This work was supported by the National Human Genome Research Institute of the National Institutes of Health under Award Number R01HG006785.

1. Sequence Design and Synthesis
<ol>
	<li>Begin MPRA with the design and synthesis of sequences to be assayed for regulatory activity. For compatibility with the pMPRA vector series, design each sequence using the following template: 5&#8217;-ACTGGCCGCTTCACTG-var-GGTACCTCTAGA-tag-AGATCGGAAGAGCGTCG-3&#8217; where var denotes the sequence to be assayed and tag denotes one or more identifying tags.</li>
	<li>The two variable regions (var and tag) are separated by a pair of KpnI (GGTACC) and XbaI (TCTAGA) restriction sites to facilitate directional ligation of a reporter gene fragment between them. In addition, two distinct SfiI (GGCCNNNNNGGCC) sites will be added by PCR to allow directional ligation into the pMPRA backbone. The variable regions must not contain additional copies of any of these restriction sites. If necessary, one or more of these restriction enzymes can be replaced, as long as the replacements 1) allow efficient cutting close to the ends of DNA molecules, and 2) do not cut elsewhere in the vector sequence. See Discussion for additional details.</li>
	<li>Obtain the required primers listed in Table 1 from a commercial vendor.</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="381">
	<tbody>
		<tr>
			<td>MPRA_SfiI_F</td>
			<td>GCTAAGGGCCTAACTGGCCGCTTCACTG</td>
		</tr>
		<tr>
			<td>MPRA_SfiI_R</td>
			<td>GTTTAAGGCCTCCGTGGCCGACGCTCTTC&#160;</td>
		</tr>
		<tr>
			<td>TAGseq_P1</td>
			<td>AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT</td>
		</tr>
		<tr>
			<td>TAGseq_P2</td>
			<td>CAAGCAGAAGACGGCATACGAGAT[index]GTGAC TGGAGTTCAGACGTGTGCTCTTCCGATCTCGAG GTGCCTAAAGG</td>
		</tr>
	</tbody>
</table>
Table 1. Primer sequences. [index] denotes a 6 to 8 nt index sequence used for multiplexed sequencing. Obtain at least 8 TagSeq-P2 primers with different indices. All of the primers should be purified by HPLC or PAGE.
<ol start="4">
	<li>Oligonucleotide libraries can be obtained from a commercial vendor or core facility, or generated by using a programmable microarray-based oligonucleotide synthesizer as described by the manufacturer. Resuspend the OLS products in 100 &#181;l TE 0.1 buffer.</li>
	<li>Run the oligonucleotide libraries on a 10% TBE-Urea denaturing polyacrylamide gel. Load approximately 1 pmol per lane and stain with ssDNA-sensitive fluorescent stain to assess their quality (Figure 2A).</li>
	<li>If a discrete band corresponding to the full-length oligonucleotides can be visualized (Figure 2A, lanes 1 and 2), excise the corresponding acrylamide gel slice and elute oligonucleotides into 100 &#181;l TE 0.1 overnight at room temperature with shaking. Otherwise, proceed using the raw OLS suspension.</li>
	<li>Amplify and add SfiI tails to the oligonucleotide library using emulsion PCR 9.</li>
	<li>Set up 50 &#181;l PCR reaction mixtures as described in Table 2. Then combine with 300 &#181;l oil and surfactant mixture from the Micellula DNA Emulsion and Purification kit and vortex for 5 min at 4 &#176;C.</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="368">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>1x Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>Herculase II Fusion DNA Polymerase&#160;</td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>5x Herculase II Reaction Buffer</td>
			<td>10</td>
		</tr>
		<tr>
			<td>dNTP (10 mM each)</td>
			<td>1.25</td>
		</tr>
		<tr>
			<td>BSA (20 mg/ml)</td>
			<td>1.25</td>
		</tr>
		<tr>
			<td>Primer MPRA_SfiI_F (25 &#181;M)</td>
			<td>0.25</td>
		</tr>
		<tr>
			<td>Primer MPRA_SfiI_R (25 &#181;M)</td>
			<td>0.25</td>
		</tr>
		<tr>
			<td>OLS template (1-10 attomol)</td>
			<td>varies</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>to 50&#160;</td>
		</tr>
	</tbody>
</table>
Table 2.&#160;Emulsion PCR reaction mix (water phase).
<ol start="9">
	<li>Use the concentration that gives the maximal yield of amplification products without the appearance of artifacts (see section 1.12).</li>
	<li>Dispense the resulting emulsion into PCR tubes and perform 20 cycles of PCR (2 min at 95 &#176;C, 20 x[20 sec at 95 &#176;C, 20 sec at 55 &#176;C, 30 sec at 72 &#176;C], 3 min at 95 &#176;C).</li>
	<li>Pool and break each 350 &#181;l emulsion PCR reaction by adding 1 ml isobutanol and briefly vortexing, and then purify the amplification product using a DNA purification column.</li>
	<li>Run an aliquot on a 2% or 4% agarose gel to verify artifact-free amplification (Figure 2B).</li>
</ol>
<img alt="Figure 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> 
Figure 2.&#160;Preparation of oligonucleotide synthesis libraries. A) Three different raw oligonucleotide synthesis libraries (OLS) run on denaturing 10% TBE-Urea polyacrylamide gels. Bands corresponding to full length oligonucleotides (*) can be visualized and excised from libraries 1 and 2. Library 3 contains contaminants that interfere with PAGE purification. If this is the case, proceed directly to PCR amplification. B) Products of open and emulsion PCR amplification of the same oligonucleotide library run on an agarose gel. PCR amplification of complex oligonucleotide libraries frequently creates chimeric products and other artifacts that may appear as higher and lower bands. Emulsion PCR can minimize these artifacts.
2. Library Construction
<ol>
	<li>Prepare a linearized plasmid backbone by digesting vector pMPRA1 with SfiI at 50 &#176;C for 2 hr, run on a 1% agarose gel, excise the backbone band (in this case, 2.5 kb) and purify it using a gel-purification spin column.</li>
	<li>Digest the emulsion PCR products from step 1.4 with SfiI at 50 &#176;C for 2 hr and purify using DNA purification columns.</li>
	<li>To ligate the promoter-tag library into the linearized vector backbone, set up reactions containing 100 ng of the digested PCR product, 50 ng of linearized vector backbone and T4 DNA ligase. Incubate overnight at 16 &#176;C and then heat at 65 &#176;C for 20 min to inactivate the ligase.</li>
	<li>Transform E. coli with the ligation reaction. To preserve library complexity, aim to obtain at least 10x&#160;more cfu than there are distinct promoter-tag combinations in the designed library.</li>
	<li>When the total number of tags is approximately 100,000, the target cfu can typically be achieved by performing 6-8 parallel transformations per library.</li>
	<li>For each transformation, combine 50 &#181;l electrocompetent E. coli cells with 2 &#181;l of ligation mix on ice. Transform by electroporation, recover the cells in 800 &#181;l SOC medium by shaking at 37 &#176;C for 1 hr, and then combine cells from the parallel transformations.</li>
	<li>To evaluate the transformation efficiency, plate serial dilutions from an alinquot of recovered cells on LB agar plates with 50-100 &#181;g/ml carbenicillin and incubate overnight at 37 &#176;C. Estimate total cfu as (observed cfu) &#215; (dilution factor) &#215; (V - v) / v, where V is the total volume of recovered cells and v is the volume of the aliquot taken for the serial dilutions.</li>
	<li>At the same time, use the remainder of the recovered cells to inoculate 200 ml LB supplemented with 100 &#181;g/ml carbenicillin. Grow cells at 37 &#176;C overnight in a shaker incubator and then isolate the plasmid DNA following standard procedures.</li>
	<li>Digest an aliquot of the isolated plasmid library with SfiI at 50 &#176;C for 2 hr and run on a 1% agarose gel to confirm the presence of inserts.</li>
