Este trabalho foi financiado pelo Instituto Nacional de Pesquisa do Genoma Humano dos Institutos Nacionais de Saúde sob Award Número R01HG006785.

1 Seqüência de Projeto e Síntese <ol><li> Comece MPRA com o desenho e síntese de sequências a ser testado para a actividade reguladora. Para compatibilidade com a série vector pMPRA, projetar cada seqüência usando o seguinte modelo: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- tag -AGATCGGAAGAGCGTCG-3 &#39;, onde var denota a seqüência a ser analisada e tag denota uma ou mais marcas de identificação. </li><li> As duas regiões variáveis ​​(e var tag) são separados por um par de Kpnl (GGTACC) e XbaI (TCTAGA) locais de restrição para facilitar a ligação direccional de um fragmento do gene repórter entre eles. Além disso, dois locais distintos Sfil (GGCCNNNNNGGCC) será adicionado por PCR para permitir a ligação direccional no esqueleto pMPRA. As regiões variáveis ​​não devem conter cópias adicionais de qualquer destes locais de restrição. Se necessário, uma ou mais destas enzimas de restrição pode ser substituído, Desde que as substituições 1) permitir que o corte eficaz perto das extremidades de moléculas de DNA, e 2) não cortar em outros lugares na sequência do vector. Veja a discussão para obter detalhes adicionais. </li><li> Obter os iniciadores necessários listados na Tabela 1 a partir de um fornecedor comercial. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [índice] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tabela 1 sequências de primer. [Índice] denota uma seqüência de índice 6-8 nt utilizado para seqüenciamento multiplexado. Obter pelo menos 8 primers TagSeq-P2 com diferentes índices. Todosdos iniciadores deve ser purificado por HPLC ou PAGE. <ol start="4"><li> Bibliotecas oligonucleotídicas podem ser obtidas a partir de um vendedor ou de núcleo instalação comercial, ou gerado usando um sintetizador de oligonucleótidos baseada microarray programável, tal como descrito pelo fabricante. Ressuspender os produtos OLS em 100 ul de tampão TE 0,1. </li><li> Executar as bibliotecas de oligonucleótidos sobre um 10% de TBE-ureia desnaturante em gel de poliacrilamida. Coloque cerca de 1 pmol por pista e mancha com mancha fluorescente ssDNA-sensível para avaliar a sua qualidade (Figura 2A). </li><li> Se uma banda discreta correspondente aos oligonucleótidos de comprimento completo pode ser visualizado (Figura 2A, pistas 1 e 2), excisar a fatia de gel correspondente a acrilamida e eluir oligonucleótidos em 100 ul de TE 0,1 durante a noite à temperatura ambiente com agitação. Caso contrário, continue usando o OLS suspensão de matéria. </li><li> Amplificar e adicionar caudas Sfil para a biblioteca oligonucleotídeo utilizando emulsão PCR 9 </<html> sup&gt;. </li><li> Defina-se 50 ul de misturas de reacção de PCR como descrito na Tabela 2. Em seguida combinam-se com 300 ul mistura de óleo e agente tensioactivo da emulsão e ADN Micellula kit de purificação e de vórtice durante 5 min a 4 ° C. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Reagente </td><td> 1x Volume (uL) </td></tr><tr><td> Herculase II Fusão ADN Polimerase </td><td> 0,5 </td></tr><tr><td> Tampão de reacção 5x Herculase II </td><td> 10 </td></tr><tr><td> de dNTP (10 mM cada) </td><td> 1,25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1,25 </td></tr><tr><td> MPRA_SfiI_F Primer (25 uM) </td><td> 0,25 </td></tr><tr><td> MPRA_SfiI_R Primer (25 uM) </td><td> 0,25 </td></tr><tr><td> Modelo OLS (1-10 attomol) </td><td> varia </td></tr><tr><td> Água livre de nuclease </td><td> 50 </td></tr></tbody></table>ve_content &quot;&gt; Tabela 2 Emulsão mistura de reacção de PCR (fase aquosa). <ol