya da şablon olarak 50 ng raportör plazmid. Daha sonra PCR amplifikasyonu (2 dakika boyunca 95 ° C, 26 x [30 saniye için 95 ° C, 30 sn için 30 saniye boyunca 55 ° C, 72 ° C], 3 dakika boyunca 72 ° C) gerçekleştirir. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reaktif </td><td> 1x Hacmi (ul) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> Astar TagSeq_P1 (25 uM) </td><td> 0.5 </td></tr><tr><td> Astar TagSeq_P2 (25 uM) </td><td> 0.5 </td></tr><tr><td> Şablon (mRNA, cDNA ya da plazmid DNA karışımı) </td><td> değişir </td></tr><tr><td> Nükleazlar içermeyen su </td><td> 50 </td></tr></tbody></table> Tablo 5. Etiket-Dizi PCR reaksiyon karışımı. <ol start="7"><li> % 2 agaroz jeli içinden PCR ürünlerini çalıştırın Etiket-Seq kütüphane karşılık gelen amplikonun tüketim bantları (0.25 kb kullanılıyorsaluc2 ile pMPRA1) ve bu kullanılarak jel saflaştırma spin sütunları arındırmak. </li><li> Yüzme havuzu, denatüre ve Illumina sıralama alet ile direkt olarak saflaştırılmış Etiket-Dizi amplikonları sırası. </li><li> Filtre düşük kaliteli sıralı etiketi içinde daha az 30 puan veya b) tam bir dizayn etiketi eşleşmiyor bir Phred kalitesi ile bir veya daha fazla pozisyon içeren) tüm a kaldırarak okur. Kalan her etiketi, her kütüphanede görünür sayısını sayın. TPM (milyon başına dizilenmiştir etiketleri etiketler) etiket sayısını normalize ve dizileme kütüphanelerinin her çifti için plasmid türevli etiket sayısı fazla mRNA, türetilmiş etiket sayımı oranı hesaplanır. Birden fazla farklı etiketler, her sekans varyantının bağlantılı olsaydı, alt analizi için medyan oranlarını kullanın. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Yazarlar hiçbir rakip mali çıkarlarının olmadığını beyan ederim.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Büyük ölçekte paralel Raportör Tahliller (MPRA) DNA dizilerinin 1- 7 yüz binlerce binlerce transkripsiyonel düzenleyici faaliyetlerinin birden fazla mesaj göndermiş ölçümüne izin verir. En genel bir uygulamasında, çoklayıcı bir açık okuma çerçevesinin alt tanıtıcı bir dizi etiketi içeren bir sentetik raportör gene, ilgilenilen her sekansı birleştirilmesi ile elde edilir (ORF, Şekil 1). Transfeksiyon, RNA izolasyonu ve raportör gen transkriptlerinin 3 &#39;uçları arasında derin dizilemesi sonra, birleştirilen dizilerin relatif aktiviteleri, bunların belirlenmesi etiketlerin görece bolluğu sonucu çıkarılabilir. <img alt="Şekil 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> MPRA Şekil 1. Genel Bakış. MPRA raportör bir kütüphane sentetik varsayımsal düzenleme sekansları şekilde birleştirilmesi yoluyla yapılandırılır konstruktlarıtanımlayıcı bir dizi etiketi ve ardından (örneğin, lusiferaz, GFP ve gibi) bir &quot;etkisiz&quot; ORF oluşmaktadır raportör genler. Kütüphane kültürlenmiş hücrelerin bir popülasyonunun içine transfekte edilir topluca ve kopyalandığı raportör mRNA, daha sonra elde edilir. Derin sıralama muhabiri mRNAların ve nakledilen plazmidlerden arasında her etiket yineleme sayısını saymak için kullanılır. Plazmid sayısı ilgili düzenleyici dizi aktivitesini belirlemek için de kullanılabilir fazla mRNA oranı sayar. Melnikov izni ile uyarlanmıştır, ve ark 2. MPRA ilgi konusu bir lokus üzerinde yeni bir düzenleyici elemanlar için tek tek gen düzenleme elemanlarının 1) geniş mutajenezi, 2) tarama dahil olmak üzere deney tasarımları çeşitli adapte edilebilir, 3) farazi bir dizi doğal genetik farklılaşmasının etkisinin test edilmesi uyarıcının veya susturucular ve sentetik düzenleyici elemanlar 4) yarı-rasyonel mühendislik. Lidizi varyantlarının braries dejenere oligonükleotidler 1,4, birleştirici ligasyon 8 ve genomik DNA 5 parçalanma oligonükleotid mikrodiziler kütüphane programlanabilir 2,3,6,7 üzerinde sentezi (en küçük kareler), montaj dahil olmak üzere çeşitli yöntemler kullanılarak elde edilebilir. Bu protokol, promotör bir kütüphanesinin yapımını da tarif eder varyantlarının en küçük kareler ve pMPRA1 ve pMPRAdonor1 vektörleri (sırasıyla Addgene kimlikleri 49349 ve 49352; http://www.addgene.org) kullanılarak kültürlenmiş memeli hücrelerine ve daha sonra kantitatif olarak bu kütüphanenin geçici transfeksiyon ilişkili etiketleri derin sıralama (Etiket-Dizi) tarafından promotör faaliyetleri. Bu protokolün önceki sürümleri (2013) Araştırma 23, 800-811 Melnikov ve ark. Nature Biotechnology 30, 271-277 (2012) ve Kheradpour ve ark. Genome bildirilen araştırmada kullanılmıştır.

