Name: massively parallel reporter assays in cultured mammalian cells
Uploaded: 2014-08-17T16:00:00.000+00:00
Duration: 11 min 3 s
Description: Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Bu çalışma Ödülü Numarası R01HG006785 altında Ulusal Sağlık Enstitüleri Ulusal İnsan Genomu Araştırma Enstitüsü tarafından desteklenmiştir.

1. Dizi Tasarımı ve Sentezi <ol><li> Dizilerin tasarımı ve sentezi ile başlar MPRA düzenleyici aktivitesi için tahlil edilecek. PMPRA vektör serisi ile uyumluluk için, aşağıdaki şablonu kullanarak her sekansı tasarımı: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- etiketi -AGATCGGAAGAGCGTCG-3 var denenecek diziyi temsil eder ve etiketi bir veya daha tanımlayıcı etiketleri gösterir &#39;. </li><li> Iki değişken bölgeleri (var ve etiket) aralarında bir raportör gen fragmanının ligasyonu yönsel kolaylaştırmak için Kpnl (GGTACC) ve Xbal (TCTAGA) kısıtlama sitelerinin bir çift ile ayrılır. Buna ek olarak, iki ayrı Sfil (GGCCNNNNNGGCC) siteleri pMPRA omurgasına yönlü bağlanmasını sağlamak için, PCR ile eklenir. Bu değişken bölgeler restriksiyon siteleri ek kopyalarını içermemelidir. Gerekirse, bu sınırlama enzimlerinin bir veya daha fazla ikame edilmiş olabilir, Uzun ve yedek olarak 1) yakın bir DNA moleküllerinin uçları etkili kesme sağlar, ve 2) vektör dizisi dışında kesme. Ek ayrıntılar için Tartışma bakın. </li><li> Ticari bir satıcıdan Tablo 1&#39;de listelenen gerekli primerler elde edilir. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [index] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tablo 1. Primer dizileri. [Index] çoğullanmış dizileme için kullanılan bir 6 ila 8 nt endeksi diziyi temsil eder. Farklı endeksleri ile en az 8 TagSeq-P2 primerler edinin. TümPrimerlerin HPLC veya PAGE ile arındırılmalıdır. <ol start="4"><li> Oligonükleotid kütüphaneler ticari bir satıcıdan veya çekirdek tesisinden elde edilen, ya da üretici tarafından tarif edildiği gibi, bir programlanabilir mikro-dizi-bazlı oligonükleotit sentezleyici kullanılarak üretilebilir. 100 ul TE 0.1 tamponunda EKK ürünleri süspanse. </li><li> Denatüre edici poliakrilamid jel% 10 TBE-Üre üzerinde oligonükleotid kütüphaneleri çalıştırın. Kalite (Şekil 2A) değerlendirmek için ssDA duyarlı floresan boyası ile şeritli ve leke başına yaklaşık 1 pmol yükleyin. </li><li> Tam uzunlukta oligonükleotitlerin karşılık gelen ayrı bir bant görselleştirilebilir durumunda (Şekil 2A, kulvarlar 1 ve 2), karşılık gelen akrilamid jel dilim kesip ve çalkalama ile oda sıcaklığında gece boyunca 100 ul TE 0,1 oligonükleotitlere aynlır. Aksi takdirde, en küçük kareler ham süspansiyonu kullanılarak devam edin. </li><li> Yükseltmek ve PCR 9 emülsiyonu kullanılarak oligonükleotid kütüphaneye Sfil kuyrukları eklemek </<html> &gt; sup. </li><li> Tablo 2&#39;de tarif edildiği gibi 50 ul PCR reaksiyon karışımları ayarlayın. Daha sonra 4 ° C&#39;de 5 dakika boyunca 300 ul DNA, Micellula Emülsiyon yağ ve yüzey aktif madde karışımı ile saflaştırma kiti ve vorteks ile birleştirir. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Reaktif </td><td> 1x Hacmi (ul) </td></tr><tr><td> Herculase II Füzyon DNA Polimeraz </td><td> 0.5 </td></tr><tr><td> 5x Herculase II Reaksiyon Tamponu </td><td> 10 </td></tr><tr><td> dNTP (10 mM) </td><td> 1.25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1.25 </td></tr><tr><td> Astar MPRA_SfiI_F (25 uM) </td><td> 0.25 </td></tr><tr><td> Astar MPRA_SfiI_R (25 uM) </td><td> 0.25 </td></tr><tr><td> EKK şablonu (1-10 attomol) </td><td> değişir </td></tr><tr><td> Nükleazlar içermeyen su </td><td> 50 </td></tr></tbody></table>ve_content &quot;&gt; Tablo 2. Emülsiyon PCR reaksiyon karışımı (su fazı). <ol start="9"><li> Eser ortaya çıkmadan amplifikasyon ürünlerinin azami bir verim sağladığını konsantrasyonunu kullanarak (bölüm 1.12 bakınız). </li><li> PCR tüpleri içine koyun ve elde edilen emülsiyonun 95 ° C (2 dakika, 20 PCR döngüsünden yerine, 20 cm x [95 ° C&#39;de 20 saniye, 55 ° C, 72 ° C de 30 sn 20 sn], 95 ° C&#39;de 3 dakika ° C). </li><li> Havuz vorteks kısa bir süre 1 mi izobütanol ilave edilmesi ve her bir 350 ul emülsiyon PCR reaksiyonunu kırmak, ve daha sonra bir DNA arıtma kolonu kullanılarak amplifikasyon ürünün arıtılması ve. </li><li> Artifakt amplifikasyon (Şekil 2B) kontrol etmek için bir% 2 veya% 4 agaroz jel üzerinde bir kesir çalıştırın. </li></ol><img alt="Şekil 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Oligonükleotit sentezi kütüphanelerinin Şekil 2. hazırlanması a.) </strong&gt; Üç farklı ham oligonükleotid sentezi kütüphaneleri (EKK)% 10 TBE-Üre poliakrilamid jelleri üzerinde çalıştırın. Tam uzunlukta oligonükleotitlerin (*) karşılık gelen bantları görsel ve kütüphanelerden 1 den kesilmiş ve 2. Library 3 SAYFA arıtma müdahale kontaminatlar edilebilir. Bu durumda ise, bir agaroz jel üzerinde, aynı oligonükleotid kütüphane çalışmasının açık ve emülsiyon PCR amplifikasyonu PCR amplifikasyonu. Ürünler, b) doğrudan devam edin. Karmaşık oligonükleotid kütüphanelerin PCR sık kimerik ürünler ve daha yüksek ve daha düşük bantları gibi görünebilir diğer eserler oluşturur. Emülsiyon PCR, bu eserler en aza indirebilirsiniz. 2. Kütüphane İnşaatı <ol><li> , Bir% 1 agaroz jel üzerinde yapılmıştır, 2 saat için, 50 ° C de bir Sfil ile sindirilerek vektör pMPRA1 ile doğrusallaştırılmış plazmit omurga hazırlanması (Bu durumda, 2,5-kb olarak) bant kesip omurga ve bir jel saflaştırma spin-sütunu kullanarak arıtın. </li><li> Digest2 saat boyunca 50 ° C&#39;de bir Sfil ile adım 1.4 emülsiyon PCR ürünleri ve DNA saflaştırma kolonları kullanılarak saflaştırılması. </li><li> , Doğrusallaştırılmış vektör omurgasına promotör-etiketi kitaplığı birbirine bağlamak için sindirilmiş PCR ürünü, 100 ng, lineerize vektör omurgası ve T4 DNA ligazı ihtiva eden 50 ng tepkileri oluşturmuştur. 