이 작품은 상을 수 R01HG006785에서 국립 보건원 (NIH)의 국립 인간 게놈 연구소에 의해 지원되었다.

1 시퀀스 설계 및 합성 <ol><li> 시퀀스의 설계 및 합성에 MPRA 시작은 규제 활동을 분석합니다. pMPRA 벡터 시리즈와의 호환성을 위해 다음과 같은 템플릿을 사용하여 각 시퀀스를 설계 : 5&#39;-ACTGGCCGCTTCACTG- var에 -GGTACCTCTAGA- 태그 -AGATCGGAAGAGCGTCG-3 var에 정량 할 수있는 순서를 나타내며, 태그는 하나 이상의 식별 태그를 의미한다 &#39;. </li><li> 이 가변 영역 (VAR 및 태그) 사이 리포터 유전자 단편의 방향을 용이하게 결찰를 KpnI (GGTACC)과를 XbaI (TCTAGA) 제한 부위의 쌍에 의해 분리된다. 또한, 두 가지 SfiI (GGCCNNNNNGGCC) 사이트는 pMPRA 백본으로 방향 결찰 할 수 있도록 PCR에 의해 추가됩니다. 변수 영역이 제한 부위의 사본을 추가로 포함 할 수 없습니다. 필요한 경우, 이들 제한 효소 중 하나 이상을 대체 할 수있다만큼 대체품으로서 1) 주변 DNA 분자의 말단에 효율적인 절단을 허용하고, 2) 벡터 시퀀스의 다른 곳에서 절단되지 않는다. 자세한 내용에 대한 설명을 참조하십시오. </li><li> 상용 공급 업체에서 표 1에 필요한 프라이머를 얻습니다. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [인덱스] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> 표 1 프라이머 서열. [색인] 다중화 시퀀싱에 사용될 6-8 NT 인덱스 시퀀스를 나타낸다. 다른 인덱스 적어도 8 TagSeq-P2 프라이머를 얻습니다. 모든프라이머의 HPLC 또는 PAGE로 정제해야한다. <ol start="4"><li> 올리고 뉴클레오티드 라이브러리는 상업적 공급 업체 또는 코어 설비로부터 얻어진, 또는 제조자에 의해 설명 된 바와 같이 프로그램 가능한 마이크로 어레이 계 올리고 뉴클레오티드 합성기를 사용하여 생성 될 수있다. 100 ㎕의 TE 0.1 버퍼에 OLS 제품을 재현 탁. </li><li> 폴리 아크릴 아미드 겔을 변성 10 % TBE-우레아에 올리고 뉴클레오티드 라이브러리를 실행. 품질 (그림 2A)를 평가하는 ssDNA의 민감한 형광 얼룩 차선 얼룩 당 약 1 pmol의를 넣습니다. </li><li> 전체 길이의 올리고 뉴클레오티드에 대응 이산 밴드 시각화 할 수있는 경우 (도 2a, 레인 1과 2), 대응 아크릴 아미드 겔 슬라이스를 절제하고 진탕하면서 실온에서 밤새 100 ㎕의 TE 0.1로 올리고 뉴클레오티드를 용출. 그렇지 않으면, 원시 OLS 서스펜션을 사용하여 진행합니다. </li><li> PCR 증폭 9 에멀젼을 이용한 올리고 뉴클레오티드 라이브러리 SfiI 꼬리를 추가 </<html> &gt; SUP. </li><li> 표 2에 설명 된대로 50 ㎕의 PCR 반응 혼합물을 설정합니다. 다음 4 ℃에서 5 분 동안 300 ㎕의 Micellula DNA 에멀젼에서 오일과 계면 활성제 혼합물의 정제 키트와 소용돌이와 결합. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> 시약 </td><td> 1X 볼륨 (μL) </td></tr><tr><td> Herculase II 퓨전 DNA 중합 효소 </td><td> 0.5 </td></tr><tr><td> 5 배 Herculase II 반응 버퍼 </td><td> 10 </td></tr><tr><td> 의 dNTP (10 mM의 각) </td><td> 1.25 </td></tr><tr><td> BSA (20 ㎎ / ㎖) </td><td> 1.25 </td></tr><tr><td> 프라이머 MPRA_SfiI_F (25 μM) </td><td> 0.25 </td></tr><tr><td> 프라이머 MPRA_SfiI_R (25 μM) </td><td> 0.25 </td></tr><tr><td> OLS 템플릿 (1-10 attomol) </td><td> 변화 </td></tr><tr><td> 핵산 분해 효소가없는 물 </td><td> 50 </td></tr></tbody></table>ve_content &quot;&gt; 표 2 에멀젼 PCR 반응 믹스 (수상). <ol start="9"><li> 생성물의 외관없이 증폭 생성물의 최대 수율을 제공 농도를 사용하여 (섹션 1.12 참조). </li><li> PCR 튜브에 생성 된 에멀젼을 분배하고 95 ° C에서 (2 분 PCR의 20주기를 수행, 20 × 95 ° C에서 20 초, 55 ° C, 72 ° C에서 30 초에서 20 초], 95시 3 분 ° C). </li><li> 풀 텍싱 간단히 1 ㎖의 이소 부탄올을 첨가하여 각각의 350 μL 에멀젼 PCR 반응을 중단 한 후 DNA 정제 컬럼을 사용하여 증폭 산물을 정제하고. </li><li> 유물없는 증폭 (그림 2B)를 확인하기 위해 2 % 또는 4 % 아가로 오스 겔에 나누어를 실행합니다. </li></ol><img alt="그림이" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> 올리고 뉴클레오티드 합성 라이브러리의 그림 2 준비.) </strong이&gt; 세 가지 다른 원료 올리고 뉴클레오티드 합성 라이브러리 (OLS)은 10 % TBE-우레아 폴리 아크릴 아마이드 젤을 변성에서 실행됩니다. 전체 길이 올리고 뉴클레오티드 (*)에 해당하는 밴드 시각화 라이브러리 1에서 절제과 2 도서관 3 페이지 정화 방해 오염 물질을 포함 할 수 있습니다. 이러한 경우, 아가로 오스 겔상에서 동일한 올리고 뉴클레오티드 라이브러리 런의 개방 및 에멀젼 PCR 증폭 PCR 증폭. B)로 직접 이동 제품. 복잡한 올리고 뉴클레오티드 라이브러리의 PCR 증폭 자주 키메라 제품과 상한 및 하한 밴드로 나타날 수 있습니다 다른 아티팩트를 생성합니다. 에멀젼 PCR은 이러한 아티팩트를 최소화 할 수 있습니다. 2 라이브러리 생성 <ol><li> , 1 % 아가 로스 겔상에서 실행 2 시간, 50 ° C에서 SfiI으로 분해 벡터 pMPRA1 의해 선형화 된 플라스미드 백본을 준비한다 (이 경우, 2.5 KB 단위) 백본 밴드를 절제하고, 겔 정제 스핀 컬럼을 사용하여 정제. </li><li> 다이제스트2 시간 동안 50 ° C에서 SfiI와 단계 1.4에서 에멀젼 PCR 제품과는 DNA 정제 컬럼을 사용하여 정제. </li><li> , 선형화 된 벡터 백본에 프로모터 태그 라이브러리를 결찰하기 위해 소화 PCR 제품의 100 NG, 선형화 된 벡터 백본 및 T4 DNA 리가 아제의 50 NG를 포함하는 반응을 설정합니다. 20 분 리가을 비활성화하는 65 ° C에서 다음 열을 16 ° C에서 밤새 품어. </li><li> E. 변환 연결 반응으로 대장균. 라이브러리 복잡성을 유지하기 위해, 설계 라이브러리에있는 개별의 프로모터 태그 조합이보다 적어도 10 배 더 CFU를 획득하는 것을 목표로하고 있습니다. </li><li> 태그의 총 개수가 약 10 인 경우, 타겟은 전형적으로 도서관 CFU 당 6-8 병렬 변환을 수행함으로써 달성 될 수있다. </li><li> 각 변환의 경우, E. electrocompetent 50 μl를 결합 얼음에 결찰 믹스의 2 μL와 대장균 세포. 800 μL의 SOC에 세포를 전기 천공에 의해 변형 복구병렬 변환에서 세포를 결합 후 1 시간 동안 37 ° C에서 흔들어, 그리고에 의해 매체. </li><li> 변환 효율을 평가하기 위해 50 ~ 100 μg / ml의 카르 베니 실린와 LB 아가 플레이트에 복구 된 세포의 alinquot에서 순차적으로 희석 플레이트 하룻밤에 37 ° C를 품어. / V, V 복구 세포와 V의 전체 볼륨 시리얼 희석 걸리는 나누어의 볼륨 - 총 CFU로 (관찰 CFU) × (희석 계수) × (V V)를 추정한다. </li><li> 동시에, 회수 된 세포의 나머지가 100 μg / ml의 카르 베니 실린이 보충 된 200 ㎖의 LB에 접종하는 데 사용. 진탕 배양기에서 하룻밤 37 ° C에서 세포를 성장하고 표준 절차에 따라 플라스미드 DNA를 분리. </li><li> 2 시간 동안 50 ° C에서 SfiI으로 절연 플라스미드 라이브러리의 분취 다이제스트와 삽입물의 존재를 확인하는 1 % 아가 로스 겔상에서 실행. </li><li> C에 의해 플라스미드 라이브러리를 선형화를 KpnI과 XbaI로를 사용하여 프로모터 변종와 태그 사이에 utting. 