Name: massively parallel reporter assays in cultured mammalian cells
Uploaded: 2014-08-17T16:00:00.000+00:00
Duration: 11 min 3 s
Description: Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Este trabalho foi financiado pelo Instituto Nacional de Pesquisa do Genoma Humano dos Institutos Nacionais de Saúde sob Award Número R01HG006785.

1 Seqüência de Projeto e Síntese <ol><li> Comece MPRA com o desenho e síntese de sequências a ser testado para a actividade reguladora. Para compatibilidade com a série vector pMPRA, projetar cada seqüência usando o seguinte modelo: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- tag -AGATCGGAAGAGCGTCG-3 &#39;, onde var denota a seqüência a ser analisada e tag denota uma ou mais marcas de identificação. </li><li> As duas regiões variáveis ​​(e var tag) são separados por um par de Kpnl (GGTACC) e XbaI (TCTAGA) locais de restrição para facilitar a ligação direccional de um fragmento do gene repórter entre eles. Além disso, dois locais distintos Sfil (GGCCNNNNNGGCC) será adicionado por PCR para permitir a ligação direccional no esqueleto pMPRA. As regiões variáveis ​​não devem conter cópias adicionais de qualquer destes locais de restrição. Se necessário, uma ou mais destas enzimas de restrição pode ser substituído, Desde que as substituições 1) permitir que o corte eficaz perto das extremidades de moléculas de DNA, e 2) não cortar em outros lugares na sequência do vector. Veja a discussão para obter detalhes adicionais. </li><li> Obter os iniciadores necessários listados na Tabela 1 a partir de um fornecedor comercial. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [índice] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tabela 1 sequências de primer. [Índice] denota uma seqüência de índice 6-8 nt utilizado para seqüenciamento multiplexado. Obter pelo menos 8 primers TagSeq-P2 com diferentes índices. Todosdos iniciadores deve ser purificado por HPLC ou PAGE. <ol start="4"><li> Bibliotecas oligonucleotídicas podem ser obtidas a partir de um vendedor ou de núcleo instalação comercial, ou gerado usando um sintetizador de oligonucleótidos baseada microarray programável, tal como descrito pelo fabricante. Ressuspender os produtos OLS em 100 ul de tampão TE 0,1. </li><li> Executar as bibliotecas de oligonucleótidos sobre um 10% de TBE-ureia desnaturante em gel de poliacrilamida. Coloque cerca de 1 pmol por pista e mancha com mancha fluorescente ssDNA-sensível para avaliar a sua qualidade (Figura 2A). </li><li> Se uma banda discreta correspondente aos oligonucleótidos de comprimento completo pode ser visualizado (Figura 2A, pistas 1 e 2), excisar a fatia de gel correspondente a acrilamida e eluir oligonucleótidos em 100 ul de TE 0,1 durante a noite à temperatura ambiente com agitação. Caso contrário, continue usando o OLS suspensão de matéria. </li><li> Amplificar e adicionar caudas Sfil para a biblioteca oligonucleotídeo utilizando emulsão PCR 9 </<html> sup&gt;. </li><li> Defina-se 50 ul de misturas de reacção de PCR como descrito na Tabela 2. Em seguida combinam-se com 300 ul mistura de óleo e agente tensioactivo da emulsão e ADN Micellula kit de purificação e de vórtice durante 5 min a 4 ° C. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Reagente </td><td> 1x Volume (uL) </td></tr><tr><td> Herculase II Fusão ADN Polimerase </td><td> 0,5 </td></tr><tr><td> Tampão de reacção 5x Herculase II </td><td> 10 </td></tr><tr><td> de dNTP (10 mM cada) </td><td> 1,25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1,25 </td></tr><tr><td> MPRA_SfiI_F Primer (25 uM) </td><td> 0,25 </td></tr><tr><td> MPRA_SfiI_R Primer (25 uM) </td><td> 0,25 </td></tr><tr><td> Modelo OLS (1-10 attomol) </td><td> varia </td></tr><tr><td> Água livre de nuclease </td><td> 50 </td></tr></tbody></table>ve_content &quot;&gt; Tabela 2 Emulsão mistura de reacção de PCR (fase aquosa). <ol start="9"><li> Utilizar a concentração que dá o máximo de rendimento de produtos de amplificação, sem o aparecimento de artefactos (ver secção 1.12). </li><li> Dispensar a emulsão resultante em tubos de PCR e executar 20 ciclos de PCR (2 minutos a 95 ° C, 20 x [20 s a 95 ° C, 20 seg a 55 ° C, 30 segundos a 72 ° C], 3 min a 95 ° C). </li><li> Piscina e romper cada emulsão de reacção de PCR de 350 ul por adição de 1 ml de isobutanol e brevemente vórtex e, em seguida, purificar o produto de amplificação, utilizando uma coluna de purificação de ADN. </li><li> Executar uma aliquota sobre um gel de agarose a 2% ou 4% para verificar a amplificação livre de artefacto (Figura 2B). </li></ol><img alt="Figura 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Figura 2: Preparação de bibliotecas de síntese de oligonucleótidos. UM) </sTrong&gt; Três bibliotecas síntese oligonucleotídeo matérias diferentes (MQO) executado em desnaturante 10% TBE-uréia géis de poliacrilamida. As bandas correspondentes a oligonucleótidos de comprimento total (*) pode ser visualizada e excisada a partir de bibliotecas de 1 e 2 Biblioteca 3 contém os contaminantes que interferem com a purificação PAGE. Se este for o caso, seguir diretamente para a amplificação de PCR. B) produtos de aberto e de emulsão de amplificação por PCR da mesma biblioteca de oligonucleótidos corrida num gel de agarose. Amplificação por PCR de bibliotecas de oligonucleotídeos complexas freqüentemente cria produtos quiméricos e outros artefatos que podem aparecer como bandas superiores e inferiores. Emulsão PCR pode minimizar esses artefatos. 