Este trabajo fue apoyado por el Instituto Nacional de Investigación del Genoma Humano de los Institutos Nacionales de la Salud bajo el número Premio R01HG006785.

1. Secuencia Diseño y Síntesis <ol><li> Comience MPRA con el diseño y la síntesis de secuencias a ensayar para la actividad reguladora. Para la compatibilidad con la serie de vectores pMPRA, diseñar cada secuencia utilizando la siguiente plantilla: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- etiqueta -AGATCGGAAGAGCGTCG-3 &#39;, donde var indica la secuencia a ensayar y la etiqueta indica una o más etiquetas de identificación. </li><li> Las dos regiones variables (var) y la etiqueta están separadas por un par de KpnI (GGTACC) y XbaI (TCTAGA) sitios de restricción para facilitar la ligadura direccional de un fragmento de gen reportero entre ellos. Además, dos sitios distintos SfiI (GGCCNNNNNGGCC) se añadirán por PCR para permitir la ligación direccional en la columna vertebral pMPRA. Las regiones variables no deben contener copias adicionales de cualquiera de estos sitios de restricción. Si es necesario, uno o más de estas enzimas de restricción se pueden sustituir, Siempre y cuando las sustituciones 1) permitir un corte eficaz cerca de los extremos de moléculas de ADN, y 2) no corte en otra parte de la secuencia del vector. Ver discusión para más detalles. </li><li> Obtener los cebadores necesarios listados en la Tabla 1 de un proveedor comercial. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [índice] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tabla 1. Primer secuencias. [Indice] denota una secuencia de índice de 6 a 8 nt utilizado para la secuenciación de multiplexado. Obtener al menos 8 cebadores TagSeq-P2 con diferentes índices. Todosde los cebadores debe ser purificado por HPLC o PAGE. <ol start="4"><li> Bibliotecas de oligonucleótidos pueden obtenerse a partir de una instalación de proveedor o núcleo comercial, o se generan utilizando un microarray basado programable sintetizador de oligonucleótidos como se describe por el fabricante. Resuspender los productos MCO en 100 l de tampón TE 0,1. </li><li> Ejecute las bibliotecas de oligonucleótidos en un 10% TBE-Urea desnaturalización gel de poliacrilamida. Cargar aproximadamente 1 pmol por carril y tinción con colorante fluorescente sensible a ssDNA para evaluar su calidad (Figura 2A). </li><li> Si una banda discreta correspondiente a los oligonucleótidos de longitud completa se puede visualizar (Figura 2A, carriles 1 y 2), escindir el correspondiente trozo de gel de acrilamida y se eluye oligonucleótidos en 100 l TE 0,1 durante la noche a temperatura ambiente con agitación. De lo contrario, continúe con el OLS suspensión cruda. </li><li> Potenciar y colas SfiI a la biblioteca de oligonucleótidos utilizando emulsión PCR 9 </<html> sup&gt;. </li><li> Establecer 50 l mezclas de reacción PCR como se describe en la Tabla 2. Luego combine con 300 l de aceite y surfactante mezcla desde el Micellula ADN Emulsión y kit de purificación y agitar durante 5 min a 4 ° C. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Reactivo </td><td> 1x Volumen (l) </td></tr><tr><td> Herculase II Fusión ADN polimerasa </td><td> 0,5 </td></tr><tr><td> Reaction Buffer 5x Herculase II </td><td> 10 </td></tr><tr><td> dNTP (10 mM cada uno) </td><td> 1.25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1.25 </td></tr><tr><td> MPRA_SfiI_F Primer (25 mM) </td><td> 0.25 </td></tr><tr><td> MPRA_SfiI_R Primer (25 mM) </td><td> 0.25 </td></tr><tr><td> Plantilla OLS (1-10 attomol) </td><td> varía </td></tr><tr><td> Agua libre de nucleasa </td><td> a 50 </td></tr></tbody></table>ve_content &quot;&gt; Cuadro 2 mezcla de reacción de PCR de emulsión (fase acuosa). <ol start="9"><li> Utilizar la concentración que