20 dakika ligazı inaktivasyonu için 65 ° C sıcaklıkta daha sonra ısı 16 ° C de bir gece inkübe ve. </li><li> E. Transform Ligasyon reaksiyonu E. coli ile. Kütüphane karmaşıklığı korumak için, tasarlanan kütüphanede farklı promotör-etiketi kombinasyonları vardır en az 10x daha cfu elde etmek hedefliyoruz. </li><li> Etiketler toplam sayısı yaklaşık 100,000 olduğunda, tipik haliyle, hedef CFU kütüphane başına 6-8 paralel dönüşümlerinin gerçekleştirilmesi suretiyle elde edilebilir. </li><li> Her bir dönüşüm, E. elektrouyumlu 50 ul birleştirme Buz üzerinde ligasyon karışımı 2 ul E. coli hücreleri. 800 ul SOC hücreleri elektroporasyon ile transforme kurtarmakParalel dönüşümler hücreleri birleştirir sonra 1 saat boyunca 37 ° C&#39;de çalkalanarak ve orta tarafından. </li><li> Transformasyon etkinliğini değerlendirmek için, 50-100 ug / ml karbenisilin LB agar plakaları üzerinde elde edilen hücreler bir alinquot kadar seri seyreltiler plaka ve gece boyunca 37 ° C&#39;de inkübe edin. / V V v ve elde edilen hücreler toplam hacmi olan seri seyreltiler için alınan kan hacmi olan - toplam CFU olarak (gözlenen cfu), x (seyreltme faktörü) x (v V) tahmin edilmesi. </li><li> Aynı zamanda, geri kalan hücrelerin 100 ug / ml karbenisilin ile desteklenmiş 200ml LB aşılamak için kullanılır. Çalkalamalı bir inkübatör içinde gece boyunca 37 ° C&#39;de hücrelerin büyümesine ve sonra standart yöntemler kullanılarak, plazmid DNA izole eder. </li><li> 2 saat boyunca 50 ° C&#39;de bir Sfil ile izole edilen plazmid kütüphanesinin bir kısım sindirimi ve insertlerin varlığı teyit etmek için bir% 1 agaroz jel üzerinde yapılmıştır. </li><li> C plazma kütüphanesi linearizeKpnl ve Xbal kullanarak promotör varyantları ve etiketleri arasında esme. Sindirim verimliliğini maksimize etmek için, seri sindirimler gerçekleştirin: </li><li> İlk olarak, 1 saat boyunca 37 ° C&#39;de Kpnl ile sindirmek ve manyetik boncuklar kullanılarak saflaştırılması. İkinci olarak, 2 saat boyunca 37 ° C &#39;de, 1 U karides alkalin fosfatazı ilavesiyle Xbal ile sindirilmesi, ısı 5 dakika boyunca 65 ° C&#39;de etkisiz hale ve daha sonra manyetik boncuklar kullanılarak saflaştırılması. </li><li> Tam doğrusallaştınlmasının kontrol etmek için bir% 1 agaroz jeli üzerinde bir kesir çalıştırın. Kesilmemiş plazmid görülebiliyorsa, doğrusallaştırılmış fragmanı jel arındırılmalıdır. </li><li> Memeli hücreleri içine transfeksiyonu için uygun bir MPRA kütüphanesi oluşturmak için, ara doğrusallaştırılmış kitaplığa Kpnl / Xbal uçları ile uyumlu bir bir ORF ligate. </li><li> PMPRAdonor1 uyumlu bir luc2 ORF fragmanını hazırlamak için, 1 saat boyunca 37 ° C&#39;de Kpnl ve Xbal ile sindirimi plasmid ve bir% 1 agaroz jel üzerinde yapılmıştır. ORF parçasını kesip (1.7 kBu durumda, b) ve bir jel saflaştırma spin kolon kullanılarak saflaştırılması. </li><li> 2,3-2,8 adımda tarif edildiği gibi doğrusallaştırılmış ara kitaplığa ORF parçası, klon. </li><li> 1 saat boyunca 37 ° C&#39;de Kpnl ile MPRA kütüphanenin (1-2 ug tekabül eden) bir tümbölen sindirmekte ve ürünleri bir% 1 agaroz jel üzerinde yapılmıştır. Sindirilmiş kütüphane tek bir bant olarak çalışıyorsa, ilave bantların (tipik olarak ara yapıların taşınmadan karşılık gelir), kütüphanesi aşağıdaki gibi bir daha antılabilir gözlenirse, Bölüm 3. edin: </li><li> 1 saat boyunca 37 ° C&#39;de Kpnl ile kirlenmiş kütüphanenin 3-5 ug sindirimi ve 4 ° C&#39;de gece boyunca,% 0.8 agaroz jel üzerinde yapılmıştır. </li><li> , Doğru kitaplığı grubu kesip çıkarmak jel saflaştırma spin kolon kullanılarak DNA&#39;nın arıtılması ve 1 saat boyunca 37 ° C &#39;de yüksek konsantrasyonlu T4 DNA ligazı kullanılarak kendi kendine bağlanmasını gerçekleştirmek. Adım 2.8 &#39;de açıklandığı gibi Sonra dönüşüm ve nihai kütüphane DNA izolasyonu tekrarlayın. </li></ol> 3. Transfection, Perturbasyon, ve RNA İzolasyonu <ol><li> Her bir bağımsız transfeksiyon, kültür, uygun bir ortam içindeki hücre istenilen sayıda (MPRA kütüphane karmaşıklığı ile tespit edildiği üzere, Tartışma) için. Örneğin DMEM kültür HEK293T / 17 hücreleri,% 10 FBS ve L-glutamin / penisilin / streptomisin ile takviye edilmiştir. Her bir kütüphaneden ve deneysel koşul için en azından iki bağımsız Transfeksiyonlar için kültür hücreleri. </li><li> MPRA plazmid ile kültürlenmiş hücrelerin transfekte. Transfeksiyon yöntemi ve koşulları, her hücre tipi için optimize edilmelidir. Her transfekte edilmiş bir örnek için, eşleştirilmiş bir kontrol olarak plazmid DNA bir kısım (50-100 ng) muhafaza eder. </li><li> Örneğin, 0.5 x 10 7 HEK293T / yetişen 17 hücrelerini transfekte etmek için 30 ul ul Lipofektamin LTX&#39;i ve 10 ul Plus tepkin maddesi kullanılarak İndirgenmiş Serum Ortamı 1 mi Opti-MEM içinde 10 ug plazmit DNA&#39;sı ile 10 cm&#39;lik bir kültür kabı içinde% 50 birleşir. 5 saat sonra transfeksiyon karışımı çıkarın ve sağlarhücreler 24-48 saat kurtarmak için. </li><li> İsteğe bağlı olarak, tasarlanan kütüphanede, bağlama veya sinyal bağımlı düzenleyici sekansları aktif hale getirmek için gerekli olan herhangi bir karışıklığa gerçekleştirin. </li><li> Hücreler hasat ve üreticinin talimatlarını kullanarak standart oligo (dT) selüloz sütunları veya boncuklar kullanılarak poli (A) + mRNA izole eder. </li><li> Sütun veya boncukların maksimum bağlama kapasitesi Toplanan hücrelerden mRNA beklenen toplam miktarını aşan emin olun. Örneğin, bölüm 3,3 beklenen verim yaklaşık 0,5-2,5 mikrogram mRNA. </li></ol> 4. Etiket-Sıra <ol><li> Transfekte edilmiş hücre lizatları vektör DNA taşınmasını ortadan kaldırmak için, önceki 2.4 ul turbo DNaz inaktivasyonu reaktifi, 1 saat boyunca 37 ° C &#39;de 1 ul Turbo DNaz (2 U) ve 2.3 ul 10x turbo DNaz tampon maddesi ile her biri 20 ul numune mRNA&#39;sı tedavi eklemek RT daha sonra 5 dakika karıştırma ile, 90 saniye boyunca 10,000 g&#39;da santrifüj ve bir tüpe olarak solüsyon. </li><li> Doğrulayın<html> bir agaroz jeli üzerinde ürün mRNA&#39;nın her numunenin 60-100 ng bölüm 4.6 de tarif edildiği gibi PCR yapılması, ve daha sonra çalıştırarak saflık. (Luc2 ile pMPRA1 kullanıyorsanız 0.25 kb) özel amplikonlar görünmüyorsa, sütun tedavi mRNA arındırmak ve ardından Dnaz tedaviyi tekrarlayın. </li><li> , Etiket-Dizi sıralama kütüphaneleri oluşturmak cDNA&#39;sına muhabiri mRNA dönüştürmek ve PCR ile dizileme bağdaştırıcısı eklemek. </li><li> Tablo 3&#39;te tarif edilen mRNA / RT primer karışımları ayarlayın. Sonra buz üzerine yerleştirin, 5 dakika boyunca 65 ° C&#39;de inkübe edilir. Tablo 4&#39;te tarif edildiği gibi paralel olarak, cDNA sentez reaksiyonları ayarlayın. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reaktif </td><td> 1x Hacmi (ul) </td></tr><tr><td> mRNA numunesi (400-700 ng toplam) </td><td> 8 </td></tr><tr><td> Oligo 0DT (50 uM) </td><td> 1 </td></tr><tr><td> dNTP (10 mM) </td><td> 1 </td></tr></tbody></table>cDNA sentezi için ove_content &quot;&gt; Tablo 3. RNA / Ters transkripsiyon primer karışımını içerir. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reaktif </td><td> 1x Hacmi (ul) </td></tr><tr><td> 10x SuperScriptTM III RT Tampon </td><td> 2 </td></tr><tr><td> MgCI2 (25mM) </td><td> 4 </td></tr><tr><td> DTT (0.1 M) </td><td> 2 </td></tr><tr><td> RNaseOut (40 U / ml) </td><td> 1 </td></tr><tr><td> Üst Simge III (200 U / ml) </td><td> 1 </td></tr></tbody></table> Tablo 4. cDNA sentez reaksiyon karışımı. <ol start="5"><li> Yavaşça mRNA / RT primer cDNA sentezi karışımları ile karışır birleştirir. 50 dakika sonra, 5 dakika boyunca 85 ° C boyunca 50 ° C&#39;de inkübe edilir ve daha sonra buz üzerine yerleştirin. Son olarak, 20 dakika boyunca, 37 ° C&#39;de 2 U ribonükleaz H kuluçkalayın. </li><li> 4-6 ul, Tablo 5&#39;te tarif edildiği gibi PCR reaksiyonları ayarlamaReaksiyon karışımı, bir cDNA ya da şablon olarak 50 ng raportör plazmid. Daha sonra PCR amplifikasyonu (2 dakika boyunca 95 ° C, 26 x [30 saniye için 95 ° C, 30 sn için 30 saniye boyunca 55 ° C, 72 ° C], 3 dakika boyunca 72 ° C) gerçekleştirir. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reaktif </td><td> 1x Hacmi (ul) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> Astar TagSeq_P1 (25 uM) </td><td> 0.5 </td></tr><tr><td> Astar TagSeq_P2 (25 uM) </td><td> 0.5 </td></tr><tr><td> Şablon (mRNA, cDNA ya da plazmid DNA karışımı) </td><td> değişir </td></tr><tr><td> Nükleazlar içermeyen su </td><td> 50 </td></tr></tbody></table> Tablo 5. Etiket-Dizi PCR reaksiyon karışımı. <ol start="7"><li> % 2 agaroz jeli içinden PCR ürünlerini çalıştırın Etiket-Seq kütüphane karşılık gelen amplikonun tüketim bantları (0.25 kb kullanılıyorsaluc2 ile pMPRA1) ve bu kullanılarak jel saflaştırma spin sütunları arındırmak. </li><li> Yüzme havuzu, denatüre ve Illumina sıralama alet ile direkt olarak saflaştırılmış Etiket-Dizi amplikonları sırası. </li><li> Filtre düşük kaliteli sıralı etiketi içinde daha az 30 puan veya b) tam bir dizayn etiketi eşleşmiyor bir Phred kalitesi ile bir veya daha fazla pozisyon içeren) tüm a kaldırarak okur. Kalan her etiketi, her kütüphanede görünür sayısını sayın. TPM (milyon başına dizilenmiştir etiketleri etiketler) etiket sayısını normalize ve dizileme kütüphanelerinin her çifti için plasmid türevli etiket sayısı fazla mRNA, türetilmiş etiket sayımı oranı hesaplanır. Birden fazla farklı etiketler, her sekans varyantının bağlantılı olsaydı, alt analizi için medyan oranlarını kullanın. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Yazarlar hiçbir rakip mali çıkarlarının olmadığını beyan ederim.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Büyük ölçekte paralel Raportör Tahliller (MPRA) DNA dizilerinin 1- 7 yüz binlerce binlerce transkripsiyonel düzenleyici faaliyetlerinin birden fazla mesaj göndermiş ölçümüne izin verir. En genel bir uygulamasında, çoklayıcı bir açık okuma çerçevesinin alt tanıtıcı bir dizi etiketi içeren bir sentetik raportör gene, ilgilenilen her sekansı birleştirilmesi ile elde edilir (ORF, Şekil 1). Transfeksiyon, RNA izolasyonu ve raportör gen transkriptlerinin 3 &#39;uçları arasında derin dizilemesi sonra, birleştirilen dizilerin relatif aktiviteleri, bunların belirlenmesi etiketlerin görece bolluğu sonucu çıkarılabilir. <img alt="Şekil 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> MPRA Şekil 1. Genel Bakış. MPRA raportör bir kütüphane sentetik varsayımsal düzenleme sekansları şekilde birleştirilmesi yoluyla yapılandırılır konstruktlarıtanımlayıcı bir dizi etiketi ve ardından (örneğin, lusiferaz, GFP ve gibi) bir &quot;etkisiz&quot; ORF oluşmaktadır raportör genler. Kütüphane kültürlenmiş hücrelerin bir popülasyonunun içine transfekte edilir topluca ve kopyalandığı raportör mRNA, daha sonra elde edilir. Derin sıralama muhabiri mRNAların ve nakledilen plazmidlerden arasında her etiket yineleme sayısını saymak için kullanılır. Plazmid sayısı ilgili düzenleyici dizi aktivitesini belirlemek için de kullanılabilir fazla mRNA oranı sayar. Melnikov izni ile uyarlanmıştır, ve ark 2. MPRA ilgi konusu bir lokus üzerinde yeni bir düzenleyici elemanlar için tek tek gen düzenleme elemanlarının 1) geniş mutajenezi, 2) tarama dahil olmak üzere deney tasarımları çeşitli adapte edilebilir, 3) farazi bir dizi doğal genetik farklılaşmasının etkisinin test edilmesi uyarıcının veya susturucular ve sentetik düzenleyici elemanlar 4) yarı-rasyonel mühendislik. Lidizi varyantlarının braries dejenere oligonükleotidler 1,4, birleştirici ligasyon 8 ve genomik DNA 5 parçalanma oligonükleotid mikrodiziler kütüphane programlanabilir 2,3,6,7 üzerinde sentezi (en küçük kareler), montaj dahil olmak üzere çeşitli yöntemler kullanılarak elde edilebilir. Bu protokol, promotör bir kütüphanesinin yapımını da tarif eder varyantlarının en küçük kareler ve pMPRA1 ve pMPRAdonor1 vektörleri (sırasıyla Addgene kimlikleri 49349 ve 49352; http://www.addgene.org) kullanılarak kültürlenmiş memeli hücrelerine ve daha sonra kantitatif olarak bu kütüphanenin geçici transfeksiyon ilişkili etiketleri derin sıralama (Etiket-Dizi) tarafından promotör faaliyetleri. Bu protokolün önceki sürümleri (2013) Araştırma 23, 800-811 Melnikov ve ark. Nature Biotechnology 30, 271-277 (2012) ve Kheradpour ve ark. Genome bildirilen araştırmada kullanılmıştır.