2 Construção da Biblioteca <ol><li> Prepara-se uma estrutura do plasmideo linearizado por digestão com Sfil pMPRA1 vector a 50 ° C durante 2 horas, corrido num gel de agarose a 1%, excisão da banda de espinha dorsal (neste caso, de 2,5 kb) e purificá-lo através de uma coluna de gel de spin-purificação. </li><li> Digestos produtos de PCR a partir de emulsão passo 1.4 com Sfil a 50 ° C durante 2 horas e purificar por meio de colunas de purificação de ADN. </li><li> Para ligar a biblioteca de promotor-tag na estrutura do vector linearizado, configurar as reacções contendo 100 ng do produto de PCR digerido, 50 ng do esqueleto do vector linearizado e ADN-ligase de T4. Incubar durante a noite a 16 ° C e, em seguida, aquece-se a 65 ° C durante 20 minutos para inactivar a ligase. </li><li> Transformar E. coli com a reacção de ligação. Para preservar a complexidade biblioteca, visam obter pelo menos 10x mais ufc do que há combinações distintas promotor-tag na biblioteca projetada. </li><li> Quando o número total de marcadores é de aproximadamente 100.000, o ufc alvo pode normalmente ser conseguido através da realização de transformações paralelas 6-8 por biblioteca. </li><li> Para cada transformação, combinar 50 ul electrocompetentes E. As células de E. coli com 2 ul de mistura de ligação em gelo. Transformar por electroporação, recuperar as células em 800 ul SOCpor meio de agitação a 37 ° C durante 1 hora, e, em seguida, combinam as células a partir das transformações paralelas. </li><li> Para avaliar a eficiência da transformação, placa de diluições em série a partir de uma alinquot de células recuperadas em placas de LB-agar com 50-100 ug / ml de carbenicilina e incubar durante a noite a 37 ° C. Estimar ufc totais (CFU observada) x (factor de diluição) x (V - V) / V, em que V é o volume total de células recuperado e v é o volume da alíquota para as diluições em série. </li><li> Ao mesmo tempo, utilizar o restante das células recuperadas para inocular 200 ml de LB suplementado com 100 ug / ml de carbenicilina. Crescer as células a 37 ° C durante a noite numa incubadora com agitador e, em seguida, isolar o ADN de plasmídeo de acordo com procedimentos normalizados. </li><li> Digerir uma aliquota do plasmídeo da biblioteca isolado com Sfil a 50 ° C durante 2 horas e separado num gel de agarose a 1% para confirmar a presença dos insertos. </li><li> Linearizar o plasmídeo da biblioteca por cutting entre as variantes do promotor e tags usando Kpnl e Xbal. Para maximizar a eficiência da digestão, realizar digestões de série: </li><li> Primeiro, digerir com Kpnl a 37 ° C durante 1 hora e purificar usando esferas magnéticas. Em segundo lugar, digerir com Xbal com adição de 1 U de fosfatase alcalina de camarão a 37 ° C durante 2 horas, o calor inactiva a 65 ° C durante 5 min, e em seguida purificar usando esferas magnéticas. </li><li> Executar uma aliquota sobre um gel de agarose a 1% para verificar a linearização completa. Se o plasmídeo não cortado é visível, o fragmento linearizado deve ser purificado em gel. </li><li> Para gerar uma biblioteca MPRA adequado para transfecção em células de mamíferos, ligar uma ORF com KpnI / XbaI extremidades -compatível na biblioteca intermediário linearizado. </li><li> Para preparar um fragmento ORF luc2 compatível de pMPRAdonor1, digerir este plasmídeo com Kpnl e Xbal a 37 ° C durante 1 hora e corrido num gel de agarose a 1%. Extirpar o fragmento ORF (1,7 kb neste caso) e purifica-se utilizando uma coluna de gel de purificação de centrifugação. </li><li> Clonar o fragmento do ORF na biblioteca intermediário linearizado como descrito nos passos 2,3-2,8. </li><li> Digerir uma aliquota (correspondendo a 1-2 ng) da biblioteca MPRA com Kpnl a 37 ° C durante 1 hora e corrido num gel de agarose a 1%. Se a biblioteca digerido é executado como uma única banda, avance para a secção 3 Se forem observadas bandas adicionais (correspondendo tipicamente a transição de construções intermédios), a biblioteca pode ser ainda purificado como se segue: </li><li> Digerir 3-5 ug da biblioteca contaminado com Kpnl a 37 ° C durante 1 hora e corrido num gel de agarose a 0,8% durante a noite a 4 ° C. </li><li> Excisar a banda correcta biblioteca, purificar o ADN utilizando uma coluna de purificação de gel de rotação e realizar a auto-ligação de alta concentração utilizando a ligase de ADN de T4 a 37 ° C durante 1 hora. Em seguida, repetir a transformação e isolamento final, biblioteca de ADN, tal como descrito na etapa 2.8. </li></ol> 3 Transfection, perturbação, e Isolamento de RNA <ol><li> Para cada transfecção independentes, o número necessário de cultura de células (tal como determinado pela complexidade da biblioteca MPRA, ver discussão) em meio apropriado. Por exemplo, a cultura de células HEK293T / 17 em meio DMEM suplementado com 10% de FBS e L-glutamina / penicilina / estreptomicina. Células de cultura durante pelo menos duas transfecções independentes para cada biblioteca e condição experimental. </li><li> Transfectar as células cultivadas com plasmídeos MPRA. O método e as condições de transfecção deve ser optimizada para cada tipo de célula. Para cada uma das amostras transfectadas, reter-se uma alíquota (50-100 ng) de ADN de plasmídeo como controlo correspondente. </li><li> Por exemplo, transfectar 0,5 x 10 7 HEK293T / 17 células cultivadas para ~ 50% de confluência numa placa de cultura de 10 centímetros, com 10 ug de plasmídeo de DNA em 1 ml de Opti-MEM I Reduced Serum Medium, utilizando 30 ul de Lipofectamina LTX e 10 ul de reagente Além disso. Retirar a mistura de transfecção após 5 horas e permitir que océlulas recuperar durante 24-48 hr. </li><li> Opcionalmente, execute qualquer perturbação necessária para ativar seqüências regulatórias ao contexto ou dependentes de sinal na biblioteca projetada. </li><li> Colher as células e isolar ARN poli (A) + ARNm utilizando colunas padrão de oligo (dT) celulose ou pérolas utilizando as instruções do fabricante. </li><li> Assegure-se que a capacidade máxima de ligação das colunas ou grânulos exceder a quantidade total de ARNm esperado a partir das células colhidas. Por exemplo, o rendimento esperado da seção 3.3 é de cerca de 0,5-2,5 mg mRNA. </li></ol> 4. Tag-Seq <ol><li> Para eliminar o arraste de ADN do vector a partir dos lisados ​​de células transfectadas, o tratamento de cada uma das amostras de mRNA de 20 ul com 1 ul Turbo ADNase (2 U) e 2,3 ul de tampão 10x turbo ADNase a 37 ° C durante 1 h, adicionar 2,4 mL de reagente de DNase Turbo Inactivação pelo RT durante 5 min, com agitação, de centrifugação a 10.000 g durante 90 segundos, e, em seguida, transferir a solução para um tubo fresco. </li><li> Verifique<html> pureza através da realização de PCR, como descrito na secção 4.6 em 60-100 ng de cada amostra de mRNA, e depois executar os produtos em gel de agarose. Se os fragmentos específicos são visíveis (0,25 kb se usando pMPRA1 com luc2), coluna de purificar o mRNA tratada e, em seguida, repetir o tratamento DNase. </li><li> Para gerar bibliotecas de sequenciamento Tag-Seq, converter mRNA repórter de cDNA e adicione adaptadores de sequenciamento por PCR. </li><li> Defina-se misturas de iniciadores de ARNm / IF, tal como descrito na Tabela 3. Incubar a 65 ° C durante 5 min, em seguida, colocar em gelo. Em paralelo, criar reacções de síntese de cDNA, como descrito na Tabela 4. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (uL) </td></tr><tr><td> amostra de ARNm (400-700 ng total) </td><td> 8 </td></tr><tr><td> Oligo-0DT (50 uM) </td><td> 1 </td></tr><tr><td> de dNTP (10 mM cada) </td><td> 1 </td></tr></tbody></table>ove_content &quot;&gt; Tabela 3 ARN / transcrição reversa mistura de iniciadores para a síntese de cDNA. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (uL) </td></tr><tr><td> 10x SuperScript III RT buffer </td><td> 2 </td></tr><tr><td> MgCl2 (25 mM) </td><td> 4 </td></tr><tr><td> DTT (0,1 M) </td><td> 2 </td></tr><tr><td> RNaseOut (40 U / ul) </td><td> 1 </td></tr><tr><td> SuperScript III (200 U / ul) </td><td> 1 </td></tr></tbody></table> Tabela 4 Mistura de reacção de síntese de cDNA. <ol start="5"><li> Suavemente combinar ARNm / RT iniciador mistura com misturas de síntese de cDNA. Incubar a 50 ° C durante 50 min, 85 ° C durante 5 min e, em seguida, colocar em gelo. Finalmente, incubar com 2 U de ribonuclease H, a 37 ° C durante 20 min. </li><li> Defina-se reacções de PCR como descrito na Tabela 5 com 4-6 ulmistura de reacção de cDNA ou 50 ng de plasmídeo repórter como modelos. Em seguida, realizar a amplificação por PCR (95 ° C durante 2 min, 26 x [95 ° C durante 30 seg, 55 ° C durante 30 seg, 72 ° C durante 30 seg], 72 ° C durante 3 min). </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagente </td><td> 1x Volume (uL) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> TagSeq_P1 Primer (25 uM) </td><td> 0,5 </td></tr><tr><td> TagSeq_P2 Primer (25 uM) </td><td> 0,5 </td></tr><tr><td> Molde (mRNA, cDNA ou a mistura de ADN de plasmídeo) </td><td> varia </td></tr><tr><td> Água livre de nuclease </td><td> 50 </td></tr></tbody></table> Tabela 5 mix reação Tag-Seq PCR. <ol start="7"><li> Executar os produtos de PCR através de um gel de agarose a 2%, faixas especiais de consumo correspondentes aos amplicons biblioteca de tags-Seq (0,25 kb se usandopMPRA1 com luc2) e purificar estas usando colunas de giro de purificação em gel. </li><li> Pool, desnaturar e sequenciar os amplicons Tag-Seq purificadas diretamente com um instrumento seqüenciamento Illumina. </li><li> Filtro de baixa qualidade lê, removendo tudo o que a) conter um ou mais posição com uma qualidade Phred pontuação inferior a 30 dentro da tag seqüenciado ou b) não corresponde exatamente a tag projetado. Conte o número de vezes que cada etiqueta restante aparece em cada biblioteca. Normalizar as contagens de tag de TPM (tags por milhão de etiquetas sequenciados) e, em seguida, calcular a relação de contagem de tag ARNm derivados sobre contagens tag derivado de plasmídeo para cada par de bibliotecas de sequenciação. Se várias marcas diferentes foram ligados a cada variante de sequência, use os seus rácios médios para análise a jusante. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Os autores declaram que não têm interesses financeiros concorrentes.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Ensaios Repórter Massively Parallel (MPRA) permitem a medição multiplexado das atividades de regulação transcricional de milhares a centenas de milhares de seqüências de DNA 1 a 7. Na sua aplicação mais comum, a multiplexação é obtida por acoplamento de cada sequência de interesse de um gene repórter sintético que contém uma marca de identificação de sequência a jusante de uma grelha de leitura aberta (ORF, Figura 1). Após a transfecção, o isolamento do RNA e profunda seqüenciamento de extremidades 3 &#39;dos ​​transcritos do gene repórter, as atividades relativas das sequências acopladas pode ser inferida a partir da abundância relativa de suas etiquetas de identificação. <img alt="Figura 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> Figura 1 Visão de MPRA. Uma biblioteca de MPRA repórter constrói é construído acoplando sequências regulatórias putativos para sintéticogenes repórter que são constituídas por uma &quot;inerte&quot; (ORF tais como GFP ou luciferase), seguido por uma sequência de marcação de identificação. A biblioteca é transfectado em massa para uma população de células cultivadas e o ARNm transcrito repórter é subsequentemente recuperado. Sequenciação profunda é utilizado para contar o número de ocorrências de cada etiqueta de entre os ARNm e os plasmídeos repórter transfectadas. A proporção de ARNm conta sobre contagens de plasmídeo pode ser usada para inferir a actividade da sequência reguladora correspondente. Adaptado com permissão de Melnikov, et al 2. MPRA podem ser adaptadas a uma ampla variedade de modelos experimentais, incluindo 1) mutagénese global de elementos reguladores de genes individuais, 2) para digitalização através de novos elementos reguladores um locus de interesse, 3) para testar o efeito da variação genética natural em um conjunto de putativas promotores, intensificadores ou silenciadores, e 4) engenharia semi-racional de elementos reguladores sintéticos. LiAs variantes da sequência de braries pode ser gerado utilizando uma variedade de métodos, incluindo síntese de biblioteca de oligonucleótidos (OLS) em microarrays programáveis ​​2,3,6,7, montagem de oligonucleótidos degenerados, 1,4 ligadura combinatória 8 e fragmentação do ADN genómico 5. Este protocolo descreve a construção de uma biblioteca de variantes do promotor utilizando MQO e os vectores e pMPRA1 pMPRAdonor1 (Addgene IDs de 49349 e 49352, respectivamente; http://www.addgene.org), a transfecção transiente desta biblioteca em células de mamífero de cultura e quantificação subsequente das atividades promotoras de profunda seqüenciamento de suas marcas associadas (Tag-Seq). Versões anteriores deste protocolo foram utilizados na pesquisa, publicada na Melnikov et al. Nature Biotechnology 30, 271-277 (2012) e em Kheradpour et al. Genome Research 23, 800-811 (2013).