da el máximo rendimiento de los productos de amplificación sin la aparición de artefactos (véase la sección 1.12). </li><li> Prescindir de la emulsión resultante en tubos de PCR y realice 20 ciclos de PCR (2 min a 95 ° C, 20 x [20 segundos a 95 ° C, 20 segundos a 55 ° C, 30 segundos a 72 ° C], 3 min a 95 ° C). </li><li> Piscina y romper cada 350 l de reacción de PCR en emulsión mediante la adición de 1 ml de isobutanol y brevemente vórtex, y luego purificar el producto de amplificación usando una columna de purificación de ADN. </li><li> Ejecutar una alícuota en un gel de agarosa al 2% o 4% para verificar la amplificación libre de artefactos (Figura 2B). </li></ol><img alt="Figura 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Figura 2 Preparación de bibliotecas de síntesis de oligonucleótidos. A) </strong&gt; Tres bibliotecas de síntesis de oligonucleótidos primas diferentes (MCO) se ejecutan en la desnaturalización de 10% TBE-urea geles de poliacrilamida. Las bandas correspondientes a los oligonucleótidos de longitud completa (*) se pueden visualizar y extirpados de bibliotecas 1 y 2 Biblioteca 3 contiene contaminantes que interfieren con la purificación PAGE. Si este es el caso, proceder directamente a la PCR de amplificación. B) los productos de amplificación por PCR abierto y emulsión de la misma corrida biblioteca de oligonucleótidos en un gel de agarosa. La amplificación por PCR de las bibliotecas de oligonucleótidos complejos con frecuencia crea productos quiméricos y otros artefactos que pueden aparecer como bandas superiores e inferiores. Emulsión PCR puede minimizar estos artefactos. 2. Construcción de la Biblioteca <ol><li> Preparar un plásmido linealizado por digestión de columna vertebral pMPRA1 vector con SfiI a 50 ° C durante 2 horas, se ejecutan en un gel de agarosa al 1%, escindir la banda columna vertebral (en este caso, 2,5 kb) y purificar usando una columna de centrifugación purificación en gel. </li><li> Recopilaciónlos productos de la PCR de emulsión de la etapa 1.4 con SfiI a 50 ° C durante 2 horas y purifican utilizando columnas de purificación de ADN. </li><li> Para ligar la biblioteca promotor-tag en el esqueleto del vector linealizado, configurar las reacciones que contenían 100 ng del producto de PCR digerido, 50 ng de esqueleto del vector linealizado y ADN ligasa de T4. Incubar toda la noche a 16 ° C y luego se calienta a 65 ° C durante 20 min para inactivar la ligasa. </li><li> Transformar E. coli con la reacción de ligación. Para preservar la complejidad de la biblioteca, el objetivo de obtener al menos 10 veces más ufc que hay combinaciones de promotor-etiquetas distintas en la biblioteca diseñada. </li><li> Cuando el número total de etiquetas es de aproximadamente 100.000, el ufc objetivo típicamente se puede lograr mediante la realización de 6-8 transformaciones paralelas por biblioteca. </li><li> Para cada transformación, se combinan 50 l electrocompetentes E. células de E. coli con 2 l de mezcla de ligación en hielo. Transformar mediante electroporación, recuperar las células en 800 l SOCmedio por agitación a 37 ° C durante 1 h, y luego se combinan células de las transformaciones paralelas. </li><li> Para evaluar la eficiencia de transformación, placa diluciones seriadas de un alinquot de células recuperadas en placas de agar LB con 50 a 100 mg / ml de carbenicilina y se incuba durante la noche a 37 ° C. Estimar ufc total, (cfu observado) x (factor de dilución) x (V - V) / V, donde V es el volumen total de células recuperadas y V es el volumen de la alícuota tomada para las diluciones en serie. </li><li> Al mismo tiempo, utilizar el resto de las células recuperadas para inocular 200 ml de LB suplementado con 100 mg / ml de carbenicilina. Se cultivan las células a 37 ° C