<table><tbody><tr><td>Oligonucleotide library synthesis</td><td>Agilent, CustomArray, or other OLS vendors</td><td>custom</td><td>If using OLS construction method</td></tr><tr><td>pMPRA1</td><td>Addgene</td><td>49349</td><td>MPRA plasmid backbone</td></tr><tr><td>pMPRAdonor1</td><td>Addgene</td><td>49352</td><td>luc2 ORF donor plasmid</td></tr><tr><td>TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td><td>Generic</td><td>n/a</td><td>OLS buffer</td></tr><tr><td>Novex TBE-Urea Gels, 10%</td><td>Life Technologies</td><td>EC6875BOX</td><td>PAGE purification of OLS products</td></tr><tr><td>Novex TBA-Urea Sample Buffer</td><td>Life Technologies</td><td>LC6876</td><td>PAGE purification of OLS products</td></tr><tr><td>SYBR Gold Nucleic Acid Gel Stain</td><td>Life Technologies</td><td>S-11494</td><td>PAGE purification of OLS products</td></tr><tr><td>Micellula DNA Emulsion &amp;amp; Purification Kit</td><td>EURx/CHIMERx</td><td>3600-01</td><td>Library amplification by emulsion PCR</td></tr><tr><td>Herculase II Fusion DNA Polymerase</td><td>Agilent</td><td>600675</td><td>Polymerase for emulsion PCR</td></tr><tr><td>SfiI</td><td>New England Biolabs</td><td>R0123S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>KpnI-HF</td><td>New England Biolabs</td><td>R3142S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>XbaI</td><td>New England Biolabs</td><td>R0145S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>T4 DNA Ligase (2,000,000 units/ml)</td><td>New England Biolabs</td><td>M0202T</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>One Shot TOP10 Electrocomp &lt;em&gt;E. coli&lt;/em&gt;</td><td>Life Technologies</td><td>C4040-50</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>LB agar and liquid media with carbenicllin</td><td>Generic</td><td>n/a</td><td>Growth media for cloning</td></tr><tr><td>E-Gel EX Gels 1%</td><td>Life Technologies</td><td>G4010-01</td><td>Library verification and purification</td></tr><tr><td>E-Gel EX Gels, 2%</td><td>Life Technologies</td><td>G4010-02</td><td>Library verification and purification</td></tr><tr><td>MinElute Gel Extraction Kit</td><td>Qiagen</td><td>28604</td><td>Library and backbone purification</td></tr><tr><td>EndoFree Plasmid Maxi Kit</td><td>Qiagen</td><td>12362</td><td>Library DNA isolation</td></tr><tr><td>Cell culture media</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>Transfection reagents</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>MicroPoly(A)Purist Kit</td><td>Life Technologies</td><td>AM1919</td><td>mRNA isolation</td></tr><tr><td>TURBO DNA-free Kit</td><td>Life Technologies</td><td>AM1907</td><td>Plasmid DNA removal</td></tr><tr><td>SuperScript III First-Strand Synthesis System</td><td>Life Technologies</td><td>18080-051</td><td>cDNA synthesis</td></tr><tr><td>PfuUltra II Hotstart PCR Master Mix</td><td>Agilent</td><td>600850</td><td>Polymerase for Tag-Seq PCR</td></tr><tr><td>Primers (see text)</td><td>IDT</td><td>custom</td><td>PAGE purify Tag-Seq primers</td></tr></tbody></table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA yüksek çözünürlüklü, transkripsiyonel düzenleyici elemanlarının dizi-etki ilişkileri kantitatif diseksiyon kolaylaştırır. Başarılı bir MPRA deney tipik olarak transfekte kitaplığı (Şekil 3A) dizilerin çoğunluğu için yüksek ölçüde tekrarlanabilir ölçümleri sağlayacaktır. Zayıf tekrarlanabilirlik (Şekil 3B) gözlenirse, bu durum, test dizileri arasında 1) düşük bir mutlak aktivitesi, ya da 2) düşük transfeksiyon verimi birine, geri kazanılan RNA örnekleri raportör mRNA, çok düşük bir konsantrasyonda bir göstergesidir. Şekil 4, analiz etmek sureti ile üretilen bir temsili &quot;bilgi izi&quot; 1,2 gösterir ~ ya da Sendai virüsü maruz kalmadan HEK293 hücrelerinde insan IFNB geninin üst akışında bir 145 bp dizisinin rastgele 37000 varyantları. Promotör TATA-kutu ve bilinen yakın güçlendirici 10 açık bilgi açısından zengin Regi olarak tanımlanabilirbir virüs-bağlı bir şekilde ortaya koymuşlardır. <img alt="Şekil 3," src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Şekil 3. Etiket-Dizi tekrarlanabilirlik. Yüksek (A) ve düşük (B) tekrarlanabilirlik ile iki bağımsız çoğaltmak transfeksiyonlann Etiket-Sıra verilerden örnekler gösteren Dağılım araziler. İkincisi arsa iki çoğaltır sadece birinde yüksek mRNA sayıları ile birçok Aykırı etiketleri gösterir. Bu tür yapılar, tipik olarak, raportör mRNA&#39;ların konsantrasyonu nedeniyle raportör yapılan arasında düşük mutlak aktiviteler, veya düşük transfeksiyon verimi için, ya da kantitatif PCR amplifikasyonu için çok düşük olduğunu göstermektedir. <img alt="Şekil 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> Insan IFNB transkripsiyon başlama alanı ile yakın arttırıcının Şekil 4. bilgi izi. </strzun&gt; yukan insan IFNB geninin bir 145 nükleotid (nt) bölgesi yaklaşık 37,000 rastgele varyantları, (A) ve Sendai virüsü (B) maruz kalmayan HEK293 hücrelerinde MPRA kullanılarak tahlil edilmiştir. Mavi çubuk her pozisyondaki raportör çıkışı ile nükleotid arasındaki karşılıklı bilgileri gösterir. Proksimal arttırıcı ve TATA kutusu viral enfeksiyon üzerinde yüksek bilgi içeriği bölgeleri olarak öne çıkıyor.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Kültürlenmiş memeli hücrelerinde büyük çapta paralel Raportör Tahliller