<table border="0" cellpadding="0" cellspacing="0" width="954">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:359px;">Oligonucleotide library synthesis</td>
			<td style="width:201px;">Agilent, CustomArray or other OLS vendors</td>
			<td style="width:119px;">custom</td>
			<td style="width:275px;">If using OLS construction method</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">pMPRA1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49349</td>
			<td>MPRA plasmid backbone</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">pMPRAdonor1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49352</td>
			<td>luc2 ORF donor plasmid</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>OLS buffer</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">Novex TBE-Urea Gels, 10%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">EC6875BOX</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Novex TBA-Urea Sample Buffer</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">LC6876</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SYBR Gold Nucleic Acid Gel Stain</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">S-11494</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Micellula DNA Emulsion &#38; Purification Kit</td>
			<td style="width:201px;">EURx/CHIMERx</td>
			<td style="width:119px;">3600-01</td>
			<td>Library amplification by emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Herculase II Fusion DNA Polymerase</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600675</td>
			<td>Polymerase for emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SfiI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0123S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">KpnI-HF</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R3142S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">XbaI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0145S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">T4 DNA Ligase (2,000,000 units/ml)</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">M0202T</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">One Shot TOP10 Electrocomp E. coli</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">C4040-50</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">LB agar and liquid media with carbenicllin</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>Growth media for cloning</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels 1%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-01</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels, 2%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-02</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MinElute Gel Extraction Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">28604</td>
			<td>Library and backbone purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">EndoFree Plasmid Maxi Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">12362</td>
			<td>Library DNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Cell culture media</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Transfection reagents</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MicroPoly(A)Purist Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1919</td>
			<td>mRNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TURBO DNA-free Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1907</td>
			<td>Plasmid DNA removal</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SuperScript III First-Strand Synthesis System</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">18080-051</td>
			<td>cDNA synthesis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">PfuUltra II Hotstart PCR Master Mix</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600850</td>
			<td>Polymerase for Tag-Seq PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Primers (see text)</td>
			<td style="width:201px;">IDT</td>
			<td style="width:119px;">custom</td>
			<td>PAGE purify Tag-Seq primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:201px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA yüksek çözünürlüklü, transkripsiyonel düzenleyici elemanlarının dizi-etki ilişkileri kantitatif diseksiyon kolaylaştırır. Başarılı bir MPRA deney tipik olarak transfekte kitaplığı (Şekil 3A) dizilerin çoğunluğu için yüksek ölçüde tekrarlanabilir ölçümleri sağlayacaktır. Zayıf tekrarlanabilirlik (Şekil 3B) gözlenirse, bu durum, test dizileri arasında 1) düşük bir mutlak aktivitesi, ya da 2) düşük transfeksiyon verimi birine, geri kazanılan RNA örnekleri raportör mRNA, çok düşük bir konsantrasyonda bir göstergesidir. Şekil 4, analiz etmek sureti ile üretilen bir temsili &quot;bilgi izi&quot; 1,2 gösterir ~ ya da Sendai virüsü maruz kalmadan HEK293 hücrelerinde insan IFNB geninin üst akışında bir 145 bp dizisinin rastgele 37000 varyantları. Promotör TATA-kutu ve bilinen yakın güçlendirici 10 açık bilgi açısından zengin Regi olarak tanımlanabilirbir virüs-bağlı bir şekilde ortaya koymuşlardır. <img alt="Şekil 3," src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Şekil 3. Etiket-Dizi tekrarlanabilirlik. Yüksek (A) ve düşük (B) tekrarlanabilirlik ile iki bağımsız çoğaltmak transfeksiyonlann Etiket-Sıra verilerden örnekler gösteren Dağılım araziler. İkincisi arsa iki çoğaltır sadece birinde yüksek mRNA sayıları ile birçok Aykırı etiketleri gösterir. Bu tür yapılar, tipik olarak, raportör mRNA&#39;ların konsantrasyonu nedeniyle raportör yapılan arasında düşük mutlak aktiviteler, veya düşük transfeksiyon verimi için, ya da kantitatif PCR amplifikasyonu için çok düşük olduğunu göstermektedir. <img alt="Şekil 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> Insan IFNB transkripsiyon başlama alanı ile yakın arttırıcının Şekil 4. bilgi izi. </strzun&gt; yukan insan IFNB geninin bir 145 nükleotid (nt) bölgesi yaklaşık 37,000 rastgele varyantları, (A) ve Sendai virüsü (B) maruz kalmayan HEK293 hücrelerinde MPRA kullanılarak tahlil edilmiştir. Mavi çubuk her pozisyondaki raportör çıkışı ile nükleotid arasındaki karşılıklı bilgileri gösterir. Proksimal arttırıcı ve TATA kutusu viral enfeksiyon üzerinde yüksek bilgi içeriği bölgeleri olarak öne çıkıyor.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Kültürlenmiş memeli hücrelerinde büyük çapta paralel Raportör Tahliller