	<li>Linearize the plasmid library by cutting between the promoter variants and tags using KpnI and XbaI. To maximize the digestion efficiency, perform serial digestions:</li>
	<li>First, digest with KpnI at 37 &#176;C for 1 hr and purify using magnetic beads. Second, digest with XbaI with addition of 1 U Shrimp Alkaline Phosphatase at 37 &#176;C for 2 hr, heat inactivate at 65 &#176;C for 5 min, and then purify using magnetic beads.</li>
	<li>Run an aliquot on a 1% agarose gel to verify complete linearization. If uncut plasmid is visible, the linearized fragment should be gel purified.</li>
	<li>To generate an MPRA library suitable for transfection into mammalian cells, ligate an ORF with KpnI/XbaI-compatible ends into the linearized intermediate library.</li>
	<li>To prepare a compatible luc2 ORF fragment from pMPRAdonor1, digest this plasmid with KpnI and XbaI at 37 &#176;C for 1 hr and run on a 1% agarose gel. Excise the ORF fragment (1.7 kb in this case) and purify using a gel purification spin column.</li>
	<li>Clone the ORF fragment into the linearized intermediate library as described in steps 2.3-2.8.</li>
	<li>Digest an aliquot (corresponding to 1-2 &#181;g) of the MPRA library with KpnI at 37 &#176;C for 1 hr and run on a 1% agarose gel. If the digested library runs as a single band, proceed to section 3. If additional bands are observed (typically corresponding to carryover of intermediate constructs), the library can be further purified as follows:</li>
	<li>Digest 3-5 &#181;g of the contaminated library with KpnI at 37 &#176;C for 1 hr and run on a 0.8% agarose gel overnight at 4 &#176;C.</li>
	<li>Excise the correct library band, purify the DNA using a gel purification spin column and perform self-ligation using high-concentration T4 DNA ligase at 37 &#176;C for 1 hr. Then repeat the transformation and final library DNA isolation as described in step 2.8.</li>
</ol>
3. Transfection, Perturbation, and RNA Isolation
<ol>
	<li>For each independent transfection, culture the required number of cells (as determined by the MPRA library complexity, see Discussion) in appropriate medium. For example, culture HEK293T/17 cells in DMEM supplemented with 10% FBS and L-glutamine/penicillin/streptomycin. Culture cells for at least two independent transfections for each library and experimental condition.</li>
	<li>Transfect the cultured cells with MPRA plasmids. The transfection method and conditions must be optimized for each cell type. For each transfected sample, retain an aliquot (50-100 ng) of the plasmid DNA as a matched control.</li>
	<li>For example, transfect 0.5 x&#160;107 HEK293T/17 cells grown to ~50% confluence in a 10 cm culture dish with 10 &#181;g plasmid DNA in 1 ml&#160;Opti-MEM I Reduced Serum Medium using 30 &#181;l&#160;Lipofectamine LTX and 10 &#181;l&#160;Plus Reagent. Remove the transfection mixture after 5 hours and allow the cells to recover for 24-48 hr.</li>
	<li>Optionally, perform any perturbation required to activate context- or signal-dependent regulatory sequences in the designed library.</li>
	<li>Harvest the cells and isolate poly(A)+ mRNA using standard oligo(dT) cellulose columns or beads using their manufacturer&#8217;s instructions.</li>
	<li>Ensure that the maximum binding capacity of the columns or beads exceed the total amount of mRNA expected from the harvested cells. For example, the expected yield from section 3.3 is approximately 0.5-2.5 &#181;g mRNA.</li>
</ol>
4. Tag-Seq
<ol>
	<li>To eliminate carryover of vector DNA from the transfected cell lysates, treat each 20 &#181;l mRNA sample with 1 &#181;l Turbo DNase (2 U) and 2.3 &#181;l 10x&#160;Turbo DNase buffer at 37 &#176;C for 1 hr, add 2.4 &#181;l Turbo DNase Inactivation Reagent at RT for 5 min with mixing, centrifuge at 10,000 g for 90 sec, and then transfer the solution to a fresh tube.</li>
	<li>Verify purity by performing PCR as described in section 4.6 on 60-100 ng of each mRNA sample, and then running the products on an agarose gel. If specific amplicons are visible (0.25 kb if using pMPRA1 with luc2), column purify the treated mRNA and then repeat the DNase treatment.</li>
	<li>To generate Tag-Seq sequencing libraries, convert reporter mRNA to cDNA and add sequencing adapters by PCR.</li>
	<li>Set up mRNA/RT primer mixtures as described in Table 3. Incubate at 65 &#176;C for 5 min, then place on ice. In parallel, set up cDNA synthesis reactions as described in Table 4.</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="428">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>1x Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>mRNA sample (400-700 ng total)</td>
			<td>8</td>
		</tr>
		<tr>
			<td>Oligo-0dT (50 &#181;M)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>dNTP (10 mM each)</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 3.&#160;RNA/Reverse transcription primer mix for cDNA synthesis.
<table border="0" cellpadding="0" cellspacing="0" width="428">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>1x Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>10x SuperScript III RT Buffer</td>
			<td>2</td>
		</tr>
		<tr>
			<td>MgCl2 (25 mM)</td>
			<td>4</td>
		</tr>
		<tr>
			<td>DTT (0.1 M)</td>
			<td>2</td>
		</tr>
		<tr>
			<td>RNaseOut (40 U/&#181;l)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>SuperScript III (200 U/&#181;l)</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 4.&#160;cDNA synthesis reaction mix.
<ol start="5">
	<li>Gently combine mRNA/RT primer mixes with cDNA synthesis mixes. Incubate at 50 &#176;C for 50 min, 85 &#176;C for 5 min and then place on ice. Finally, incubate with 2 U of Ribonuclease H at 37 &#176;C for 20 min.</li>
	<li>Set up PCR reactions as described in Table 5 with 4-6 &#181;l cDNA reaction mixture or 50 ng reporter plasmid as templates. Then perform PCR amplification (95 &#176;C for 2 min, 26 x [95 &#176;C for 30 sec, 55 &#176;C for 30 sec, 72 &#176;C for 30 sec], 72 &#176;C for 3 min).</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="428">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>1x Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>2x PfuUltra II HotStart PCR Master Mix</td>
			<td>25</td>
		</tr>
		<tr>
			<td>Primer TagSeq_P1 (25 &#181;M)</td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>Primer TagSeq_P2 (25 &#181;M)</td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>Template (mRNA, cDNA mix or plasmid DNA)</td>
			<td>varies</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>to 50&#160;</td>
		</tr>
	</tbody>
</table>
Table 5.&#160;Tag-Seq PCR reaction mix. 
<ol start="7">
	<li>Run the PCR products through a 2% agarose gel, excise bands corresponding to the Tag-Seq library amplicons (0.25 kb if using pMPRA1 with luc2) and purify these using gel purification spin columns.</li>
	<li>Pool, denature and sequence the purified Tag-Seq amplicons directly with an Illumina sequencing instrument.</li>
	<li>Filter low-quality reads by removing all that a) contain one or more position with a Phred quality score less than 30 within the sequenced tag or b) does not exactly match a designed tag. Count the number of times each remaining tag appears in each library. Normalize the tag counts to TPM (tags per million sequenced tags) and then compute the ratio of mRNA-derived tag counts over plasmid-derived tag counts for each pair of sequencing libraries. If multiple different tags were linked to each sequence variant, use their median ratios for downstream analysis.</li>
</ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