start="9"><li> Utilizar a concentração que dá o máximo de rendimento de produtos de amplificação, sem o aparecimento de artefactos (ver secção 1.12). </li><li> Dispensar a emulsão resultante em tubos de PCR e executar 20 ciclos de PCR (2 minutos a 95 ° C, 20 x [20 s a 95 ° C, 20 seg a 55 ° C, 30 segundos a 72 ° C], 3 min a 95 ° C). </li><li> Piscina e romper cada emulsão de reacção de PCR de 350 ul por adição de 1 ml de isobutanol e brevemente vórtex e, em seguida, purificar o produto de amplificação, utilizando uma coluna de purificação de ADN. </li><li> Executar uma aliquota sobre um gel de agarose a 2% ou 4% para verificar a amplificação livre de artefacto (Figura 2B). </li></ol><img alt="Figura 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Figura 2: Preparação de bibliotecas de síntese de oligonucleótidos. UM) </sTrong&gt; Três bibliotecas síntese oligonucleotídeo matérias diferentes (MQO) executado em desnaturante 10% TBE-uréia géis de poliacrilamida. As bandas correspondentes a oligonucleótidos de comprimento total (*) pode ser visualizada e excisada a partir de bibliotecas de 1 e 2 Biblioteca 3 contém os contaminantes que interferem com a purificação PAGE. Se este for o caso, seguir diretamente para a amplificação de PCR. B) produtos de aberto e de emulsão de amplificação por PCR da mesma biblioteca de oligonucleótidos corrida num gel de agarose. Amplificação por PCR de bibliotecas de oligonucleotídeos complexas freqüentemente cria produtos quiméricos e outros artefatos que podem aparecer como bandas superiores e inferiores. Emulsão PCR pode minimizar esses artefatos. 2 Construção da Biblioteca <ol><li> Prepara-se uma estrutura do plasmideo linearizado por digestão com Sfil pMPRA1 vector a 50 ° C durante 2 horas, corrido num gel de agarose a 1%, excisão da banda de espinha dorsal (neste caso, de 2,5 kb) e purificá-lo através de uma coluna de gel de spin-purificação. </li><li> Digestos produtos de PCR a partir de emulsão passo 1.4 com Sfil a 50 ° C durante 2 horas e purificar por meio de colunas de purificação de ADN. </li><li> Para ligar a biblioteca de promotor-tag na estrutura do vector linearizado, configurar as reacções contendo 100 ng do produto de PCR digerido, 50 ng do esqueleto do vector linearizado e ADN-ligase de T4. Incubar durante a noite a 16 ° C e, em seguida, aquece-se a 65 ° C durante 20 minutos para inactivar a ligase. </li><li> Transformar E. coli com a reacção de ligação. Para preservar a complexidade biblioteca, visam obter pelo menos 10x mais ufc do que há combinações distintas promotor-tag na biblioteca projetada. </li><li> Quando o número total de marcadores é de aproximadamente 100.000, o ufc alvo pode normalmente ser conseguido através da realização de transformações paralelas 6-8 por biblioteca. </li><li> Para cada transformação, combinar 50 ul electrocompetentes E. As células de E. coli com 2 ul de mistura de ligação em gelo. Transformar por electroporação, recuperar as células em 800 ul SOCpor meio de agitação a 37 ° C durante 1 hora, e, em seguida, combinam as células a partir das transformações paralelas. </li><li> Para avaliar a eficiência da transformação, placa de diluições em série a partir de uma alinquot de células recuperadas em placas de LB-agar com 50-100 ug / ml de carbenicilina e incubar durante a noite a 37 ° C. Estimar ufc totais (CFU observada) x (factor de diluição) x (V - V) / V, em que V é o volume total de células recuperado e v é o volume da alíquota para as diluições em série. </li><li> Ao mesmo tempo, utilizar o restante das células recuperadas para inocular 200 ml de LB suplementado com 100 ug / ml de carbenicilina. Crescer as células a 37 ° C durante a noite