소화 효율을 극대화하기 위해, 일련 digestions를 수행 </li><li> 첫째, 1 시간 동안 37 ° C에서 KpnI에서 다이제스트 및 자기 구슬을 사용하여 정제. 둘째, 2 시간 동안 37 ° C에서 1 U 새우 알칼리 포스 파타 아제의 첨가를 XbaI으로 소화, 열은 5 분 동안 65 ° C에서 비활성화 한 다음 자석 구슬을 사용하여 정제. </li><li> 완전한 선형화를 확인하는 1 % 아가 로스 겔상에서 분취 액을 실행. 미가공 플라스미드가 보이면, 선형화 된 단편을 겔 정제한다. </li><li> 포유 동물 세포에 형질 전환에 적합한 MPRA 라이브러리를 생성하기 위해, 선형화 된 중간 라이브러리에 KpnI으로 절단 / XbaI으로 호환 끝으로 ORF를 결찰. </li><li> pMPRAdonor1에서 호환 luc2 ORF 부분을 준비하려면 1 시간 동안 37 ° C에서를 KpnI과 XbaI으로이 플라스미드를 소화하고 1 % 아가 로스 젤에서 실행됩니다. ORF 부분을 절제 (1.7 K이 경우, b) 및 겔 정제 스핀 컬럼을 사용하여 정제. </li><li> 단계 2.3-2.8에서 설명한 바와 같이 선형화 된 라이브러리에 중간 ORF 단편을 복제. </li><li> 1 시간 동안 37 ° C에서 KpnI으로 절단과 MPRA 라이브러리 (1-2 μg에 해당) 나누어지는 다이제스트와 1 % 아가 로스 젤에서 실행됩니다. 소화 라이브러리가 하나의 밴드로 실행하면 추가 밴드가 (일반적으로 중간 구조의 이월에 해당), 라이브러리는 다음과 같이 추가로 정제 할 수있다 관찰하는 경우, 섹션 3으로 진행합니다 : </li><li> 1 시간 동안 37 ° C에서 KpnI으로 절단으로 오염 된 라이브러리의 3-5 μg을 소화하고 4 ℃에서 하룻밤 0.8 % 아가로 오스 겔에서 실행됩니다. </li><li> 올바른 라이브러리 밴드를 절제 겔 정제 스핀 컬럼을 사용하여 DNA를 정제하고, 1 시간 동안 37 ° C에서 고농도의 T4 DNA 리가 아제를 이용하여자가 결찰을 수행한다. 단계 2.8에 설명 된대로 그런 다음 변환 및 최종 라이브러리 DNA 분리를 반복합니다. </li></ol> 3 Transfection, 동요 및 RNA 분리 <ol><li> 각각의 독립적 인 형질 감염, 적절한 배양 배지에서 세포를 필요 매수 (MPRA 라이브러리의 복잡성에 의해 결정된 바와 같이, 논의 참조). 예를 들어, DMEM에서 배양 HEK293T / 17 세포를 10 % FBS 및 L-글루타민 / 페니실린 / 스트렙토 마이신이 보충. 각 라이브러리 및 실험 조건에 대한 적어도 두 개의 독립적 인 형질 감염을위한 세포를 배양. </li><li> MPRA 플라스미드와 함께 배양 된 세포를 형질. 형질 전환 방법 및 조건은 각 세포 유형에 맞게 최적화해야합니다. 각 형질 샘플 들어, 정합 제어로서 플라스미드 DNA의 분취 액 (50-100 NG)를 유지한다. </li><li> 예를 들어, 0.5 × 10 7 HEK293T / 성장 17 세포를 형질에 ~ 나는 30 ㎕의 리포 펙 타민 LTX 10 μL 플러스 시약을 사용하여 혈청 중 감소 된 1 ml의 옵티-MEM에서 10 μg 플라스미드 DNA와 10cm 배양 접시에 50 %의 합류. 5시간 후 형질 전환 혼합물을 제거하고 허용세포는 24 ~ 48 시간 동안 복구 할 수 있습니다. </li><li> 선택적으로, 설계 라이브러리의 상황에 또는 신호에 의존하는 조절 서열을 활성화하는 데 필요한 교란을 수행합니다. </li><li> 세포를 수확과 제조업체의 지침을 사용하여 표준 올리고 (DT) 셀룰로오스 열 또는 구슬을 사용하여 폴리 (A) + mRNA를을 격리 할 것. </li><li> 열 또는 구슬의 최대 결합 용량이 수확 한 세포에서 mRNA의 예상 총 금액을 초과 할 수 있는지 확인합니다. 