The authors declare that they have no competing financial interests.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Massively Parallel Reporter Assays (MPRA) allow multiplexed measurement of the transcriptional regulatory activities of thousands to hundreds of thousands of DNA sequences1-7. In their most common implementation, multiplexing is achieved by coupling each sequence of interest to a synthetic reporter gene that contains an identifying sequence tag downstream of an open reading frame (ORF; Figure 1). Following transfection, RNA isolation and deep sequencing of the 3&#8217; ends of the reporter gene transcripts, the relative activities of the coupled sequences can be inferred from the relative abundance of their identifying tags.
<img alt="Figure 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> 
Figure 1.&#160;Overview of MPRA. A library of MPRA reporter constructs is constructed by coupling putative regulatory sequences to synthetic reporter genes that consist of an &#8220;inert&#8221; ORF (such as GFP or luciferase) followed by an identifying sequence tag. The library is transfected en masse into a population of cultured cells and transcribed reporter mRNA is subsequently recovered. Deep sequencing is used to count the number of occurrences of each tag among the reporter mRNAs and the transfected plasmids. The ratio of mRNA counts over plasmid counts can be used to infer the activity of the corresponding regulatory sequence. Adapted with permission from Melnikov,&#160;et al2.
MPRA can be adapted to a wide variety of experimental designs, including 1) comprehensive mutagenesis of individual gene regulatory elements, 2) scanning for novel regulatory elements across a locus of interest, 3) testing the effect of natural genetic variation in a set of putative promoters, enhancers or silencers, and 4) semi-rational engineering of synthetic regulatory elements. Libraries of sequence variants can be generated using a variety of methods, including oligonucleotide library synthesis (OLS) on programmable microarrays2,3,6,7, assembly of degenerate oligonucleotides1,4, combinatorial ligation8 and fragmentation of genomic DNA5.
This protocol describes construction of a library of promoter variants using OLS and the pMPRA1 and pMPRAdonor1 vectors (Addgene IDs 49349 and 49352, respectively; http://www.addgene.org), transient transfection of this library into cultured mammalian cells and subsequent quantitation of the promoter activities by deep sequencing of their associated tags (Tag-Seq). Earlier versions of this protocol were used in the research reported in Melnikov et al. Nature Biotechnology 30, 271-277 (2012) and in Kheradpour et al. Genome Research 23, 800-811 (2013).