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.4K Görüntüleme.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Video: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Trypsinizing and Subculturing Mammalian Cells

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in cell death. The first step in subculturing is to detach cells from the surface of the primary culture vessel by trypsinization or mechanical means. The resultant cell suspension is then subdivided, or reseeded, into fresh cultures. Secondary cultures are checked for growth and fed periodically, and may be subsequently subcultured to produce tertiary cultures. The time between passaging of cells varies with the cell line and depends on the growth rate.

As cells reach confluency, they must be subcultured or passaged. This video will demonstrate a procedure for subculturing both adherent and suspension cells.

Memeli Hücreleri Trypsinizing ve alt kültüre

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

Biyoloji

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

Memeli Hücreleri RNAi Tarama MİSYON esiRNA

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

MISSION LentiPlex Pooled shRNA Library Screening in Mammalian Cells

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies.
There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids 1. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library.
The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes 2. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 108 TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification.
Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line 3, 4. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

Here we use a human LentiPlex pooled library and traditional sequencing methods to identify gene targets promoting cell survival. We demonstrate how to set up and deconvolute a LentiPlex screen and validate the results.

MİSYON LentiPlex Memeli Hücreleri shRNA Kütüphane Tarama Pooled

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to ...

Analysis of Cell Cycle Position in Mammalian Cells

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of cell proliferation underlies the pathology of diseases like cancer. As such there is great need to be able to investigate cell proliferation and quantitate the proportion of cells in each phase of the cell cycle. It is also of vital importance to indistinguishably identify cells that are replicating their DNA within a larger population. Since a cell&prime;s decision to proliferate is made in the G1 phase immediately before initiating DNA synthesis and progressing through the rest of the cell cycle, detection of DNA synthesis at this stage allows for an unambiguous determination of the status of growth regulation in cell culture experiments.
DNA content in cells can be readily quantitated by flow cytometry of cells stained with propidium iodide, a fluorescent DNA intercalating dye. Similarly, active DNA synthesis can be quantitated by culturing cells in the presence of radioactive thymidine, harvesting the cells, and measuring the incorporation of radioactivity into an acid insoluble fraction. We have considerable expertise with cell cycle analysis and recommend a different approach. We Investigate cell proliferation using bromodeoxyuridine/fluorodeoxyuridine (abbreviated simply as BrdU) staining that detects the incorporation of these thymine analogs into recently synthesized DNA. Labeling and staining cells with BrdU, combined with total DNA staining by propidium iodide and analysis by flow cytometry1 offers the most accurate measure of cells in the various stages of the cell cycle. It is our preferred method because it combines the detection of active DNA synthesis, through antibody based staining of BrdU, with total DNA content from propidium iodide. This allows for the clear separation of cells in G1 from early S phase, or late S phase from G2/M. Furthermore, this approach can be utilized to investigate the effects of many different cell stimuli and pharmacologic agents on the regulation of progression through these different cell cycle phases.