numa incubadora com agitador e, em seguida, isolar o ADN de plasmídeo de acordo com procedimentos normalizados. </li><li> Digerir uma aliquota do plasmídeo da biblioteca isolado com Sfil a 50 ° C durante 2 horas e separado num gel de agarose a 1% para confirmar a presença dos insertos. </li><li> Linearizar o plasmídeo da biblioteca por cutting entre as variantes do promotor e tags usando Kpnl e Xbal. Para maximizar a eficiência da digestão, realizar digestões de série: </li><li> Primeiro, digerir com Kpnl a 37 ° C durante 1 hora e purificar usando esferas magnéticas. Em segundo lugar, digerir com Xbal com adição de 1 U de fosfatase alcalina de camarão a 37 ° C durante 2 horas, o calor inactiva a 65 ° C durante 5 min, e em seguida purificar usando esferas magnéticas. </li><li> Executar uma aliquota sobre um gel de agarose a 1% para verificar a linearização completa. Se o plasmídeo não cortado é visível, o fragmento linearizado deve ser purificado em gel. </li><li> Para gerar uma biblioteca MPRA adequado para transfecção em células de mamíferos, ligar uma ORF com KpnI / XbaI extremidades -compatível na biblioteca intermediário linearizado. </li><li> Para preparar um fragmento ORF luc2 compatível de pMPRAdonor1, digerir este plasmídeo com Kpnl e Xbal a 37 ° C durante 1 hora e corrido num gel de agarose a 1%. Extirpar o fragmento ORF (1,7 kb neste caso) e purifica-se utilizando uma coluna de gel de purificação de centrifugação. </li><li> Clonar o fragmento do ORF na biblioteca intermediário linearizado como descrito nos passos 2,3-2,8. </li><li> Digerir uma aliquota (correspondendo a 1-2 ng) da biblioteca MPRA com Kpnl a 37 ° C durante 1 hora e corrido num gel de agarose a 1%. Se a biblioteca digerido é executado como uma única banda, avance para a secção 3 Se forem observadas bandas adicionais (correspondendo tipicamente a transição de construções intermédios), a biblioteca pode ser ainda purificado como se segue: </li><li> Digerir 3-5 ug da biblioteca contaminado com Kpnl a 37 ° C durante 1 hora e corrido num gel de agarose a 0,8% durante a noite a 4 ° C. </li><li> Excisar a banda correcta biblioteca, purificar o ADN utilizando uma coluna de purificação de gel de rotação e realizar a auto-ligação de alta concentração utilizando a ligase de ADN de T4 a 37 ° C durante 1 hora. Em seguida, repetir a transformação e isolamento final, biblioteca de ADN, tal como descrito na etapa 2.8. </li></ol> 3 Transfection, perturbação, e Isolamento de RNA <ol><li> Para cada transfecção independentes, o número necessário de cultura de células (tal como determinado pela complexidade da biblioteca MPRA, ver discussão) em meio apropriado. Por exemplo, a cultura de células HEK293T / 17 em meio DMEM suplementado com 10% de FBS e L-glutamina / penicilina / estreptomicina. Células de cultura durante pelo menos duas transfecções independentes para cada biblioteca e condição experimental. </li><li> Transfectar as células cultivadas com plasmídeos MPRA. O método e as condições de transfecção deve ser optimizada para cada tipo de célula. Para cada uma das amostras transfectadas, reter-se uma alíquota (50-100 ng) de ADN de plasmídeo como controlo correspondente. </li><li> Por exemplo, transfectar 0,5 x 10 7 HEK293T / 17 células cultivadas para ~ 50% de confluência numa placa de cultura de 10 centímetros, com 10 ug de plasmídeo de DNA em 1 ml de Opti-MEM I Reduced Serum Medium, utilizando 30 ul de Lipofectamina LTX e 10 ul de reagente Além disso. Retirar a mistura de transfecção após 5 horas e permitir que océlulas recuperar durante 24-48 hr. </li><li> Opcionalmente, execute qualquer perturbação necessária para ativar seqüências regulatórias ao contexto