<table border="0" cellpadding="0" cellspacing="0" width="954">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:359px;">Oligonucleotide library synthesis</td>
			<td style="width:201px;">Agilent, CustomArray or other OLS vendors</td>
			<td style="width:119px;">custom</td>
			<td style="width:275px;">If using OLS construction method</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">pMPRA1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49349</td>
			<td>MPRA plasmid backbone</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">pMPRAdonor1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49352</td>
			<td>luc2 ORF donor plasmid</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>OLS buffer</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">Novex TBE-Urea Gels, 10%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">EC6875BOX</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Novex TBA-Urea Sample Buffer</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">LC6876</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SYBR Gold Nucleic Acid Gel Stain</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">S-11494</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Micellula DNA Emulsion &#38; Purification Kit</td>
			<td style="width:201px;">EURx/CHIMERx</td>
			<td style="width:119px;">3600-01</td>
			<td>Library amplification by emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Herculase II Fusion DNA Polymerase</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600675</td>
			<td>Polymerase for emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SfiI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0123S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">KpnI-HF</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R3142S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">XbaI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0145S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">T4 DNA Ligase (2,000,000 units/ml)</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">M0202T</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">One Shot TOP10 Electrocomp E. coli</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">C4040-50</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">LB agar and liquid media with carbenicllin</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>Growth media for cloning</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels 1%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-01</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels, 2%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-02</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MinElute Gel Extraction Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">28604</td>
			<td>Library and backbone purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">EndoFree Plasmid Maxi Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">12362</td>
			<td>Library DNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Cell culture media</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Transfection reagents</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MicroPoly(A)Purist Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1919</td>
			<td>mRNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TURBO DNA-free Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1907</td>
			<td>Plasmid DNA removal</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SuperScript III First-Strand Synthesis System</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">18080-051</td>
			<td>cDNA synthesis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">PfuUltra II Hotstart PCR Master Mix</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600850</td>
			<td>Polymerase for Tag-Seq PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Primers (see text)</td>
			<td style="width:201px;">IDT</td>
			<td style="width:119px;">custom</td>
			<td>PAGE purify Tag-Seq primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:201px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA facilitates high-resolution, quantitative dissection of the sequence-activity relationships of transcriptional regulatory elements. A successful MPRA experiment will typically yield highly reproducible measurements for the majority of sequences in the transfected library (Figure 3A). If poor reproducibility is observed (Figure 3B), this is indicative of a too low concentration of reporter mRNAs in the recovered RNA samples, due to either 1) low absolute activity among the assayed sequences, or 2) low transfection efficiency.
Figure 4 shows a representative &#8220;information footprint&#8221;1,2 generated by assaying ~37,000 random variants of a 145 bp sequence upstream of the human IFNB gene in HEK293 cells with or without exposure to Sendai virus. The promoter TATA-box and known proximal enhancer10 can be clearly identified as information-rich regions in a virus-dependent manner.&#160;
<img alt="Figure 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> 
Figure 3.&#160;Tag-Seq reproducibility. Scatter plots showing examples of Tag-Seq data from two independent replicate transfections with high (A) and low (B) reproducibility. The latter plot shows many outlier tags with high mRNA counts in only one of the two replicates. Such artifacts typically indicate that the concentrations of reporter mRNAs were too low for quantitative PCR amplification, either due to low absolute activities among the reporter constructs, or low transfection efficiencies.
<img alt="Figure 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> 
Figure 4.&#160;Information footprinting of the human IFNB transcription start site and proximal enhancer. Approximately 37,000 random variants of a 145 nucleotide (nt) region upstream of the human IFNB gene were assayed using MPRA in HEK293 cells with (A) and without (B) exposure to Sendai virus. The blue bars show the mutual information between the reporter output and the nucleotide at each position. The proximal enhancer and TATA-box stand out as regions of high information content upon viral infection.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.2K ビュー.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