예를 들어, 3.3에서 기대 수익률은 약 0.5 내지 2.5 μg의 mRNA이다. </li></ol> 4 태그-SEQ <ol><li> 형질 세포 용 해물에서 벡터 DNA의 이월을 제거하기 위해 2.4 ㎕의 터보 DNase의 불 활성화 시약을 1 시간 동안 37 ° C에서 1 μL 터보 DNase의 (2 U) 및 2.3 ㎕의 10 배 터보 DNase의 버퍼 각 20 μL mRNA의 샘플을 처리 추가 RT 후 5 분간 혼합과 90 초간 원심 분리기에 10,000그램 및 위해 신선한 용액 튜브에 옮긴다. </li><li> 확인<html> 아가로 오스 겔상에서의 제품을 각각의 mRNA 시료 60-100 ng의 섹션 4.6에 설명 된 바와 같이 PCR을 수행하고 실행하여 순도. (luc2와 pMPRA1를 사용하는 경우 0.25 킬로바이트) 특정 증폭 산물을 볼 수있는 경우, 열은 치료의 mRNA를 정제 한 후 DNase를 처리를 반복합니다. </li><li> , 태그-SEQ 시퀀싱 라이브러리를 생성하는 cDNA에 기자의 mRNA를 변환 PCR에 의해 시퀀싱 어댑터를 추가합니다. </li><li> 표 3에 설명 된대로의 mRNA / RT 프라이머 혼합물을 설정합니다. 다음 얼음에 놓고 5 분 동안 65 ° C에서 품어. 표 4에 설명 된대로 병행하여, cDNA 합성 반응을 설정합니다. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> 시약 </td><td> 1X 볼륨 (μL) </td></tr><tr><td> mRNA의 샘플 (400-700 NG 전체) </td><td> 8 </td></tr><tr><td> 올리고 0dT (50 μM) </td><td> 1 </td></tr><tr><td> 의 dNTP (10 mM의 각) </td><td> 1 </td></tr></tbody></table>cDNA 합성을위한 ove_content &quot;&gt; 표 3 RNA / 역전사 프라이머 믹스. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> 시약 </td><td> 1X 볼륨 (μL) </td></tr><tr><td> 10 배 첨자 III RT 버퍼 </td><td> 이 </td></tr><tr><td> MgCl2를 (25 밀리미터) </td><td> 4 </td></tr><tr><td> DTT (0.1 M) </td><td> 이 </td></tr><tr><td> RNaseOut (40 U / μL) </td><td> 1 </td></tr><tr><td> 첨자 III (200 U / μL) </td><td> 1 </td></tr></tbody></table> 표 4의 cDNA 합성 반응 믹스. <ol start="5"><li> 조심스럽게 mRNA의 / RT 프라이머 cDNA 합성 믹스와 혼합 결합한다. 50 분, 5 분, 85 ° C, 50 ° C에서 부화 한 후 얼음에 배치합니다. 마지막으로, 20 분 동안 37 ° C에서 2 U 리보 뉴 클레아 제의 H와 부화. </li><li> 4-6 μL와 표 5에 설명 된대로 PCR 반응을 설정cDNA의 반응 혼합물 또는 템플릿으로 50 ng의 리포터 플라스미드. 그런 다음 PCR 증폭 (2 분 95 ° C, 26 X [30 초 동안 95 ° C, 30 초 30 초 동안 55 ° C, 72 ° C], 3 분 동안 72 ° C)를 수행합니다. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> 시약 </td><td> 1X 볼륨 (μL) </td></tr><tr><td> 배 PfuUltra II HotStart PCR 마스터 믹스 </td><td> 25 </td></tr><tr><td> 프라이머 TagSeq_P1 (25 μM) </td><td> 0.5 </td></tr><tr><td> 프라이머 TagSeq_P2 (25 μM) </td><td> 0.5 </td></tr><tr><td> 템플릿 (mRNA를 cDNA를 혼합 또는 플라스미드 DNA) </td><td> 변화 </td></tr><tr><td> 핵산 분해 효소가없는 물 </td><td> 50 </td></tr></tbody></table> 표 5 태그-SEQ PCR 반응 혼합물. <ol start="7"><li> 2 % 아가 로스 젤 PCR 제품을 실행 태그-SEQ 라이브러리 증폭 산물에 해당하는 소비세 밴드 (0.25 킬로바이트 사용하는 경우luc2와 pMPRA1) 및 이들의 겔 정화 스핀 열을 정화. </li><li> 수영장, 변성 및 Illumina의 시퀀싱 기기와 직접 정제 된 태그-SEQ 증폭 산물을 시퀀싱. </li><li> 필터 저품질는 시퀀스 태그 내에 30 개 미만의 점수 또는 b) 정확하게 설계된 태그가 일치하지 않는 Phred 품질로 하나 이상의 위치를​​ 포함) 모두를 제거하여 판독한다. 