ou dependentes de sinal na biblioteca projetada. </li><li> Colher as células e isolar ARN poli (A) + ARNm utilizando colunas padrão de oligo (dT) celulose ou pérolas utilizando as instruções do fabricante. </li><li> Assegure-se que a capacidade máxima de ligação das colunas ou grânulos exceder a quantidade total de ARNm esperado a partir das células colhidas. Por exemplo, o rendimento esperado da seção 3.3 é de cerca de 0,5-2,5 mg mRNA. </li></ol> 4. Tag-Seq <ol><li> Para eliminar o arraste de ADN do vector a partir dos lisados ​​de células transfectadas, o tratamento de cada uma das amostras de mRNA de 20 ul com 1 ul Turbo ADNase (2 U) e 2,3 ul de tampão 10x turbo ADNase a 37 ° C durante 1 h, adicionar 2,4 mL de reagente de DNase Turbo Inactivação pelo RT durante 5 min, com agitação, de centrifugação a 10.000 g durante 90 segundos, e, em seguida, transferir a solução para um tubo fresco. </li><li> Verifique<html> pureza através da realização de PCR, como descrito na secção 4.6 em 60-100 ng de cada amostra de mRNA, e depois executar os produtos em gel de agarose. Se os fragmentos específicos são visíveis (0,25 kb se usando pMPRA1 com luc2), coluna de purificar o mRNA tratada e, em seguida, repetir o tratamento DNase. </li><li> Para gerar bibliotecas de sequenciamento Tag-Seq, converter mRNA repórter de cDNA e adicione adaptadores de sequenciamento por PCR. </li><li> Defina-se misturas de iniciadores de ARNm / IF, tal como descrito na Tabela 3. Incubar a 65 ° C durante 5 min, em seguida, colocar em gelo. Em paralelo, criar reacções de síntese de cDNA, como descrito na Tabela 4. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (uL) </td></tr><tr><td> amostra de ARNm (400-700 ng total) </td><td> 8 </td></tr><tr><td> Oligo-0DT (50 uM) </td><td> 1 </td></tr><tr><td> de dNTP (10 mM cada) </td><td> 1 </td></tr></tbody></table>ove_content &quot;&gt; Tabela 3 ARN / transcrição reversa mistura de iniciadores para a síntese de cDNA. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (uL) </td></tr><tr><td> 10x SuperScript III RT buffer </td><td> 2 </td></tr><tr><td> MgCl2 (25 mM) </td><td> 4 </td></tr><tr><td> DTT (0,1 M) </td><td> 2 </td></tr><tr><td> RNaseOut (40 U / ul) </td><td> 1 </td></tr><tr><td> SuperScript III (200 U / ul) </td><td> 1 </td></tr></tbody></table> Tabela 4 Mistura de reacção de síntese de cDNA. <ol start="5"><li> Suavemente combinar ARNm / RT iniciador mistura com misturas de síntese de cDNA. Incubar a 50 ° C durante 50 min, 85 ° C durante 5 min e, em seguida, colocar em gelo. Finalmente, incubar com 2 U de ribonuclease H, a 37 ° C durante 20 min. </li><li> Defina-se reacções de PCR como descrito na Tabela 5 com 4-6 ulmistura de reacção de cDNA ou 50 ng de plasmídeo repórter como modelos. Em seguida, realizar a amplificação por PCR (95 ° C durante 2 min, 26 x [95 ° C durante 30 seg, 55 ° C durante 30 seg, 72 ° C durante 30 seg], 72 ° C durante 3 min). </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (uL) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> TagSeq_P1 Primer (25 uM) </td><td> 0,5 </td></tr><tr><td> TagSeq_P2 Primer (25 uM) </td><td> 0,5 </td></tr><tr><td> Molde (mRNA, cDNA ou a mistura de ADN de plasmídeo) </td><td> varia </td></tr><tr><td> Água livre de nuclease </td><td> 50 </td></tr></tbody></table> Tabela 5 mix reação Tag-Seq PCR. <ol start="7"><li> Executar os produtos de PCR através de um gel de agarose a 2%, faixas especiais de consumo correspondentes aos amplicons biblioteca de tags-Seq (0,25 kb se usandopMPRA1 com luc2) e purificar estas usando colunas de giro de purificação em gel. </li><li> Pool, desnaturar e sequenciar os amplicons Tag-Seq purificadas diretamente com