ビデオ: Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these...

imaging local ca2+ signals in cultured mammalian cells

Imaging Local Ca2+ Signals in Cultured Mammalian Cells

Here we present techniques for imaging local IP3-mediated Ca2+ events using fluorescence microscopy in intact mammalian cells loaded with Ca2+ indicators together with an algorithm that automates identification and analysis of these...

Imaging Local Ca2+ Signals in Cultured Mammalian Cells

a reporter assay to analyze intronic microrna maturation in mammalian cells

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

detecting somatic genetic alterations in tumor specimens by exon capture and massively parallel sequencing

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency...

a femtoliter droplet array for massively parallel protein synthesis from single dna molecules

A Femtoliter Droplet Array for Massively Parallel Protein Synthesis from Single DNA Molecules

The overall goal of the protocol is to prepare over one million ordered, uniform, stable, and biocompatible femtoliter droplets on a 1 cm2 planar substrate that can be used for cell-free protein...

isolation of adult spinal cord nuclei for massively parallel single-nucleus rna sequencing

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

Here, we present a protocol to rapidly isolate high-quality nuclei from the fresh or frozen tissue for downstream massively parallel RNA sequencing. We include detergent-mechanical and hypotonic-mechanical tissue disruption and cell lysis options, both of which can be used for isolation of...

rapid quantification of oxidized and reduced forms of glutathione using ortho -phthalaldehyde in cultured mammalian cells in vitro

Author Spotlight: Innovating Thiol Quantification and Biomarker Detection for Oxidative Stress Research 

Quantification of both oxidized and reduced forms of glutathione (GSSG and GSH, respectively) has been achieved through the use of Ortho-phthalaldehyde (OPA). OPA becomes highly fluorescent once conjugated to GSH but is unable to conjugate GSSG until reduced. Here, we describe a multiparametric assay to quantify both using protein quantification for...