durante la noche en una incubadora con agitador y luego aislar el ADN plásmido siguiendo los procedimientos estándar. </li><li> Digerir una alícuota de la biblioteca de plásmido aislado con SfiI a 50 ° C durante 2 horas y correr en un gel de agarosa al 1% para confirmar la presencia de insertos. </li><li> Linealizar el plásmido biblioteca por cutting entre las variantes promotoras y etiquetas utilizando KpnI y XbaI. Para maximizar la eficiencia de la digestión, realizar digestiones de serie: </li><li> En primer lugar, digerir con KpnI a 37 ° C durante 1 hora y purificar usando perlas magnéticas. En segundo lugar, digerir con XbaI con la adición de 1 U de fosfatasa alcalina de camarón a 37 ° C durante 2 h, el calor inactiva a 65 ° C durante 5 min, y luego se purifica usando perlas magnéticas. </li><li> Ejecutar una alícuota en un gel de agarosa al 1% para verificar la linealización completa. Si plásmido sin cortar es visible, el fragmento linealizado se purificó en gel debe ser. </li><li> Para generar una biblioteca de MPRA adecuados para la transfección en células de mamífero, ligar un ORF con KpnI / XbaI extremos -Compatible en la biblioteca intermedia linealizado. </li><li> Para preparar un fragmento ORF luc2 compatible desde pMPRAdonor1, digerir este plásmido con KpnI y XbaI a 37 ° C durante 1 hora y se ejecutan en un gel de agarosa al 1%. Cortar el fragmento ORF (1,7 kb en este caso) y se purifican usando una columna de gel de purificación de giro. </li><li> Clonar el fragmento ORF en la biblioteca intermedio linealizado como se describe en los pasos 2.3 a 2.8. </li><li> Digerir una parte alícuota (correspondiente a 1-2 g) de la biblioteca MPRA con KpnI a 37 ° C durante 1 hora y correr en un gel de agarosa al 1%. Si la biblioteca digerido se ejecuta como una sola banda, pase a la sección 3 Si se observan bandas adicionales (por lo general corresponde a remanente de construcciones intermedias), la biblioteca puede ser purificado de la siguiente manera: </li><li> Digerir 3-5 g de la biblioteca contaminada con KpnI a 37 ° C durante 1 hora y correr en un gel de agarosa al 0,8% durante la noche a 4 ° C. </li><li> Escindir la banda biblioteca correcta, purificar el ADN usando una columna de centrifugación purificación en gel y llevar a cabo la auto-ligación utilizando alta concentración de ADN ligasa de T4 a 37 ° C durante 1 hr. A continuación, repita la transformación y la biblioteca definitiva de aislamiento de ADN como se describe en el paso 2.8. </li></ol> 3. Transfection, Perturbación, y Aislamiento de ARN <ol><li> Para cada transfección independiente, la cultura el número requerido de células (como se determina por la complejidad de la biblioteca MPRA, ver Discusión) en un medio apropiado. Por ejemplo, cultivo de células HEK293T 17 / en DMEM suplementado con 10% de FBS y L-glutamina / penicilina / estreptomicina. Células de cultivo de al menos dos transfecciones independientes para cada biblioteca y condición experimental. </li><li> Transfectar las células cultivadas con plásmidos MPRA. El método y las condiciones de transfección debe ser optimizado para cada tipo de célula. Para cada muestra transfectadas, retener una parte alícuota (50-100 ng) de ADN plásmido como control emparejado. </li><li> Por ejemplo, transfectar 0,5 x 10 7 HEK293T / 17 células cultivadas a ~ 50% de confluencia en una placa de cultivo de 10 cm con el plásmido de ADN 10 mg en 1 ml de Opti-MEM I medio de suero reducido utilizando 30 l Lipofectamine LTX y 10 l de reactivo Plus. Retire la mezcla de transfección después de 5 horas y permitir lalas células se recuperen durante 24-48 h. </li><li> Opcionalmente, realice cualquier perturbación necesaria para activar secuencias reguladoras al contexto o dependientes de señales en la biblioteca