um instrumento seqüenciamento Illumina. </li><li> Filtro de baixa qualidade lê, removendo tudo o que a) conter um ou mais posição com uma qualidade Phred pontuação inferior a 30 dentro da tag seqüenciado ou b) não corresponde exatamente a tag projetado. Conte o número de vezes que cada etiqueta restante aparece em cada biblioteca. Normalizar as contagens de tag de TPM (tags por milhão de etiquetas sequenciados) e, em seguida, calcular a relação de contagem de tag ARNm derivados sobre contagens tag derivado de plasmídeo para cada par de bibliotecas de sequenciação. Se várias marcas diferentes foram ligados a cada variante de sequência, use os seus rácios médios para análise a jusante. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Os autores declaram que não têm interesses financeiros concorrentes.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Ensaios Repórter Massively Parallel (MPRA) permitem a medição multiplexado das atividades de regulação transcricional de milhares a centenas de milhares de seqüências de DNA 1 a 7. Na sua aplicação mais comum, a multiplexação é obtida por acoplamento de cada sequência de interesse de um gene repórter sintético que contém uma marca de identificação de sequência a jusante de uma grelha de leitura aberta (ORF, Figura 1). Após a transfecção, o isolamento do RNA e profunda seqüenciamento de extremidades 3 &#39;dos ​​transcritos do gene repórter, as atividades relativas das sequências acopladas pode ser inferida a partir da abundância relativa de suas etiquetas de identificação. <img alt="Figura 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> Figura 1 Visão de MPRA. Uma biblioteca de MPRA repórter constrói é construído acoplando sequências regulatórias putativos para sintéticogenes repórter que são constituídas por uma &quot;inerte&quot; (ORF tais como GFP ou luciferase), seguido por uma sequência de marcação de identificação. A biblioteca é transfectado em massa para uma população de células cultivadas e o ARNm transcrito repórter é subsequentemente recuperado. Sequenciação profunda é utilizado para contar o número de ocorrências de cada etiqueta de entre os ARNm e os plasmídeos repórter transfectadas. A proporção de ARNm conta sobre contagens de plasmídeo pode ser usada para inferir a actividade da sequência reguladora correspondente. Adaptado com permissão de Melnikov, et al 2. MPRA podem ser adaptadas a uma ampla variedade de modelos experimentais, incluindo 1) mutagénese global de elementos reguladores de genes individuais, 2) para digitalização através de novos elementos reguladores um locus de interesse, 3) para testar o efeito da variação genética natural em um conjunto de putativas promotores, intensificadores ou silenciadores, e 4) engenharia semi-racional de elementos reguladores sintéticos. LiAs variantes da sequência de braries pode ser gerado utilizando uma variedade de métodos, incluindo síntese de biblioteca de oligonucleótidos (OLS) em microarrays programáveis ​​2,3,6,7, montagem de oligonucleótidos degenerados, 1,4 ligadura combinatória 8 e fragmentação do ADN genómico 5. Este protocolo descreve a construção de uma biblioteca de variantes do promotor utilizando MQO e os vectores e pMPRA1 pMPRAdonor1 (Addgene IDs de 49349 e 49352, respectivamente; http://www.addgene.org), a transfecção transiente desta biblioteca em células de mamífero de cultura e quantificação subsequente das atividades promotoras de profunda seqüenciamento de suas marcas associadas (Tag-Seq). Versões anteriores deste protocolo foram utilizados na pesquisa, publicada na Melnikov et al. Nature Biotechnology 30, 271-277 (2012) e em Kheradpour et al. Genome Research 23, 800-811 (2013).