Rapid Quantification of Oxidized and Reduced Forms of Glutathione Using Ortho -phthalaldehyde in Cultured Mammalian Cells In Vitro

sirna screening to identify ubiquitin and ubiquitin-like system regulators of biological pathways in cultured mammalian cells

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is...

construction of crispr plasmids and detection of knockout efficiency in mammalian cells through a dual luciferase reporter system

Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System

Here, we present a protocol describing a streamlined method for the efficient generation of plasmids expressing both the CRISPR enzyme and associated single guide RNA (sgRNAs). Co-transfection of mammalian cells with this sgRNA/CRISPR vector and a dual luciferase reporter vector that examines double-strand break repair allows evaluation of knockout...

a strategy to identify compounds that affect cell growth and survival in cultured mammalian cells at low-to-moderate throughput

A Strategy to Identify Compounds that Affect Cell Growth and Survival in Cultured Mammalian Cells at Low-to-Moderate Throughput

It is often necessary to assess the potential cytotoxicity of a set of compounds on cultured cells. Here, we describe a strategy to reliably screen for toxic compounds in a 96-well...

laminar flow-based assays to investigate leukocyte recruitment on cultured vascular cells and adherent platelets

Laminar Flow-based Assays to Investigate Leukocyte Recruitment on Cultured Vascular Cells and Adherent Platelets

Leukocytes avidly interact with vascular cells and platelets after vessel wall injury or during inflammation. Here, we describe a straightforward laminar flow-based assay to characterize the molecular mechanisms that underlie the interactions between leukocytes and their cellular...

electroporation-mediated in vitro gene delivery: an electric pulse technique to introduce fluorescent reporter protein-encoding plasmids into cultured cells

This video demonstrates the electroporation technique that introduces fluorescent protein-encoding plasmid DNA into mouse primary cerebellar granule cell...

Electroporation-Mediated In Vitro Gene Delivery: An Electric Pulse Technique to Introduce Fluorescent Reporter Protein-Encoding Plasmids Into Cultured Cells

viability assays for cells in culture

Viability Assays for Cells in Culture

Therapeutic compounds are often first examined in vitro with viability assays. Blind cell counts by a human observer can be highly sensitive to small changes in cell number but do not assess function. Computerized viability assays, as described here, can assess both structure and function in an objective...

analyzing mitochondrial supercomplexes in mammalian tissue fractions via in-gel activity assays

Analyzing Mitochondrial Supercomplexes in Mammalian Tissue Fractions via In-Gel Activity Assays

engineering intracellular protein sensors in mammalian cells

Engineering Intracellular Protein Sensors in Mammalian Cells

Here, we present a protocol for engineering genetically-encoded intracellular protein sensor-actuator(s). The device specifically detects target proteins through intracellular antibodies (intrabodies) and responds by switching on gene transcriptional output. A general framework is built to rapidly replace intrabodies, enabling rapid detection of any desired protein, without altering the general...

mission esirna for rnai screening in mammalian cells

MISSION esiRNA for RNAi Screening in Mammalian Cells

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the...

Discard the supernatant, and resuspend the cell pellet in 200 microliters of Opti-MEM. Repeat this procedure twice to ensure no residual culture medium is present in the tube. Set the parameters of electroporation as listed. Pipette the electroporation reaction gently to mix well, and use a long P200 pipette tip to transfer an exact volume of 100 microliters of the mixture into the two-millimeter gap...

pooled crispr-based genetic screens in mammalian cells

Pooled CRISPR-Based Genetic Screens in Mammalian Cells

CRISPR-Cas9 technology provides an efficient method to precisely edit the mammalian genome in any cell type and represents a novel means to perform genome-wide genetic screens. A detailed protocol discussing the steps required for the successful performance of pooled genome-wide CRISPR-Cas9 screens is provided...

quantifying bulk autophagic sequestration activity in mammalian cells

The video demonstrates an assay for assessing bulk autophagic sequestration activity in mammalian cells. It utilizes electroporation to release cytosolic proteins, including lactate dehydrogenase (LDH). The sequestered LDH and total cellular LDH fractions are determined to assess LDH sequestration, providing insights into the overall bulk sequestration...

Quantifying Bulk Autophagic Sequestration Activity in Mammalian Cells

analysis of cell cycle position in mammalian cells

Analysis of Cell Cycle Position in Mammalian Cells

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol.  We report a simple experimental approach to staining cells and quantifying their position in the cell...