In this report we describe methods for labeling and staining cultured cells, as well as their analysis by flow cytometry. We also include experimental examples of how this method can be used to measure the effects of growth inhibiting signals from cytokines such as TGF-&beta;1, and proliferative inhibitors such as the cyclin dependent kinase inhibitor, p27KIP1. We also include an alternate protocol that allows for the analysis of cell cycle position in a sub-population of cells within a larger culture5. In this case, we demonstrate how to detect a cell cycle arrest in cells transfected with the retinoblastoma gene even when greatly outnumbered by untransfected cells in the same culture. These examples illustrate the many ways that DNA staining and flow cytometry can be utilized and adapted to investigate fundamental questions of mammalian cell cycle control.

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol. We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

Memeli Hücreler, Hücre Döngüsü Pozisyon Analizi

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of ...

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum (ER). However, the visualization of these mRNAs can be challenging. This is especially true when only a fraction of the mRNA is ER-associated and their distribution to this organelle is obstructed by non-targeted (i.e. "free") transcripts. In order to monitor ER-associated mRNAs, we have developed a method in which cells are treated with a short exposure to a digitonin extraction solution that selectively permeabilizes the plasma membrane, and thus removes the cytoplasmic contents, while simultaneously maintaining the integrity of the ER. When this method is coupled with fluorescent in situ hybridization (FISH), one can clearly visualize ER-bound mRNAs by fluorescent microscopy. Using this protocol the degree of ER-association for either bulk poly(A) transcripts or specific mRNAs can be assessed and even quantified. In the process, one can use this assay to investigate the nature of mRNA-ER interactions.

Here we describe a method to visualize endoplasmic reticulum-associated mRNAs in mammalian tissue culture cells. This technique involves the selective permeabilization of the plasma membrane with digitonin to remove cytoplasmic contents followed by fluorescent in situ hybridization to detect either bulk poly(A) mRNA or specific transcripts.

Memeli hücrelerinde endoplazmik retikulum lokalize mRNA&#39;ların görselleştirilmesi

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum ...

Chromosome Preparation From Cultured Cells

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as fluorescence in situ hybridization (FISH), this assay has the powerful ability to analyze individual cells for aberrations that involve gains or losses of portions of the genome&#160;and rearrangements involving one or more chromosomes. In humans, chromosome abnormalities occur in approximately 1 per 160 live births1,2, 60-80% of all miscarriages3,4, 10% of stillbirths2,5, 13% of individuals with congenital heart disease6, 3-6% of infertility cases2, and in many patients with developmental delay&#160;and birth defects7. Cytogenetic analysis of malignancy is routinely used by researchers and clinicians, as observations of clonal chromosomal abnormalities have been shown to have both diagnostic and prognostic significance8,9.&#160; Chromosome isolation is invaluable for gene therapy and stem cell research of organisms including nonhuman primates and rodents10-13.
Chromosomes can be isolated from cells of live tissues, including blood lymphocytes, skin fibroblasts, amniocytes, placenta, bone marrow, and tumor specimens. Chromosomes are analyzed at the metaphase stage of mitosis, when they are most condensed and therefore more clearly visible. The first step of the chromosome isolation technique involves the disruption of the spindle fibers by incubation with Colcemid, to prevent the cells from proceeding to the subsequent anaphase stage. The cells are then treated with a hypotonic solution and preserved in their swollen state with Carnoy&#39;s fixative. The cells are then dropped on to slides and can then be utilized for a variety of procedures. G-banding involves trypsin treatment followed by staining with Giemsa to create characteristic light and dark bands. The same procedure to isolate chromosomes can be used for the preparation of cells for procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY)14,15.