<table><tbody><tr><td>Oligonucleotide library synthesis</td><td>Agilent, CustomArray, or other OLS vendors</td><td>custom</td><td>If using OLS construction method</td></tr><tr><td>pMPRA1</td><td>Addgene</td><td>49349</td><td>MPRA plasmid backbone</td></tr><tr><td>pMPRAdonor1</td><td>Addgene</td><td>49352</td><td>luc2 ORF donor plasmid</td></tr><tr><td>TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td><td>Generic</td><td>n/a</td><td>OLS buffer</td></tr><tr><td>Novex TBE-Urea Gels, 10%</td><td>Life Technologies</td><td>EC6875BOX</td><td>PAGE purification of OLS products</td></tr><tr><td>Novex TBA-Urea Sample Buffer</td><td>Life Technologies</td><td>LC6876</td><td>PAGE purification of OLS products</td></tr><tr><td>SYBR Gold Nucleic Acid Gel Stain</td><td>Life Technologies</td><td>S-11494</td><td>PAGE purification of OLS products</td></tr><tr><td>Micellula DNA Emulsion &amp;amp; Purification Kit</td><td>EURx/CHIMERx</td><td>3600-01</td><td>Library amplification by emulsion PCR</td></tr><tr><td>Herculase II Fusion DNA Polymerase</td><td>Agilent</td><td>600675</td><td>Polymerase for emulsion PCR</td></tr><tr><td>SfiI</td><td>New England Biolabs</td><td>R0123S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>KpnI-HF</td><td>New England Biolabs</td><td>R3142S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>XbaI</td><td>New England Biolabs</td><td>R0145S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>T4 DNA Ligase (2,000,000 units/ml)</td><td>New England Biolabs</td><td>M0202T</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>One Shot TOP10 Electrocomp &lt;em&gt;E. coli&lt;/em&gt;</td><td>Life Technologies</td><td>C4040-50</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>LB agar and liquid media with carbenicllin</td><td>Generic</td><td>n/a</td><td>Growth media for cloning</td></tr><tr><td>E-Gel EX Gels 1%</td><td>Life Technologies</td><td>G4010-01</td><td>Library verification and purification</td></tr><tr><td>E-Gel EX Gels, 2%</td><td>Life Technologies</td><td>G4010-02</td><td>Library verification and purification</td></tr><tr><td>MinElute Gel Extraction Kit</td><td>Qiagen</td><td>28604</td><td>Library and backbone purification</td></tr><tr><td>EndoFree Plasmid Maxi Kit</td><td>Qiagen</td><td>12362</td><td>Library DNA isolation</td></tr><tr><td>Cell culture media</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>Transfection reagents</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>MicroPoly(A)Purist Kit</td><td>Life Technologies</td><td>AM1919</td><td>mRNA isolation</td></tr><tr><td>TURBO DNA-free Kit</td><td>Life Technologies</td><td>AM1907</td><td>Plasmid DNA removal</td></tr><tr><td>SuperScript III First-Strand Synthesis System</td><td>Life Technologies</td><td>18080-051</td><td>cDNA synthesis</td></tr><tr><td>PfuUltra II Hotstart PCR Master Mix</td><td>Agilent</td><td>600850</td><td>Polymerase for Tag-Seq PCR</td></tr><tr><td>Primers (see text)</td><td>IDT</td><td>custom</td><td>PAGE purify Tag-Seq primers</td></tr></tbody></table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA facilita alta resolução, dissecção quantitativa das relações de elementos reguladores da transcrição seqüência de atividades. Um experimento MPRA bem sucedido irá tipicamente produzir medições altamente reprodutíveis para a maioria das sequências na biblioteca transfectadas (Figura 3A). Se for observada uma fraca reprodutibilidade (Figura 3B), isto é indicativo de uma muito baixa concentração de mRNAs repórter nas amostras de RNA recuperado, devido ou a 1) reduzida actividade absoluta entre as sequências ensaiadas, ou 2) a baixa eficiência de transfecção. A Figura 4 mostra uma representação &quot;pegada informações&quot; 1,2 gerado por ensaio ~ 37.000 variantes aleatórias de uma sequência de 145 pb a montante do gene ifnb humano em células HEK293 com ou sem exposição ao virus Sendai. O promotor TATA-box e conhecido potenciador proximal 10 pode ser claramente identificada como regi rica em informaçõesons de um modo dependente de vírus. <img alt="Figura 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Figura 3 Tag-Seq reprodutibilidade. Gráficos de dispersão que mostram exemplos de dados de tag-Seq de dois transfections réplicas independentes com alta (A) e baixa (B) reprodutibilidade. A última trama mostra muitas marcas de outlier com contagens elevadas de ARNm em apenas uma das duas repetições. Tais artefactos tipicamente indicam que as concentrações de ARNm repórter foram demasiado baixos para a amplificação de PCR quantitativa, quer devido a baixas actividades absolutas entre as construções repórter, ou baixos níveis de eficiência de transfecção. <img alt="Figura 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> Figura 4. Informação pegada do local de início da transcrição ifnb humano e potenciador proximal. </strong&gt; Cerca de 37.000 variantes aleatórios de uma região de 145 nucleótidos (nt) a montante do gene humano ifnb foram ensaiadas usando MPRA em células HEK293 com (A) e sem (B) exposição a vírus de Sendai. As barras azuis mostrar a informação mútua entre a saída do repórter e as sequências de nucleótidos em cada posição. O potenciador proximal e caixa TATÁ destacam como regiões com elevado teor de informação, por infecção viral.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Ensaios Repórter Massively Parallel em células de mamíferos cultivadas