Trypsinizing and Subculturing Mammalian Cells

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in cell death. The first step in subculturing is to detach cells from the surface of the primary culture vessel by trypsinization or mechanical means. The resultant cell suspension is then subdivided, or reseeded, into fresh cultures. Secondary cultures are checked for growth and fed periodically, and may be subsequently subcultured to produce tertiary cultures. The time between passaging of cells varies with the cell line and depends on the growth rate.

As cells reach confluency, they must be subcultured or passaged. This video will demonstrate a procedure for subculturing both adherent and suspension cells.

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

MISSION LentiPlex Pooled shRNA Library Screening in Mammalian Cells

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies.
There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids 1. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library.
The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes 2. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 108 TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification.
Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line 3, 4. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

Here we use a human LentiPlex pooled library and traditional sequencing methods to identify gene targets promoting cell survival. We demonstrate how to set up and deconvolute a LentiPlex screen and validate the results.

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to ...

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of cell proliferation underlies the pathology of diseases like cancer. As such there is great need to be able to investigate cell proliferation and quantitate the proportion of cells in each phase of the cell cycle. It is also of vital importance to indistinguishably identify cells that are replicating their DNA within a larger population. Since a cell&prime;s decision to proliferate is made in the G1 phase immediately before initiating DNA synthesis and progressing through the rest of the cell cycle, detection of DNA synthesis at this stage allows for an unambiguous determination of the status of growth regulation in cell culture experiments.
DNA content in cells can be readily quantitated by flow cytometry of cells stained with propidium iodide, a fluorescent DNA intercalating dye. Similarly, active DNA synthesis can be quantitated by culturing cells in the presence of radioactive thymidine, harvesting the cells, and measuring the incorporation of radioactivity into an acid insoluble fraction. We have considerable expertise with cell cycle analysis and recommend a different approach. We Investigate cell proliferation using bromodeoxyuridine/fluorodeoxyuridine (abbreviated simply as BrdU) staining that detects the incorporation of these thymine analogs into recently synthesized DNA. Labeling and staining cells with BrdU, combined with total DNA staining by propidium iodide and analysis by flow cytometry1 offers the most accurate measure of cells in the various stages of the cell cycle. It is our preferred method because it combines the detection of active DNA synthesis, through antibody based staining of BrdU, with total DNA content from propidium iodide. This allows for the clear separation of cells in G1 from early S phase, or late S phase from G2/M. Furthermore, this approach can be utilized to investigate the effects of many different cell stimuli and pharmacologic agents on the regulation of progression through these different cell cycle phases.
In this report we describe methods for labeling and staining cultured cells, as well as their analysis by flow cytometry. We also include experimental examples of how this method can be used to measure the effects of growth inhibiting signals from cytokines such as TGF-&beta;1, and proliferative inhibitors such as the cyclin dependent kinase inhibitor, p27KIP1. We also include an alternate protocol that allows for the analysis of cell cycle position in a sub-population of cells within a larger culture5. In this case, we demonstrate how to detect a cell cycle arrest in cells transfected with the retinoblastoma gene even when greatly outnumbered by untransfected cells in the same culture. These examples illustrate the many ways that DNA staining and flow cytometry can be utilized and adapted to investigate fundamental questions of mammalian cell cycle control.

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol. We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of ...

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum (ER). However, the visualization of these mRNAs can be challenging. This is especially true when only a fraction of the mRNA is ER-associated and their distribution to this organelle is obstructed by non-targeted (i.e. "free") transcripts. In order to monitor ER-associated mRNAs, we have developed a method in which cells are treated with a short exposure to a digitonin extraction solution that selectively permeabilizes the plasma membrane, and thus removes the cytoplasmic contents, while simultaneously maintaining the integrity of the ER. When this method is coupled with fluorescent in situ hybridization (FISH), one can clearly visualize ER-bound mRNAs by fluorescent microscopy. Using this protocol the degree of ER-association for either bulk poly(A) transcripts or specific mRNAs can be assessed and even quantified. In the process, one can use this assay to investigate the nature of mRNA-ER interactions.

Here we describe a method to visualize endoplasmic reticulum-associated mRNAs in mammalian tissue culture cells. This technique involves the selective permeabilization of the plasma membrane with digitonin to remove cytoplasmic contents followed by fluorescent in situ hybridization to detect either bulk poly(A) mRNA or specific transcripts.

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum ...