diseñada. </li><li> Recoger las células y aislar poli (A) + mRNA utilizando columnas estándar oligo (dT) celulosa o perlas usando las instrucciones de su fabricante. </li><li> Asegúrese de que la capacidad máxima de unión de las columnas o los granos supere el importe total de ARNm que se espera de las células recogidas. Por ejemplo, el rendimiento esperado de la sección 3.3 es de aproximadamente 0,5-2,5 mg ARNm. </li></ol> 4. Tag-Seq <ol><li> Para eliminar el arrastre de ADN del vector de los lisados ​​de células transfectadas, tratar a cada muestra de ARNm 20 l con 1 l Turbo DNasa (2 U) y 2,3 l de tampón 10x Turbo DNasa a 37 ° C durante 1 hora, añadir 2,4 l Turbo DNasa inactivación reactivo en RT durante 5 min con mezcla, centrifugar a 10.000 g durante 90 seg, y luego transferir la solución a un tubo nuevo. </li><li> Compruebe<html> pureza mediante la realización de PCR como se describe en la sección 4.6 de 60-100 ng de cada muestra de ARNm, y luego ejecutar los productos en un gel de agarosa. Si amplicones específicos son visibles (0,25 kb si usa pMPRA1 con luc2), la columna de purificar el mRNA tratado y luego repetir el tratamiento DNasa. </li><li> Para generar bibliotecas de secuenciación-Tag Seq, convertir reportero ARNm en ADNc y añadir adaptadores de secuenciación por PCR. </li><li> Configurar mezclas de cebadores ARNm / RT como se describe en la Tabla 3. Incubar a 65 ° C durante 5 min, luego colocar en hielo. En paralelo, configurar las reacciones de síntesis de ADNc como se describe en la Tabla 4. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reactivo </td><td> 1x Volumen (l) </td></tr><tr><td> muestra de ARNm (400-700 ng total) </td><td> 8 </td></tr><tr><td> Oligo-0DT (50 M) </td><td> 1 </td></tr><tr><td> dNTP (10 mM cada uno) </td><td> 1 </td></tr></tbody></table>ove_content &quot;&gt; Cuadro 3 ARN mezcla de cebadores / transcripción inversa para la síntesis de ADNc. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reactivo </td><td> 1x Volumen (l) </td></tr><tr><td> 10x superíndice III RT Buffer </td><td> 2 </td></tr><tr><td> MgCl2 (25 mM) </td><td> 4 </td></tr><tr><td> DTT (0,1 M) </td><td> 2 </td></tr><tr><td> RNaseOUT (40 U / l) </td><td> 1 </td></tr><tr><td> Superíndice III (200 U / l) </td><td> 1 </td></tr></tbody></table> Tabla ADNc 4. mezcla de reacción de síntesis. <ol start="5"><li> Combinan suavemente imprimación mRNA / RT mezcla con mezclas de síntesis de ADNc. Incubar a 50 ° C durante 50 min, 85 ° C durante 5 min y luego se coloca en hielo. Finalmente, se incuba con 2 U de ribonucleasa H a 37 ° C durante 20 min. </li><li> Configurar las reacciones de PCR como se describe en la Tabla 5 con 4-6 lcDNA mezcla de reacción o 50 ng de plásmido reportero como plantillas. A continuación, realizar la amplificación por PCR (95 ° C durante 2 min, 26 x [95 ° C durante 30 segundos, 55 ° C durante 30 segundos, 72 ° C durante 30 seg], 72 ° C durante 3 min). </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reactivo </td><td> 1x Volumen (l) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> TagSeq_P1 Primer (25 mM) </td><td> 0,5 </td></tr><tr><td> TagSeq_P2 Primer (25 mM) </td><td> 0,5 </td></tr><tr><td> Plantilla (ARNm, ADNc o ADN plásmido mix) </td><td> varía </td></tr><tr><td> Agua libre de nucleasa </td><td> a 50 </td></tr></tbody></table> Tabla 5. mezcla de reacción de PCR Tag-Seq. <ol start="7"><li> Ejecutar los productos de PCR en un gel de agarosa al 2%, bandas especiales correspondientes a los amplicones biblioteca-Tag Sec (0,25 kb si se utilizapMPRA1 con luc2) y purificar estas utilizando columnas giratorias de purificación de gel. </li><li> Piscina, desnaturalizar y secuenciar los amplicones-Tag Sec purificados directamente con un instrumento de secuenciación de