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.4K visualizações.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Vídeo: Massively Parallel Reporter Assays in Cultured Mammalian Cells

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in vitro analysis are well suited to study of large numbers of cells (&ge;105) in milliliter-scale volumes (&ge;0.1 ml). However, there are many instances in which it is necessary or desirable to scale down culture size to reduce consumption of the cells of interest and/or reagents required for their culture, stimulation, or processing. Unfortunately, conventional approaches do not support precise and reproducible manipulation of micro-scale cultures, and the microfluidics-based automated systems currently available are too complex and specialized for routine use by most laboratories. To address this problem, we have developed a simple and versatile technology platform for automated culture, stimulation, and recovery of small populations of cells (100 - 2,000 cells) in micro-scale volumes (1 - 20 &mu;l). The platform consists of a set of fibronectin-coated microcapillaries ("cell perfusion chambers"), within which micro-scale cultures are established, maintained, and stimulated; a digital microfluidics (DMF) device outfitted with "transfer" microcapillaries ("central hub"), which routes cells and reagents to and from the perfusion chambers; a high-precision syringe pump, which powers transport of materials between the perfusion chambers and the central hub; and an electronic interface that provides control over transport of materials, which is coordinated and automated via pre-determined scripts. As an example, we used the platform to facilitate study of transcriptional responses elicited in immune cells upon challenge with bacteria. Use of the platform enabled us to reduce consumption of cells and reagents, minimize experiment-to-experiment variability, and re-direct hands-on labor. Given the advantages that it confers, as well as its accessibility and versatility, our platform should find use in a wide variety of laboratories and applications, and prove especially useful in facilitating analysis of cells and stimuli that are available in only limited quantities.