Chromosome Preparation From Cultured Cells

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as fluorescence in situ hybridization (FISH), this assay has the powerful ability to analyze individual cells for aberrations that involve gains or losses of portions of the genome&#160;and rearrangements involving one or more chromosomes. In humans, chromosome abnormalities occur in approximately 1 per 160 live births1,2, 60-80% of all miscarriages3,4, 10% of stillbirths2,5, 13% of individuals with congenital heart disease6, 3-6% of infertility cases2, and in many patients with developmental delay&#160;and birth defects7. Cytogenetic analysis of malignancy is routinely used by researchers and clinicians, as observations of clonal chromosomal abnormalities have been shown to have both diagnostic and prognostic significance8,9.&#160; Chromosome isolation is invaluable for gene therapy and stem cell research of organisms including nonhuman primates and rodents10-13.
Chromosomes can be isolated from cells of live tissues, including blood lymphocytes, skin fibroblasts, amniocytes, placenta, bone marrow, and tumor specimens. Chromosomes are analyzed at the metaphase stage of mitosis, when they are most condensed and therefore more clearly visible. The first step of the chromosome isolation technique involves the disruption of the spindle fibers by incubation with Colcemid, to prevent the cells from proceeding to the subsequent anaphase stage. The cells are then treated with a hypotonic solution and preserved in their swollen state with Carnoy&#39;s fixative. The cells are then dropped on to slides and can then be utilized for a variety of procedures. G-banding involves trypsin treatment followed by staining with Giemsa to create characteristic light and dark bands. The same procedure to isolate chromosomes can be used for the preparation of cells for procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY)14,15.

Chromosomes can be isolated from live cells such as lymphocytes or skin fibroblasts, and from organisms including humans or mice. These chromosome preparations can be further utilized for routine G-banding and molecular cytogenetic procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY).

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as ...

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized viability assays are expensive in terms of equipment but can be faster and more objective than manual cell counts. The present report describes the use of three such viability assays. Two of these assays are infrared and one is luminescent. Both infrared assays rely on a 16&#160;bit Odyssey Imager. One infrared assay uses the DRAQ5 stain for nuclei combined with the Sapphire stain for cytosol and is visualized in the 700 nm channel. The other infrared assay, an In-Cell Western, uses antibodies against cytoskeletal proteins (&#945;-tubulin or microtubule associated protein 2) and labels them in the 800 nm channel. The third viability assay is a commonly used luminescent assay for ATP, but we use a quarter of the recommended volume to save on cost. These measurements are all linear and correlate with the number of cells plated, but vary in sensitivity. All three assays circumvent time-consuming microscopy and sample the entire well, thereby reducing sampling error. Finally, all of the assays can easily be completed within one day of the end of the experiment, allowing greater numbers of experiments to be performed within short timeframes. However, they all rely on the assumption that cell numbers remain in proportion to signal strength after treatments, an assumption that is sometimes not met, especially for cellular ATP. Furthermore, if cells increase or decrease in size after treatment, this might affect signal strength without affecting cell number. We conclude that all viability assays, including manual counts, suffer from a number of caveats, but that computerized viability assays are well worth the initial investment. Using all three assays together yields a comprehensive view of cellular structure and function.

Therapeutic compounds are often first examined in vitro with viability assays. Blind cell counts by a human observer can be highly sensitive to small changes in cell number but do not assess function. Computerized viability assays, as described here, can assess both structure and function in an objective manner.

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized ...

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Visualization of Endoplasmic Reticulum Subdomains in Cultured Cells

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and functions despite the intense interorganelle molecular traffic. The techniques described in this paper are powerful means of studying protein and lipid mobility and trafficking in vivo and in their physiological environment. Fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP) are widely used live-cell imaging techniques for studying intracellular trafficking through the exo-endocytic pathway, the continuity between organelles or subcompartments, the formation of protein complexes, and protein localization in lipid microdomains, all of which can be observed under physiological and pathological conditions. The limitations of these approaches are mainly due to the use of fluorescent fusion proteins, and their potential drawbacks include artifactual over-expression in cells and the possibility of differences in the folding and localization of tagged and native proteins. Finally, as the limit of resolution of optical microscopy (about 200 nm) does not allow investigation of the fine structure of the ER or the specific subcompartments that can originate in cells under stress (i.e. hypoxia, drug administration, the over-expression of transmembrane ER resident proteins) or under pathological conditions, we combine live-cell imaging of cultured transfected cells with ultrastructural analyses based on transmission electron microscopy.

We describe the imaging approaches we use to investigate the distribution and mobility of the transfected fluorescent proteins resident in the endoplasmic reticulum (ER) by means of the confocal imaging of living cells. We also ultrastructurally analyze the effect of their expression on the architecture of this subcellular compartment.

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and ...

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...