Illumina. </li><li> Filtro de baja calidad se lee mediante la eliminación de todo lo que a) contener una o más posiciones con una calidad Phred puntuación de menos de 30 dentro de la etiqueta secuenciado o b) que no coincide exactamente una etiqueta diseñada. Cuente el número de veces que cada etiqueta restante aparece en cada biblioteca. Normalizar la etiqueta cuenta con TPM (etiquetas por millón de etiquetas secuenciados) y luego calcular la relación de etiqueta cuenta derivados de ARNm más de etiqueta cuenta plásmido derivado para cada par de bibliotecas de secuenciación. Si varias etiquetas diferentes estaban vinculados a cada variante de secuencia, utilice sus ratios de la mediana para el análisis de aguas abajo. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Los autores declaran que no tienen intereses financieros en competencia.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Ensayos Reporteros Massively Parallel (MPRA) permiten medir multiplexado de las actividades reguladoras de la transcripción de miles a cientos de miles de secuencias de ADN 1-7. En su aplicación más común, la multiplexación se logra mediante el acoplamiento de cada secuencia de interés a un gen indicador sintético que contiene una identificación de etiqueta de secuencia aguas abajo de un marco de lectura abierto (ORF; Figura 1). Después de la transfección, el aislamiento de ARN y secuenciación profunda de los extremos 3 &#39;de los transcritos del gen reportero, las actividades relativas de las secuencias unidas se pueden deducir de la abundancia relativa de sus etiquetas de identificación. <img alt="Figura 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> Figura 1 Descripción general de MPRA. Una biblioteca de reportero MPRA construcciones se construye acoplando secuencias reguladoras putativas a sintéticogenes indicadores que consisten en un &quot;inerte&quot; ORF (como GFP o luciferasa), seguido de una identificación de marcadores de secuencias. La biblioteca es transfectada en masa en una población de células cultivadas y ARNm transcrito reportero se recupera posteriormente. Secuenciación de profundidad se utiliza para contar el número de ocurrencias de cada etiqueta entre los mRNAs reportero y los plásmidos transfectados. La proporción de mRNA cuenta sobre los recuentos de plásmido puede utilizarse para inferir la actividad de la secuencia reguladora correspondiente. Adaptado con permiso de Melnikov, et al 2. MPRA se puede adaptar a una amplia variedad de diseños experimentales, incluyendo 1) la mutagénesis integral de elementos reguladores de genes individuales, 2) la exploración de nuevos elementos reguladores a través de un locus de interés, 3) probar el efecto de la variación genética natural en un conjunto de putativo promotores, potenciadores o silenciadores, y 4) ingeniería semi-racional de los elementos reguladores sintéticos. Libraries de variantes de secuencia pueden generarse usando una variedad de métodos, incluyendo la síntesis de la biblioteca de oligonucleótidos (OLS) en microarrays programables 2,3,6,7, conjunto de oligonucleótidos degenerados, 1,4 ligadura 8 combinatoria y la fragmentación de ADN genómico 5. Este protocolo describe la construcción de una biblioteca de variantes de promotor usando OLS y los vectores de pMPRA1 y pMPRAdonor1 (Addgene IDs 49349 y 49352, respectivamente; http://www.addgene.org), la transfección transitoria de esta biblioteca en células de mamífero cultivadas y la posterior cuantificación de las actividades promotoras de secuenciación profunda de sus etiquetas asociadas (Tag-Seq). Las versiones anteriores de este protocolo se utilizaron en la investigación publicada en Melnikov et al. Nature Biotechnology 30, 271-277 (2012) y en Kheradpour et al. Genome Research 23, 800-811 (2013).