We have developed an automated cell culture and interrogation platform for micro-scale cell stimulation experiments. The platform offers simple, versatile, and precise control in cultivating and stimulating small populations of cells, and recovering lysates for molecular analyses. The platform is well suited to studies that use precious cells and/or reagents.

A plataforma automatizada versátil para experiências de estimulação Micro escala celulares

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in ...

Bioengenharia

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

Otimizando a incorporação genética do produto químico sondas em GPCRs para mapeamento de foto-reticulação e opaco química em células de mamíferos vivas

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

Química

A Multiplexed Luciferase-based Screening Platform for Interrogating Cancer-associated Signal Transduction in Cultured Cells

Genome-scale interrogation of gene function using RNA interference (RNAi) holds tremendous promise for the rapid identification of chemically tractable cancer cell vulnerabilities. Limiting the potential of this technology is the inability to rapidly delineate the mechanistic basis of phenotypic outcomes and thus inform the development of molecularly targeted therapeutic strategies. We outline here methods to deconstruct cellular phenotypes induced by RNAi-mediated gene targeting using multiplexed reporter systems that allow monitoring of key cancer cell-associated processes. This high-content screening methodology is versatile and can be readily adapted for the screening of other types of large molecular libraries.

Achieving a systems level understanding of cellular processes is a goal of modern-day cell biology. We describe here strategies for multiplexing luciferase reporters of various cellular function end-points to interrogate gene function using genome-scale RNAi libraries.

A plataforma de triagem baseada luciferase diversificadas para interrogar associados ao câncer transdução de sinal em células cultivadas

Genome-scale interrogation of gene function using RNA interference (RNAi)  holds tremendous promise for the rapid identification of chemically tractable  ...

Medicina

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since several decades, the sudden burst of multi- and extensively-drug resistant strains is a serious threat for the control of tuberculosis. Therefore, it is essential to identify new targets and pathways critical for the causative agent of the tuberculosis, Mycobacterium tuberculosis (Mtb) and to search for novel chemicals that could become TB drugs. One approach is to set&#160;up methods suitable for the genetic and chemical screens of large scale libraries enabling the search of a needle in a haystack. To this end, we developed a phenotypic assay relying on the detection of fluorescently labeled Mtb within fluorescently labeled host&#160;cells using automated confocal microscopy. This in vitro assay allows an image based quantification of the colonization process of Mtb&#160;into the host and was optimized for the 384-well microplate format, which is proper for screens of siRNA-, chemical compound- or Mtb mutant-libraries. The images are then processed for multiparametric analysis, which provides read&#160;out inferring on the pathogenesis of Mtb&#160;within host cells.

Here, we describe a phenotypic assay applicable to the High-throughput/High-content screens of small-interfering synthetic RNA (siRNA), chemical compound, and Mycobacterium tuberculosis mutant libraries. This method relies on the detection of fluorescently labeled Mycobacterium tuberculosis within fluorescently labeled host&#160;cell using automated confocal microscopy.