<table border="0" cellpadding="0" cellspacing="0" width="954">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:359px;">Oligonucleotide library synthesis</td>
			<td style="width:201px;">Agilent, CustomArray or other OLS vendors</td>
			<td style="width:119px;">custom</td>
			<td style="width:275px;">If using OLS construction method</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">pMPRA1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49349</td>
			<td>MPRA plasmid backbone</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">pMPRAdonor1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49352</td>
			<td>luc2 ORF donor plasmid</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>OLS buffer</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">Novex TBE-Urea Gels, 10%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">EC6875BOX</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Novex TBA-Urea Sample Buffer</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">LC6876</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SYBR Gold Nucleic Acid Gel Stain</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">S-11494</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Micellula DNA Emulsion &#38; Purification Kit</td>
			<td style="width:201px;">EURx/CHIMERx</td>
			<td style="width:119px;">3600-01</td>
			<td>Library amplification by emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Herculase II Fusion DNA Polymerase</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600675</td>
			<td>Polymerase for emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SfiI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0123S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">KpnI-HF</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R3142S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">XbaI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0145S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">T4 DNA Ligase (2,000,000 units/ml)</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">M0202T</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">One Shot TOP10 Electrocomp E. coli</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">C4040-50</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">LB agar and liquid media with carbenicllin</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>Growth media for cloning</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels 1%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-01</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels, 2%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-02</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MinElute Gel Extraction Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">28604</td>
			<td>Library and backbone purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">EndoFree Plasmid Maxi Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">12362</td>
			<td>Library DNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Cell culture media</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Transfection reagents</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MicroPoly(A)Purist Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1919</td>
			<td>mRNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TURBO DNA-free Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1907</td>
			<td>Plasmid DNA removal</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SuperScript III First-Strand Synthesis System</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">18080-051</td>
			<td>cDNA synthesis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">PfuUltra II Hotstart PCR Master Mix</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600850</td>
			<td>Polymerase for Tag-Seq PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Primers (see text)</td>
			<td style="width:201px;">IDT</td>
			<td style="width:119px;">custom</td>
			<td>PAGE purify Tag-Seq primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:201px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA facilita alta resolução, dissecção quantitativa das relações de elementos reguladores da transcrição seqüência de atividades. Um experimento MPRA bem sucedido irá tipicamente produzir medições altamente reprodutíveis para a maioria das sequências na biblioteca transfectadas (Figura 3A). Se for observada uma fraca reprodutibilidade (Figura 3B), isto é indicativo de uma muito baixa concentração de mRNAs repórter nas amostras de RNA recuperado, devido ou a 1) reduzida actividade absoluta entre as sequências ensaiadas, ou 2) a baixa eficiência de transfecção. A Figura 4 mostra uma representação &quot;pegada informações&quot; 1,2 gerado por ensaio ~ 37.000 variantes aleatórias de uma sequência de 145 pb a montante do gene ifnb humano em células HEK293 com ou sem exposição ao virus Sendai. O promotor TATA-box e conhecido potenciador proximal 10 pode ser claramente identificada como regi rica em informaçõesons de um modo dependente de vírus. <img alt="Figura 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Figura 3 Tag-Seq reprodutibilidade. Gráficos de dispersão que mostram exemplos de dados de tag-Seq de dois transfections réplicas independentes com alta (A) e baixa (B) reprodutibilidade. A última trama mostra muitas marcas de outlier com contagens elevadas de ARNm em apenas uma das duas repetições. Tais artefactos tipicamente indicam que as concentrações de ARNm repórter foram demasiado baixos para a amplificação de PCR quantitativa, quer devido a baixas actividades absolutas entre as construções repórter, ou baixos níveis de eficiência de transfecção. <img alt="Figura 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> Figura 4. Informação pegada do local de início da transcrição ifnb humano e potenciador proximal. </strong&gt; Cerca de 37.000 variantes aleatórios de uma região de 145 nucleótidos (nt) a montante do gene humano ifnb foram ensaiadas usando MPRA em células HEK293 com (A) e sem (B) exposição a vírus de Sendai. As barras azuis mostrar a informação mútua entre a saída do repórter e as sequências de nucleótidos em cada posição. O potenciador proximal e caixa TATÁ destacam como regiões com elevado teor de informação, por infecção viral.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Ensaios Repórter Massively Parallel em células de mamíferos cultivadas