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.4K Görüntüleme.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Video: Massively Parallel Reporter Assays in Cultured Mammalian Cells

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in vitro analysis are well suited to study of large numbers of cells (&ge;105) in milliliter-scale volumes (&ge;0.1 ml). However, there are many instances in which it is necessary or desirable to scale down culture size to reduce consumption of the cells of interest and/or reagents required for their culture, stimulation, or processing. Unfortunately, conventional approaches do not support precise and reproducible manipulation of micro-scale cultures, and the microfluidics-based automated systems currently available are too complex and specialized for routine use by most laboratories. To address this problem, we have developed a simple and versatile technology platform for automated culture, stimulation, and recovery of small populations of cells (100 - 2,000 cells) in micro-scale volumes (1 - 20 &mu;l). The platform consists of a set of fibronectin-coated microcapillaries ("cell perfusion chambers"), within which micro-scale cultures are established, maintained, and stimulated; a digital microfluidics (DMF) device outfitted with "transfer" microcapillaries ("central hub"), which routes cells and reagents to and from the perfusion chambers; a high-precision syringe pump, which powers transport of materials between the perfusion chambers and the central hub; and an electronic interface that provides control over transport of materials, which is coordinated and automated via pre-determined scripts. As an example, we used the platform to facilitate study of transcriptional responses elicited in immune cells upon challenge with bacteria. Use of the platform enabled us to reduce consumption of cells and reagents, minimize experiment-to-experiment variability, and re-direct hands-on labor. Given the advantages that it confers, as well as its accessibility and versatility, our platform should find use in a wide variety of laboratories and applications, and prove especially useful in facilitating analysis of cells and stimuli that are available in only limited quantities.