Um ensaio fenotípico microscópico para quantificação de micobactérias intracelulares adaptadas para triagem de alto rendimento/alto conteúdo

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

Imunologia e Infecção

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

Um ensaio repórter para analisar a maturação intronic microRNA em células mamíferas

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

Pesquisa do câncer

High Throughput, Real-time, Dual-readout Testing of Intracellular Antimicrobial Activity and Eukaryotic Cell Cytotoxicity

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require several additional experimental steps prior to readout, such as cell lysis, colony forming unit determination, or reagent addition. When performing thousands of assays, for example, during high-throughput screening, the downstream effort required for these types of assays is considerable. Therefore, to facilitate high-throughput antimicrobial discovery, we developed a real-time assay to simultaneously identify inhibitors of intracellular bacterial growth and assess eukaryotic cell cytotoxicity. Specifically, real-time intracellular bacterial growth detection was enabled by marking bacterial screening strains with either a bacterial lux operon (1st generation assay) or fluorescent protein reporters (2nd generation, orthogonal assay). A non-toxic, cell membrane-impermeant, nucleic acid-binding dye was also added during initial infection of macrophages. These dyes are excluded from viable cells. However, non-viable host cells lose membrane integrity permitting entry and fluorescent labeling of nuclear DNA (deoxyribonucleic acid). Notably, DNA binding is associated with a large increase in fluorescent quantum yield that provides a solution-based readout of host cell death. We have used this combined assay to perform a high-throughput screen in microplate format, and to assess intracellular growth and cytotoxicity by microscopy. Notably, antimicrobials may demonstrate synergy in which the combined effect of two or more antimicrobials when applied together is greater than when applied separately. Testing for in vitro synergy against intracellular pathogens is normally a prodigious task as combinatorial permutations of antibiotics at different concentrations must be assessed. However, we found that our real-time assay combined with automated, digital dispensing technology permitted facile synergy testing. Using these approaches, we were able to systematically survey action of a large number of antimicrobials alone and in combination against the intracellular pathogen, Legionella pneumophila.

A high throughput, real-time assay was developed to simultaneously identify (1) eukaryotic cell-penetrant antimicrobials targeting an intracellular bacterial pathogen, and (2) assess eukaryotic cell cytotoxicity. A variation on the same technology was thereafter combined with digital dispensing technology to enable facile, high-resolution, dose-response, and two- and three-dimensional synergy studies.

High Throughput, em tempo real, Teste Dual-leitura dos intracelular Actividade Antimicrobiana e citotoxicidade celular eucariótica

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require ...

Monitoring Plasmid Replication in Live Mammalian Cells over Multiple Generations by Fluorescence Microscopy

Few naturally-occurring plasmids are maintained in mammalian cells. Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus (EBV) and Kaposi's Sarcoma-associated herpesvirus (KSHV), which cause multiple human malignancies 1-3. These two genomes are replicated in a licensed manner, each using a single viral protein and cellular replication machinery, and are passed to daughter cells during cell division despite their lacking traditional centromeres 4-8.
Much work has been done to characterize the replications of these plasmid genomes using methods such as Southern blotting and fluorescence in situ hybridization (FISH). These methods are limited, though. Quantitative PCR and Southern blots provide information about the average number of plasmids per cell in a population of cells. FISH is a single-cell assay that reveals both the average number and the distribution of plasmids per cell in the population of cells but is static, allowing no information about the parent or progeny of the examined cell.
Here, we describe a method for visualizing plasmids in live cells. This method is based on the binding of a fluorescently tagged lactose repressor protein to multiple sites in the plasmid of interest 9. The DNA of interest is engineered to include approximately 250 tandem repeats of the lactose operator (LacO) sequence. LacO is specifically bound by the lactose repressor protein (LacI), which can be fused to a fluorescent protein. The fusion protein can either be expressed from the engineered plasmid or introduced by a retroviral vector. In this way, the DNA molecules are fluorescently tagged and therefore become visible via fluorescence microscopy. The fusion protein is blocked from binding the plasmid DNA by culturing cells in the presence of IPTG until the plasmids are ready to be viewed.
This system allows the plasmids to be monitored in living cells through several generations, revealing properties of their synthesis and partitioning to daughter cells. Ideal cells are adherent, easily transfected, and have large nuclei. This technique has been used to determine that 84% of EBV-derived plasmids are synthesized each generation and 88% of the newly synthesized plasmids partition faithfully to daughter cells in HeLa cells. Pairs of these EBV plasmids were seen to be tethered to or associated with sister chromatids after their synthesis in S-phase until they were seen to separate as the sister chromatids separated in Anaphase10. The method is currently being used to study replication of KSHV genomes in HeLa cells and SLK cells. HeLa cells are immortalized human epithelial cells, and SLK cells are immortalized human endothelial cells. Though SLK cells were originally derived from a KSHV lesion, neither the HeLa nor SLK cell line naturally harbors KSHV genomes11. In addition to studying viral replication, this visualization technique can be used to investigate the effects of the addition, removal, or mutation of various DNA sequence elements on synthesis, localization, and partitioning of other recombinant plasmid DNAs.

A method of observing individual DNA molecules in live cells is described. The technique is based on the binding of a fluorescently tagged lac repressor protein to binding sites engineered into the DNA of interest. This method can be adapted to follow many recombinant DNAs in live cells over time.

Monitorando a replicação plasmídeo em células vivas de mamíferos longo de múltiplas gerações por microscopia de fluorescência

Few naturally-occurring plasmids are maintained in mammalian cells.  Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus  (EBV) ...