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.4K visualizações.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Vídeo: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Trypsinizing and Subculturing Mammalian Cells

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in cell death. The first step in subculturing is to detach cells from the surface of the primary culture vessel by trypsinization or mechanical means. The resultant cell suspension is then subdivided, or reseeded, into fresh cultures. Secondary cultures are checked for growth and fed periodically, and may be subsequently subcultured to produce tertiary cultures. The time between passaging of cells varies with the cell line and depends on the growth rate.

As cells reach confluency, they must be subcultured or passaged. This video will demonstrate a procedure for subculturing both adherent and suspension cells.

Trypsinizing e Subcultura células de mamíferos

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

Biologia

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

EsiRNA MISSÃO para a seleção RNAi em células de mamíferos

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

MISSION LentiPlex Pooled shRNA Library Screening in Mammalian Cells

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies.
There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids 1. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library.
The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes 2. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 108 TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification.
Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line 3, 4. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

Here we use a human LentiPlex pooled library and traditional sequencing methods to identify gene targets promoting cell survival. We demonstrate how to set up and deconvolute a LentiPlex screen and validate the results.

LentiPlex MISSÃO Pooled shRNA Screening Biblioteca em células de mamíferos

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to ...

Analysis of Cell Cycle Position in Mammalian Cells

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of cell proliferation underlies the pathology of diseases like cancer. As such there is great need to be able to investigate cell proliferation and quantitate the proportion of cells in each phase of the cell cycle. It is also of vital importance to indistinguishably identify cells that are replicating their DNA within a larger population. Since a cell&prime;s decision to proliferate is made in the G1 phase immediately before initiating DNA synthesis and progressing through the rest of the cell cycle, detection of DNA synthesis at this stage allows for an unambiguous determination of the status of growth regulation in cell culture experiments.
DNA content in cells can be readily quantitated by flow cytometry of cells stained with propidium iodide, a fluorescent DNA intercalating dye. Similarly, active DNA synthesis can be quantitated by culturing cells in the presence of radioactive thymidine, harvesting the cells, and measuring the incorporation of radioactivity into an acid insoluble fraction. We have considerable expertise with cell cycle analysis and recommend a different approach. We Investigate cell proliferation using bromodeoxyuridine/fluorodeoxyuridine (abbreviated simply as BrdU) staining that detects the incorporation of these thymine analogs into recently synthesized DNA. Labeling and staining cells with BrdU, combined with total DNA staining by propidium iodide and analysis by flow cytometry1 offers the most accurate measure of cells in the various stages of the cell cycle. It is our preferred method because it combines the detection of active DNA synthesis, through antibody based staining of BrdU, with total DNA content from propidium iodide. This allows for the clear separation of cells in G1 from early S phase, or late S phase from G2/M. Furthermore, this approach can be utilized to investigate the effects of many different cell stimuli and pharmacologic agents on the regulation of progression through these different cell cycle phases.
In this report we describe methods for labeling and staining cultured cells, as well as their analysis by flow cytometry. We also include experimental examples of how this method can be used to measure the effects of growth inhibiting signals from cytokines such as TGF-&beta;1, and proliferative inhibitors such as the cyclin dependent kinase inhibitor, p27KIP1. We also include an alternate protocol that allows for the analysis of cell cycle position in a sub-population of cells within a larger culture5. In this case, we demonstrate how to detect a cell cycle arrest in cells transfected with the retinoblastoma gene even when greatly outnumbered by untransfected cells in the same culture. These examples illustrate the many ways that DNA staining and flow cytometry can be utilized and adapted to investigate fundamental questions of mammalian cell cycle control.

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol. We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

Análise da posição do ciclo celular em células de mamíferos

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of ...

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum (ER). However, the visualization of these mRNAs can be challenging. This is especially true when only a fraction of the mRNA is ER-associated and their distribution to this organelle is obstructed by non-targeted (i.e. "free") transcripts. In order to monitor ER-associated mRNAs, we have developed a method in which cells are treated with a short exposure to a digitonin extraction solution that selectively permeabilizes the plasma membrane, and thus removes the cytoplasmic contents, while simultaneously maintaining the integrity of the ER. When this method is coupled with fluorescent in situ hybridization (FISH), one can clearly visualize ER-bound mRNAs by fluorescent microscopy. Using this protocol the degree of ER-association for either bulk poly(A) transcripts or specific mRNAs can be assessed and even quantified. In the process, one can use this assay to investigate the nature of mRNA-ER interactions.

Here we describe a method to visualize endoplasmic reticulum-associated mRNAs in mammalian tissue culture cells. This technique involves the selective permeabilization of the plasma membrane with digitonin to remove cytoplasmic contents followed by fluorescent in situ hybridization to detect either bulk poly(A) mRNA or specific transcripts.

Visualização de mRNAs retículo endoplasmático localizados em células de mamíferos

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum ...

Chromosome Preparation From Cultured Cells

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as fluorescence in situ hybridization (FISH), this assay has the powerful ability to analyze individual cells for aberrations that involve gains or losses of portions of the genome&#160;and rearrangements involving one or more chromosomes. In humans, chromosome abnormalities occur in approximately 1 per 160 live births1,2, 60-80% of all miscarriages3,4, 10% of stillbirths2,5, 13% of individuals with congenital heart disease6, 3-6% of infertility cases2, and in many patients with developmental delay&#160;and birth defects7. Cytogenetic analysis of malignancy is routinely used by researchers and clinicians, as observations of clonal chromosomal abnormalities have been shown to have both diagnostic and prognostic significance8,9.&#160; Chromosome isolation is invaluable for gene therapy and stem cell research of organisms including nonhuman primates and rodents10-13.
Chromosomes can be isolated from cells of live tissues, including blood lymphocytes, skin fibroblasts, amniocytes, placenta, bone marrow, and tumor specimens. Chromosomes are analyzed at the metaphase stage of mitosis, when they are most condensed and therefore more clearly visible. The first step of the chromosome isolation technique involves the disruption of the spindle fibers by incubation with Colcemid, to prevent the cells from proceeding to the subsequent anaphase stage. The cells are then treated with a hypotonic solution and preserved in their swollen state with Carnoy&#39;s fixative. The cells are then dropped on to slides and can then be utilized for a variety of procedures. G-banding involves trypsin treatment followed by staining with Giemsa to create characteristic light and dark bands. The same procedure to isolate chromosomes can be used for the preparation of cells for procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY)14,15.