We have developed an automated cell culture and interrogation platform for micro-scale cell stimulation experiments. The platform offers simple, versatile, and precise control in cultivating and stimulating small populations of cells, and recovering lysates for molecular analyses. The platform is well suited to studies that use precious cells and/or reagents.

Mikro ölçekli Hücre Stimülasyon deneyler için Çok Yönlü Otomatik Platformu

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in ...

Biyomühendislik

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

Kimyasal ve genetik eklenmesi en iyi duruma getirme GPCRs fotoğraf-çapraz eşleme ve canlı memeli hücreleri Bioorthogonal kimyada probları

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

Kimya

A Multiplexed Luciferase-based Screening Platform for Interrogating Cancer-associated Signal Transduction in Cultured Cells

Genome-scale interrogation of gene function using RNA interference (RNAi) holds tremendous promise for the rapid identification of chemically tractable cancer cell vulnerabilities. Limiting the potential of this technology is the inability to rapidly delineate the mechanistic basis of phenotypic outcomes and thus inform the development of molecularly targeted therapeutic strategies. We outline here methods to deconstruct cellular phenotypes induced by RNAi-mediated gene targeting using multiplexed reporter systems that allow monitoring of key cancer cell-associated processes. This high-content screening methodology is versatile and can be readily adapted for the screening of other types of large molecular libraries.

Achieving a systems level understanding of cellular processes is a goal of modern-day cell biology. We describe here strategies for multiplexing luciferase reporters of various cellular function end-points to interrogate gene function using genome-scale RNAi libraries.

Kültür Hücreler Kanser ile ilişkili Sinyal İletimi sorgulanması için bir Multiplexed Lusiferaz tabanlı Tarama Platformu

Genome-scale interrogation of gene function using RNA interference (RNAi)  holds tremendous promise for the rapid identification of chemically tractable  ...

Tıp

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since several decades, the sudden burst of multi- and extensively-drug resistant strains is a serious threat for the control of tuberculosis. Therefore, it is essential to identify new targets and pathways critical for the causative agent of the tuberculosis, Mycobacterium tuberculosis (Mtb) and to search for novel chemicals that could become TB drugs. One approach is to set&#160;up methods suitable for the genetic and chemical screens of large scale libraries enabling the search of a needle in a haystack. To this end, we developed a phenotypic assay relying on the detection of fluorescently labeled Mtb within fluorescently labeled host&#160;cells using automated confocal microscopy. This in vitro assay allows an image based quantification of the colonization process of Mtb&#160;into the host and was optimized for the 384-well microplate format, which is proper for screens of siRNA-, chemical compound- or Mtb mutant-libraries. The images are then processed for multiparametric analysis, which provides read&#160;out inferring on the pathogenesis of Mtb&#160;within host cells.