Chromosomes can be isolated from live cells such as lymphocytes or skin fibroblasts, and from organisms including humans or mice. These chromosome preparations can be further utilized for routine G-banding and molecular cytogenetic procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY).

Kültür Hücrelerinin itibaren Kromozom Hazırlık

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as ...

Viability Assays for Cells in Culture

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized viability assays are expensive in terms of equipment but can be faster and more objective than manual cell counts. The present report describes the use of three such viability assays. Two of these assays are infrared and one is luminescent. Both infrared assays rely on a 16&#160;bit Odyssey Imager. One infrared assay uses the DRAQ5 stain for nuclei combined with the Sapphire stain for cytosol and is visualized in the 700 nm channel. The other infrared assay, an In-Cell Western, uses antibodies against cytoskeletal proteins (&#945;-tubulin or microtubule associated protein 2) and labels them in the 800 nm channel. The third viability assay is a commonly used luminescent assay for ATP, but we use a quarter of the recommended volume to save on cost. These measurements are all linear and correlate with the number of cells plated, but vary in sensitivity. All three assays circumvent time-consuming microscopy and sample the entire well, thereby reducing sampling error. Finally, all of the assays can easily be completed within one day of the end of the experiment, allowing greater numbers of experiments to be performed within short timeframes. However, they all rely on the assumption that cell numbers remain in proportion to signal strength after treatments, an assumption that is sometimes not met, especially for cellular ATP. Furthermore, if cells increase or decrease in size after treatment, this might affect signal strength without affecting cell number. We conclude that all viability assays, including manual counts, suffer from a number of caveats, but that computerized viability assays are well worth the initial investment. Using all three assays together yields a comprehensive view of cellular structure and function.

Therapeutic compounds are often first examined in vitro with viability assays. Blind cell counts by a human observer can be highly sensitive to small changes in cell number but do not assess function. Computerized viability assays, as described here, can assess both structure and function in an objective manner.

Kültür hücreleri için Canlılık Tahliller

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized ...

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Ekson yakalama ve Devasa Paralel Dizilimine tarafından Tümör Örneklerinin somatik genetik değişiklikler tespit

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Visualization of Endoplasmic Reticulum Subdomains in Cultured Cells

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and functions despite the intense interorganelle molecular traffic. The techniques described in this paper are powerful means of studying protein and lipid mobility and trafficking in vivo and in their physiological environment. Fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP) are widely used live-cell imaging techniques for studying intracellular trafficking through the exo-endocytic pathway, the continuity between organelles or subcompartments, the formation of protein complexes, and protein localization in lipid microdomains, all of which can be observed under physiological and pathological conditions. The limitations of these approaches are mainly due to the use of fluorescent fusion proteins, and their potential drawbacks include artifactual over-expression in cells and the possibility of differences in the folding and localization of tagged and native proteins. Finally, as the limit of resolution of optical microscopy (about 200 nm) does not allow investigation of the fine structure of the ER or the specific subcompartments that can originate in cells under stress (i.e. hypoxia, drug administration, the over-expression of transmembrane ER resident proteins) or under pathological conditions, we combine live-cell imaging of cultured transfected cells with ultrastructural analyses based on transmission electron microscopy.

We describe the imaging approaches we use to investigate the distribution and mobility of the transfected fluorescent proteins resident in the endoplasmic reticulum (ER) by means of the confocal imaging of living cells. We also ultrastructurally analyze the effect of their expression on the architecture of this subcellular compartment.

Kültür Hücrelerinin retikulum Subdomain&#39;ler Görselleştirme

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Kültür Memeli Hücrelerde Biyolojik tanımında ubikitin ve Ubiquitin benzeri Sistemi Regülatörleri tanımak siRNA Eleme

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...