Biologia

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with Parkinson&#39;s disease. 293T cells are transiently transfected with plasmids from an arrayed ORF expression library, together with luciferase reporter plasmids, in a one-gene-per-well microplate format. Firefly luciferase activity is assayed after 48 hr to determine the effects of each library gene upon alpha-synuclein transcription, normalized to expression from an internal control construct (a hCMV promoter directing Renilla luciferase). This protocol is facilitated by a bench-top robot enclosed in a biosafety cabinet, which performs aseptic liquid handling in 96-well format. Our automated transfection protocol is readily adaptable to high-throughput lentiviral library production or other functional screening protocols requiring triple-transfections of large numbers of unique library plasmids in conjunction with a common set of helper plasmids. We also present an inexpensive and validated alternative to commercially-available, dual luciferase reagents which employs PTC124, EDTA, and pyrophosphate to suppress firefly luciferase activity prior to measurement of Renilla luciferase. Using these methods, we screened 7,670 human genes and identified 68 regulators of alpha-synuclein. This protocol is easily modifiable to target other genes of interest.

We present a rapid and inexpensive screening method for identifying transcriptional regulators using high-throughput robotic transfections and a homemade dual-glow luciferase assay. This protocol rapidly generates direct side-by-side functional data for thousands of genes and is easily modifiable to target any gene of interest.

De alta capacidade de Triagem funcional usando um caseiro Dual-brilho ensaio de luciferase

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Screening Peptides that Activate MRGPRX2 using Engineered HEK Cells

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new therapeutics. Mas related G-protein receptor-X2 (MRGPRX2) is an important receptor that regulates mast cell activation and, thus, directs the general immune response. Numerous ligands for MRGPRX2 have been identified and include endogenous peptides like PAMPs, defensins, LL-37 and other protein fragments (i.e., degraded albumin). Further identification of MRGPRX2 specific ligands requires the screening of a large number of peptides (i.e., peptide library); however, mast cells are difficult and expensive to maintain in vitro and, therefore, not economical to use for screening large numbers of molecules. The present paper demonstrates a method to design, develop, and screen a library of small peptide molecules using MRGPRX2 expressing HEK cells. This cell line is relatively easy and inexpensive to maintain and can be used for in vitro high-throughput analysis. A calcium sensitive Fura-2 fluorescent dye to mark intracellular calcium flux upon activation was used to monitor the activation. The ratio of fluorescence intensity of Fura-2 at 510 nm against excitation wavelengths of 340 and 380 nm was used to calculate calcium concentration. The peptide library used to verify this system was based on the endogenous proadrenomedullin N-terminal 12 (PAMP-12) secretagogue, which is known to bind MRGPRX2 with high specificity and affinity. Subsequent peptides were generated through amino acid truncation and alanine scanning techniques applied to PAMP-12. The method described here is simple and inexpensive yet robust for screening a large library of compounds to identify binding domains and other important parameters that play an important role in receptor activation.

Techniques for generating a library of short peptides that can activate mast cells via the MRGPRX2 receptor are described. Associated techniques are easy, inexpensive, and can be extended to other cell receptors.

Peptídeos de triagem que ativam mrgprx2 usando células HEK projetadas

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new ...

Autonomously Bioluminescent Mammalian Cells for Continuous and Real-time Monitoring of Cytotoxicity

Mammalian cell-based in vitro assays have been widely employed as alternatives to animal testing for toxicological studies but have been limited due to the high monetary and time costs of parallel sample preparation that are necessitated due to the destructive nature of firefly luciferase-based screening methods. This video describes the utilization of autonomously bioluminescent mammalian cells, which do not require the destructive addition of a luciferin substrate, as an inexpensive and facile method for monitoring the cytotoxic effects of a compound of interest. Mammalian cells stably expressing the full bacterial bioluminescence (luxCDABEfrp) gene cassette autonomously produce an optical signal that peaks at 490 nm without the addition of an expensive and possibly interfering luciferin substrate, excitation by an external energy source, or destruction of the sample that is traditionally performed during optical imaging procedures. This independence from external stimulation places the burden for maintaining the bioluminescent reaction solely on the cell, meaning that the resultant signal is only detected during active metabolism. This characteristic makes the lux-expressing cell line an excellent candidate for use as a biosentinel against cytotoxic effects because changes in bioluminescent production are indicative of adverse effects on cellular growth and metabolism. Similarly, the autonomous nature and lack of required sample destruction permits repeated imaging of the same sample in real-time throughout the period of toxicant exposure and can be performed across multiple samples using existing imaging equipment in an automated fashion.

Mammalian cells expressing the bacterial bioluminescence gene cassette (lux) produce light autonomously. The resulting bioluminescent dynamics upon chemical exposure have been demonstrated to reflect the treatment effects on cellular growth and metabolism, making these cells an inexpensive, continuous, real-time toxicity screening tool that can easily be adapted for high-throughput automation.

Células de mamíferos autonomamente bioluminescentes para monitoramento contínuo e em tempo real de citotoxicidade

Mammalian  cell-based in vitro assays have been  widely employed as alternatives to animal testing for toxicological studies but  have been limited due to ...