Here, we describe a phenotypic assay applicable to the High-throughput/High-content screens of small-interfering synthetic RNA (siRNA), chemical compound, and Mycobacterium tuberculosis mutant libraries. This method relies on the detection of fluorescently labeled Mycobacterium tuberculosis within fluorescently labeled host&#160;cell using automated confocal microscopy.

Yüksek Verimli/Yüksek İçerikli Taramaya Uyarlanmış Hücre İçi Mikobakterilerin Nicelleştirilmesi için Mikroskobik Fenotipik Bir Tahlil

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

İmmünoloji ve Enfeksiyon

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

Memeli Hücrelerinde Intronic mikroRNA Olgunlaşmasını Analiz Etmek İçin Bir Muhabir Testi

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

Kanser Araştırmaları

High Throughput, Real-time, Dual-readout Testing of Intracellular Antimicrobial Activity and Eukaryotic Cell Cytotoxicity

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require several additional experimental steps prior to readout, such as cell lysis, colony forming unit determination, or reagent addition. When performing thousands of assays, for example, during high-throughput screening, the downstream effort required for these types of assays is considerable. Therefore, to facilitate high-throughput antimicrobial discovery, we developed a real-time assay to simultaneously identify inhibitors of intracellular bacterial growth and assess eukaryotic cell cytotoxicity. Specifically, real-time intracellular bacterial growth detection was enabled by marking bacterial screening strains with either a bacterial lux operon (1st generation assay) or fluorescent protein reporters (2nd generation, orthogonal assay). A non-toxic, cell membrane-impermeant, nucleic acid-binding dye was also added during initial infection of macrophages. These dyes are excluded from viable cells. However, non-viable host cells lose membrane integrity permitting entry and fluorescent labeling of nuclear DNA (deoxyribonucleic acid). Notably, DNA binding is associated with a large increase in fluorescent quantum yield that provides a solution-based readout of host cell death. We have used this combined assay to perform a high-throughput screen in microplate format, and to assess intracellular growth and cytotoxicity by microscopy. Notably, antimicrobials may demonstrate synergy in which the combined effect of two or more antimicrobials when applied together is greater than when applied separately. Testing for in vitro synergy against intracellular pathogens is normally a prodigious task as combinatorial permutations of antibiotics at different concentrations must be assessed. However, we found that our real-time assay combined with automated, digital dispensing technology permitted facile synergy testing. Using these approaches, we were able to systematically survey action of a large number of antimicrobials alone and in combination against the intracellular pathogen, Legionella pneumophila.

A high throughput, real-time assay was developed to simultaneously identify (1) eukaryotic cell-penetrant antimicrobials targeting an intracellular bacterial pathogen, and (2) assess eukaryotic cell cytotoxicity. A variation on the same technology was thereafter combined with digital dispensing technology to enable facile, high-resolution, dose-response, and two- and three-dimensional synergy studies.

Yüksek Verimli, gerçek zamanlı, Hücre içi Antimikrobiyal Aktiviteleri Çift okuma Test ve Ökaryotik Hücre Sitotoksisite

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require ...

Monitoring Plasmid Replication in Live Mammalian Cells over Multiple Generations by Fluorescence Microscopy

Few naturally-occurring plasmids are maintained in mammalian cells. Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus (EBV) and Kaposi's Sarcoma-associated herpesvirus (KSHV), which cause multiple human malignancies 1-3. These two genomes are replicated in a licensed manner, each using a single viral protein and cellular replication machinery, and are passed to daughter cells during cell division despite their lacking traditional centromeres 4-8.
Much work has been done to characterize the replications of these plasmid genomes using methods such as Southern blotting and fluorescence in situ hybridization (FISH). These methods are limited, though. Quantitative PCR and Southern blots provide information about the average number of plasmids per cell in a population of cells. FISH is a single-cell assay that reveals both the average number and the distribution of plasmids per cell in the population of cells but is static, allowing no information about the parent or progeny of the examined cell.
Here, we describe a method for visualizing plasmids in live cells. This method is based on the binding of a fluorescently tagged lactose repressor protein to multiple sites in the plasmid of interest 9. The DNA of interest is engineered to include approximately 250 tandem repeats of the lactose operator (LacO) sequence. LacO is specifically bound by the lactose repressor protein (LacI), which can be fused to a fluorescent protein. The fusion protein can either be expressed from the engineered plasmid or introduced by a retroviral vector. In this way, the DNA molecules are fluorescently tagged and therefore become visible via fluorescence microscopy. The fusion protein is blocked from binding the plasmid DNA by culturing cells in the presence of IPTG until the plasmids are ready to be viewed.
This system allows the plasmids to be monitored in living cells through several generations, revealing properties of their synthesis and partitioning to daughter cells. Ideal cells are adherent, easily transfected, and have large nuclei. This technique has been used to determine that 84% of EBV-derived plasmids are synthesized each generation and 88% of the newly synthesized plasmids partition faithfully to daughter cells in HeLa cells. Pairs of these EBV plasmids were seen to be tethered to or associated with sister chromatids after their synthesis in S-phase until they were seen to separate as the sister chromatids separated in Anaphase10. The method is currently being used to study replication of KSHV genomes in HeLa cells and SLK cells. HeLa cells are immortalized human epithelial cells, and SLK cells are immortalized human endothelial cells. Though SLK cells were originally derived from a KSHV lesion, neither the HeLa nor SLK cell line naturally harbors KSHV genomes11. In addition to studying viral replication, this visualization technique can be used to investigate the effects of the addition, removal, or mutation of various DNA sequence elements on synthesis, localization, and partitioning of other recombinant plasmid DNAs.