<table border="0" cellpadding="0" cellspacing="0" width="954">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:359px;">Oligonucleotide library synthesis</td>
			<td style="width:201px;">Agilent, CustomArray or other OLS vendors</td>
			<td style="width:119px;">custom</td>
			<td style="width:275px;">If using OLS construction method</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">pMPRA1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49349</td>
			<td>MPRA plasmid backbone</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">pMPRAdonor1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49352</td>
			<td>luc2 ORF donor plasmid</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>OLS buffer</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">Novex TBE-Urea Gels, 10%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">EC6875BOX</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Novex TBA-Urea Sample Buffer</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">LC6876</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SYBR Gold Nucleic Acid Gel Stain</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">S-11494</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Micellula DNA Emulsion &#38; Purification Kit</td>
			<td style="width:201px;">EURx/CHIMERx</td>
			<td style="width:119px;">3600-01</td>
			<td>Library amplification by emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Herculase II Fusion DNA Polymerase</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600675</td>
			<td>Polymerase for emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SfiI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0123S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">KpnI-HF</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R3142S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">XbaI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0145S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">T4 DNA Ligase (2,000,000 units/ml)</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">M0202T</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">One Shot TOP10 Electrocomp E. coli</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">C4040-50</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">LB agar and liquid media with carbenicllin</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>Growth media for cloning</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels 1%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-01</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels, 2%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-02</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MinElute Gel Extraction Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">28604</td>
			<td>Library and backbone purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">EndoFree Plasmid Maxi Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">12362</td>
			<td>Library DNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Cell culture media</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Transfection reagents</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MicroPoly(A)Purist Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1919</td>
			<td>mRNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TURBO DNA-free Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1907</td>
			<td>Plasmid DNA removal</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SuperScript III First-Strand Synthesis System</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">18080-051</td>
			<td>cDNA synthesis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">PfuUltra II Hotstart PCR Master Mix</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600850</td>
			<td>Polymerase for Tag-Seq PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Primers (see text)</td>
			<td style="width:201px;">IDT</td>
			<td style="width:119px;">custom</td>
			<td>PAGE purify Tag-Seq primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:201px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA facilita de alta resolución, la disección cuantitativa de las relaciones de secuencia de la actividad de elementos reguladores transcripcionales. Un experimento exitoso MPRA típicamente producirá mediciones altamente reproducibles para la mayoría de las secuencias en la biblioteca transfectadas (Figura 3A). Si se observa una mala reproducibilidad (Figura 3B), esto es indicativo de una concentración demasiado baja de mRNAs reportero en las muestras de ARN recuperado, ya sea debido a 1) una baja actividad absoluta entre las secuencias ensayadas, o 2) la baja eficiencia de transfección. La figura 4 muestra un representante &quot;información de la huella&quot; 1,2 generada por el ensayo de ~ 37.000 variantes aleatorias de una secuencia de 145 pb aguas arriba del gen IFNB humano en células HEK293 con o sin exposición al virus Sendai. El promotor TATA-box y conocido promotor de proximal 10 pueden ser claramente identificados como regi rico en informacióncomplementos de una manera dependiente de virus. <img alt="Figura 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Figura 3.-Tag Sec reproducibilidad diagramas de dispersión que muestran ejemplos de datos de la etiqueta de la Seq dos transfecciones independientes replicadas con alta (A) y baja (B) la reproducibilidad.. Este último gráfico muestra muchas etiquetas de valores atípicos con recuentos de alta mRNA en sólo una de las dos repeticiones. Tales artefactos típicamente indican que las concentraciones de ARNm reportero eran demasiado bajos para la amplificación de PCR cuantitativa, ya sea debido a las actividades absolutas bajas entre los constructos informadores, o bajas eficiencias de transfección. <img alt="Figura 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> Figura 4. Información footprinting del sitio de inicio de transcripción IFNB humano y potenciador proximal. </strong&gt; Aproximadamente 37.000 variantes aleatorias de un (nt) región de 145 nucleótidos aguas arriba del gen IFNB humano se analizaron utilizando MPRA en células HEK293 con (A) y sin (B) la exposición al virus Sendai. Las barras azules muestran la información mutua entre la salida reportero y el nucleótido en cada posición. El potenciador proximal y la caja TATA se destacan como las regiones de alto contenido de información a la infección viral.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Ensayos Reporteros Massively Parallel en células de mamífero cultivadas