Chromosomes can be isolated from live cells such as lymphocytes or skin fibroblasts, and from organisms including humans or mice. These chromosome preparations can be further utilized for routine G-banding and molecular cytogenetic procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY).

Cromossomo Preparação a partir de células cultivadas

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as ...

Viability Assays for Cells in Culture

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized viability assays are expensive in terms of equipment but can be faster and more objective than manual cell counts. The present report describes the use of three such viability assays. Two of these assays are infrared and one is luminescent. Both infrared assays rely on a 16&#160;bit Odyssey Imager. One infrared assay uses the DRAQ5 stain for nuclei combined with the Sapphire stain for cytosol and is visualized in the 700 nm channel. The other infrared assay, an In-Cell Western, uses antibodies against cytoskeletal proteins (&#945;-tubulin or microtubule associated protein 2) and labels them in the 800 nm channel. The third viability assay is a commonly used luminescent assay for ATP, but we use a quarter of the recommended volume to save on cost. These measurements are all linear and correlate with the number of cells plated, but vary in sensitivity. All three assays circumvent time-consuming microscopy and sample the entire well, thereby reducing sampling error. Finally, all of the assays can easily be completed within one day of the end of the experiment, allowing greater numbers of experiments to be performed within short timeframes. However, they all rely on the assumption that cell numbers remain in proportion to signal strength after treatments, an assumption that is sometimes not met, especially for cellular ATP. Furthermore, if cells increase or decrease in size after treatment, this might affect signal strength without affecting cell number. We conclude that all viability assays, including manual counts, suffer from a number of caveats, but that computerized viability assays are well worth the initial investment. Using all three assays together yields a comprehensive view of cellular structure and function.

Therapeutic compounds are often first examined in vitro with viability assays. Blind cell counts by a human observer can be highly sensitive to small changes in cell number but do not assess function. Computerized viability assays, as described here, can assess both structure and function in an objective manner.

Ensaios de viabilidade para células em cultura

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized ...

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Detectando somáticas Genéticos Alterações em amostras de tumor por Exon Captura e Seqüenciamento Massively Parallel

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Visualization of Endoplasmic Reticulum Subdomains in Cultured Cells

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and functions despite the intense interorganelle molecular traffic. The techniques described in this paper are powerful means of studying protein and lipid mobility and trafficking in vivo and in their physiological environment. Fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP) are widely used live-cell imaging techniques for studying intracellular trafficking through the exo-endocytic pathway, the continuity between organelles or subcompartments, the formation of protein complexes, and protein localization in lipid microdomains, all of which can be observed under physiological and pathological conditions. The limitations of these approaches are mainly due to the use of fluorescent fusion proteins, and their potential drawbacks include artifactual over-expression in cells and the possibility of differences in the folding and localization of tagged and native proteins. Finally, as the limit of resolution of optical microscopy (about 200 nm) does not allow investigation of the fine structure of the ER or the specific subcompartments that can originate in cells under stress (i.e. hypoxia, drug administration, the over-expression of transmembrane ER resident proteins) or under pathological conditions, we combine live-cell imaging of cultured transfected cells with ultrastructural analyses based on transmission electron microscopy.

We describe the imaging approaches we use to investigate the distribution and mobility of the transfected fluorescent proteins resident in the endoplasmic reticulum (ER) by means of the confocal imaging of living cells. We also ultrastructurally analyze the effect of their expression on the architecture of this subcellular compartment.

Visualização do retículo endoplasmático Subdomains em células cultivadas

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Screening siRNA identificar Ubiquitin e ubiquitina-como reguladores do sistema de caminhos biológicos em células de mamíferos cultivadas

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...