A method of observing individual DNA molecules in live cells is described. The technique is based on the binding of a fluorescently tagged lac repressor protein to binding sites engineered into the DNA of interest. This method can be adapted to follow many recombinant DNAs in live cells over time.

Floresan Mikroskobu ile Çoklu Nesiller boyunca Canlı Memeli Hücrelerinde Plazmid Çoğaltma İzlenmesi

Few naturally-occurring plasmids are maintained in mammalian cells.  Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus  (EBV) ...

Biyoloji

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with Parkinson&#39;s disease. 293T cells are transiently transfected with plasmids from an arrayed ORF expression library, together with luciferase reporter plasmids, in a one-gene-per-well microplate format. Firefly luciferase activity is assayed after 48 hr to determine the effects of each library gene upon alpha-synuclein transcription, normalized to expression from an internal control construct (a hCMV promoter directing Renilla luciferase). This protocol is facilitated by a bench-top robot enclosed in a biosafety cabinet, which performs aseptic liquid handling in 96-well format. Our automated transfection protocol is readily adaptable to high-throughput lentiviral library production or other functional screening protocols requiring triple-transfections of large numbers of unique library plasmids in conjunction with a common set of helper plasmids. We also present an inexpensive and validated alternative to commercially-available, dual luciferase reagents which employs PTC124, EDTA, and pyrophosphate to suppress firefly luciferase activity prior to measurement of Renilla luciferase. Using these methods, we screened 7,670 human genes and identified 68 regulators of alpha-synuclein. This protocol is easily modifiable to target other genes of interest.

We present a rapid and inexpensive screening method for identifying transcriptional regulators using high-throughput robotic transfections and a homemade dual-glow luciferase assay. This protocol rapidly generates direct side-by-side functional data for thousands of genes and is easily modifiable to target any gene of interest.

Bir ev yapımı Çift kızdırma Lusıferaz Testi kullanarak yüksek verim Fonksiyonel Taraması

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Screening Peptides that Activate MRGPRX2 using Engineered HEK Cells

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new therapeutics. Mas related G-protein receptor-X2 (MRGPRX2) is an important receptor that regulates mast cell activation and, thus, directs the general immune response. Numerous ligands for MRGPRX2 have been identified and include endogenous peptides like PAMPs, defensins, LL-37 and other protein fragments (i.e., degraded albumin). Further identification of MRGPRX2 specific ligands requires the screening of a large number of peptides (i.e., peptide library); however, mast cells are difficult and expensive to maintain in vitro and, therefore, not economical to use for screening large numbers of molecules. The present paper demonstrates a method to design, develop, and screen a library of small peptide molecules using MRGPRX2 expressing HEK cells. This cell line is relatively easy and inexpensive to maintain and can be used for in vitro high-throughput analysis. A calcium sensitive Fura-2 fluorescent dye to mark intracellular calcium flux upon activation was used to monitor the activation. The ratio of fluorescence intensity of Fura-2 at 510 nm against excitation wavelengths of 340 and 380 nm was used to calculate calcium concentration. The peptide library used to verify this system was based on the endogenous proadrenomedullin N-terminal 12 (PAMP-12) secretagogue, which is known to bind MRGPRX2 with high specificity and affinity. Subsequent peptides were generated through amino acid truncation and alanine scanning techniques applied to PAMP-12. The method described here is simple and inexpensive yet robust for screening a large library of compounds to identify binding domains and other important parameters that play an important role in receptor activation.

Techniques for generating a library of short peptides that can activate mast cells via the MRGPRX2 receptor are described. Associated techniques are easy, inexpensive, and can be extended to other cell receptors.

Tasarlanmış HEK Hücrelerini Kullanarak MRGPRX2'i Etkinleştiren Peptitlerin Taranır

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new ...

Autonomously Bioluminescent Mammalian Cells for Continuous and Real-time Monitoring of Cytotoxicity

Mammalian cell-based in vitro assays have been widely employed as alternatives to animal testing for toxicological studies but have been limited due to the high monetary and time costs of parallel sample preparation that are necessitated due to the destructive nature of firefly luciferase-based screening methods. This video describes the utilization of autonomously bioluminescent mammalian cells, which do not require the destructive addition of a luciferin substrate, as an inexpensive and facile method for monitoring the cytotoxic effects of a compound of interest. Mammalian cells stably expressing the full bacterial bioluminescence (luxCDABEfrp) gene cassette autonomously produce an optical signal that peaks at 490 nm without the addition of an expensive and possibly interfering luciferin substrate, excitation by an external energy source, or destruction of the sample that is traditionally performed during optical imaging procedures. This independence from external stimulation places the burden for maintaining the bioluminescent reaction solely on the cell, meaning that the resultant signal is only detected during active metabolism. This characteristic makes the lux-expressing cell line an excellent candidate for use as a biosentinel against cytotoxic effects because changes in bioluminescent production are indicative of adverse effects on cellular growth and metabolism. Similarly, the autonomous nature and lack of required sample destruction permits repeated imaging of the same sample in real-time throughout the period of toxicant exposure and can be performed across multiple samples using existing imaging equipment in an automated fashion.

Mammalian cells expressing the bacterial bioluminescence gene cassette (lux) produce light autonomously. The resulting bioluminescent dynamics upon chemical exposure have been demonstrated to reflect the treatment effects on cellular growth and metabolism, making these cells an inexpensive, continuous, real-time toxicity screening tool that can easily be adapted for high-throughput automation.

Sitotoksisite Sürekli ve gerçek zamanlı izlenmesi için özerk Bioluminescent Memeli Hücre

Mammalian  cell-based in vitro assays have been  widely employed as alternatives to animal testing for toxicological studies but  have been limited due to ...