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.4K vistas.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Video: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Trypsinizing and Subculturing Mammalian Cells

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in cell death. The first step in subculturing is to detach cells from the surface of the primary culture vessel by trypsinization or mechanical means. The resultant cell suspension is then subdivided, or reseeded, into fresh cultures. Secondary cultures are checked for growth and fed periodically, and may be subsequently subcultured to produce tertiary cultures. The time between passaging of cells varies with the cell line and depends on the growth rate.

As cells reach confluency, they must be subcultured or passaged. This video will demonstrate a procedure for subculturing both adherent and suspension cells.

Trypsinizing Siembra y células de mamífero

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

Investigación

Biología

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

MISIÓN esiRNA sobre el cribado del ARNi en células de mamífero

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

MISSION LentiPlex Pooled shRNA Library Screening in Mammalian Cells

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies.
There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids 1. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library.
The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes 2. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 108 TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification.
Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line 3, 4. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

Here we use a human LentiPlex pooled library and traditional sequencing methods to identify gene targets promoting cell survival. We demonstrate how to set up and deconvolute a LentiPlex screen and validate the results.

LentiPlex MISIÓN combinados de detección del shRNA biblioteca en células de mamífero

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to ...

Analysis of Cell Cycle Position in Mammalian Cells

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of cell proliferation underlies the pathology of diseases like cancer. As such there is great need to be able to investigate cell proliferation and quantitate the proportion of cells in each phase of the cell cycle. It is also of vital importance to indistinguishably identify cells that are replicating their DNA within a larger population. Since a cell&prime;s decision to proliferate is made in the G1 phase immediately before initiating DNA synthesis and progressing through the rest of the cell cycle, detection of DNA synthesis at this stage allows for an unambiguous determination of the status of growth regulation in cell culture experiments.
DNA content in cells can be readily quantitated by flow cytometry of cells stained with propidium iodide, a fluorescent DNA intercalating dye. Similarly, active DNA synthesis can be quantitated by culturing cells in the presence of radioactive thymidine, harvesting the cells, and measuring the incorporation of radioactivity into an acid insoluble fraction. We have considerable expertise with cell cycle analysis and recommend a different approach. We Investigate cell proliferation using bromodeoxyuridine/fluorodeoxyuridine (abbreviated simply as BrdU) staining that detects the incorporation of these thymine analogs into recently synthesized DNA. Labeling and staining cells with BrdU, combined with total DNA staining by propidium iodide and analysis by flow cytometry1 offers the most accurate measure of cells in the various stages of the cell cycle. It is our preferred method because it combines the detection of active DNA synthesis, through antibody based staining of BrdU, with total DNA content from propidium iodide. This allows for the clear separation of cells in G1 from early S phase, or late S phase from G2/M. Furthermore, this approach can be utilized to investigate the effects of many different cell stimuli and pharmacologic agents on the regulation of progression through these different cell cycle phases.
In this report we describe methods for labeling and staining cultured cells, as well as their analysis by flow cytometry. We also include experimental examples of how this method can be used to measure the effects of growth inhibiting signals from cytokines such as TGF-&beta;1, and proliferative inhibitors such as the cyclin dependent kinase inhibitor, p27KIP1. We also include an alternate protocol that allows for the analysis of cell cycle position in a sub-population of cells within a larger culture5. In this case, we demonstrate how to detect a cell cycle arrest in cells transfected with the retinoblastoma gene even when greatly outnumbered by untransfected cells in the same culture. These examples illustrate the many ways that DNA staining and flow cytometry can be utilized and adapted to investigate fundamental questions of mammalian cell cycle control.

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol. We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

Análisis de la posición del ciclo celular en células de mamífero

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of ...

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum (ER). However, the visualization of these mRNAs can be challenging. This is especially true when only a fraction of the mRNA is ER-associated and their distribution to this organelle is obstructed by non-targeted (i.e. "free") transcripts. In order to monitor ER-associated mRNAs, we have developed a method in which cells are treated with a short exposure to a digitonin extraction solution that selectively permeabilizes the plasma membrane, and thus removes the cytoplasmic contents, while simultaneously maintaining the integrity of the ER. When this method is coupled with fluorescent in situ hybridization (FISH), one can clearly visualize ER-bound mRNAs by fluorescent microscopy. Using this protocol the degree of ER-association for either bulk poly(A) transcripts or specific mRNAs can be assessed and even quantified. In the process, one can use this assay to investigate the nature of mRNA-ER interactions.

Here we describe a method to visualize endoplasmic reticulum-associated mRNAs in mammalian tissue culture cells. This technique involves the selective permeabilization of the plasma membrane with digitonin to remove cytoplasmic contents followed by fluorescent in situ hybridization to detect either bulk poly(A) mRNA or specific transcripts.

La visualización de los ARNm retículo endoplásmico localizados en células de mamíferos

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum ...

Chromosome Preparation From Cultured Cells

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as fluorescence in situ hybridization (FISH), this assay has the powerful ability to analyze individual cells for aberrations that involve gains or losses of portions of the genome&#160;and rearrangements involving one or more chromosomes. In humans, chromosome abnormalities occur in approximately 1 per 160 live births1,2, 60-80% of all miscarriages3,4, 10% of stillbirths2,5, 13% of individuals with congenital heart disease6, 3-6% of infertility cases2, and in many patients with developmental delay&#160;and birth defects7. Cytogenetic analysis of malignancy is routinely used by researchers and clinicians, as observations of clonal chromosomal abnormalities have been shown to have both diagnostic and prognostic significance8,9.&#160; Chromosome isolation is invaluable for gene therapy and stem cell research of organisms including nonhuman primates and rodents10-13.
Chromosomes can be isolated from cells of live tissues, including blood lymphocytes, skin fibroblasts, amniocytes, placenta, bone marrow, and tumor specimens. Chromosomes are analyzed at the metaphase stage of mitosis, when they are most condensed and therefore more clearly visible. The first step of the chromosome isolation technique involves the disruption of the spindle fibers by incubation with Colcemid, to prevent the cells from proceeding to the subsequent anaphase stage. The cells are then treated with a hypotonic solution and preserved in their swollen state with Carnoy&#39;s fixative. The cells are then dropped on to slides and can then be utilized for a variety of procedures. G-banding involves trypsin treatment followed by staining with Giemsa to create characteristic light and dark bands. The same procedure to isolate chromosomes can be used for the preparation of cells for procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY)14,15.

Chromosomes can be isolated from live cells such as lymphocytes or skin fibroblasts, and from organisms including humans or mice. These chromosome preparations can be further utilized for routine G-banding and molecular cytogenetic procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY).

Cromosoma Preparación de las células cultivadas

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as ...

Viability Assays for Cells in Culture

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized viability assays are expensive in terms of equipment but can be faster and more objective than manual cell counts. The present report describes the use of three such viability assays. Two of these assays are infrared and one is luminescent. Both infrared assays rely on a 16&#160;bit Odyssey Imager. One infrared assay uses the DRAQ5 stain for nuclei combined with the Sapphire stain for cytosol and is visualized in the 700 nm channel. The other infrared assay, an In-Cell Western, uses antibodies against cytoskeletal proteins (&#945;-tubulin or microtubule associated protein 2) and labels them in the 800 nm channel. The third viability assay is a commonly used luminescent assay for ATP, but we use a quarter of the recommended volume to save on cost. These measurements are all linear and correlate with the number of cells plated, but vary in sensitivity. All three assays circumvent time-consuming microscopy and sample the entire well, thereby reducing sampling error. Finally, all of the assays can easily be completed within one day of the end of the experiment, allowing greater numbers of experiments to be performed within short timeframes. However, they all rely on the assumption that cell numbers remain in proportion to signal strength after treatments, an assumption that is sometimes not met, especially for cellular ATP. Furthermore, if cells increase or decrease in size after treatment, this might affect signal strength without affecting cell number. We conclude that all viability assays, including manual counts, suffer from a number of caveats, but that computerized viability assays are well worth the initial investment. Using all three assays together yields a comprehensive view of cellular structure and function.

Therapeutic compounds are often first examined in vitro with viability assays. Blind cell counts by a human observer can be highly sensitive to small changes in cell number but do not assess function. Computerized viability assays, as described here, can assess both structure and function in an objective manner.

Los ensayos de viabilidad de las células en cultivo

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized ...

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

La detección de alteraciones genéticas somáticas en muestras de tumores por Exon de captura y secuenciación masivamente paralelo

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Visualization of Endoplasmic Reticulum Subdomains in Cultured Cells

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and functions despite the intense interorganelle molecular traffic. The techniques described in this paper are powerful means of studying protein and lipid mobility and trafficking in vivo and in their physiological environment. Fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP) are widely used live-cell imaging techniques for studying intracellular trafficking through the exo-endocytic pathway, the continuity between organelles or subcompartments, the formation of protein complexes, and protein localization in lipid microdomains, all of which can be observed under physiological and pathological conditions. The limitations of these approaches are mainly due to the use of fluorescent fusion proteins, and their potential drawbacks include artifactual over-expression in cells and the possibility of differences in the folding and localization of tagged and native proteins. Finally, as the limit of resolution of optical microscopy (about 200 nm) does not allow investigation of the fine structure of the ER or the specific subcompartments that can originate in cells under stress (i.e. hypoxia, drug administration, the over-expression of transmembrane ER resident proteins) or under pathological conditions, we combine live-cell imaging of cultured transfected cells with ultrastructural analyses based on transmission electron microscopy.

We describe the imaging approaches we use to investigate the distribution and mobility of the transfected fluorescent proteins resident in the endoplasmic reticulum (ER) by means of the confocal imaging of living cells. We also ultrastructurally analyze the effect of their expression on the architecture of this subcellular compartment.

Visualización del retículo endoplasmático subdominios en células cultivadas

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Screening siRNA para identificar ubiquitina y reguladores del sistema ubiquitina-como de las vías biológicas en células de mamífero en cultivo

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...