나머지 각 태그는 각 도서관에 나타나는 횟수를 계산합니다. TPM에 (백만 시퀀싱 태그 당 태그) 태그 카운트를 정규화 한 후 시퀀싱 라이브러리의 각 쌍에 대한 플라스미드 유래 태그 카운트 위에 유래의 mRNA 태그 카운트의 비율을 계산한다. 서로 다른 여러 태그를 각 시퀀스 변종에 연결 한 경우, 다운 스트림 분석을 위해 자신의 평균 비율을 사용합니다. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

저자는 그들이 더 경쟁 금전적 이해 관계가 없다고 선언합니다.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

대규모 병렬 리포터 분석 실험은 (MPRA)는 DNA 서열 1 (7)을 수천 수백 수천의 전사 규제 활동의 다중 측정을 할 수 있습니다. 자신의 가장 일반적인 실시 예에서, 다중화는 오픈 리딩 프레임의 하류 서열 식별 태그가 포함되어 합성 리포터 유전자를 관심있는 각각의 시퀀스를 연결함으로써 달성된다 (ORF를,도 1). 형질 감염, RNA 분리 및 리포터 유전자 전 사체의 3 &#39;말단의 깊이 순서화에 따라, 결합 된 서열의 상대적인 활동은 식별 태그의 상대적인 풍부로부터 추론 될 수있다. <img alt="그림 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> MPRA의 그림 1 개요. MPRA 기자의 라이브러리는 합성으로 추정 조절 서열을 결합하여 구성되어 구축서열 식별 태그 뒤에 (예로서 루시페라아제 또는 GFP) &quot;불활성&quot;ORF로 구성 리포터 유전자. 도서관은 배양 된 세포의 인구에 대거 형질 전환하고, 전사 리포터 mRNA를 연속적으로 회수한다. 깊은 순서는 기자의 mRNA와 형질 전환 된 플라스미드 중 각 태그의 발생 수를 계산하는 데 사용됩니다. 플라스미드 카운트 대응하는 조절 서열의 활성을 추정하는 데 사용될 수있는 동안의 mRNA의 비를 계산. 멜린 니코의 허가를 적응, 등 2. MPRA은 관심 궤적 걸쳐 신규 조절 요소에 대해 개별 유전자 조절 요소는 1) 광범위한 돌연변이 유발, 2) 주사를 포함하여, 실험 다양한 설계에 적용 할 수 있으며, 3) 추정의 세트 천연 유전 적 변이의 효과를 테스트 프로모터, 인핸서 또는 소음기, 합성 규제 요소 사) 반 합리적인 엔지니어링. 리시퀀스 변종 braries은 퇴화 올리고 1,4, 조합 결찰 8 게놈 DNA 5의 조각화 올리고 뉴클레오티드 라이브러리 프로그램 마이크로 어레이 2,3,6,7-에 합성 (OLS), 조립 등 다양한 방법을 사용하여 생성 할 수 있습니다. 이 프로토콜은 프로모터의 라이브러리의 구조를 설명 변종 OLS와 pMPRA1 및 pMPRAdonor1 벡터 (각각 Addgene ID를 49349 및 49352; http://www.addgene.org)를 사용하여, 배양 된 포유류 세포 및 후속 정량에이 라이브러리의 일시 발현을 관련 태그의 깊은 시퀀싱 (태그-SEQ)에 의해 프로모터 활동. 이 프로토콜의 이전 버전 (2013) 연구 23, 800-811 멜린 니코 등. 자연 생명 공학 30, 271-277 (2012)과 Kheradpour 등. 게놈에보고 된 연구에 사용되었다.

<table border="0" cellpadding="0" cellspacing="0" width="954">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:359px;">Oligonucleotide library synthesis</td>
			<td style="width:201px;">Agilent, CustomArray or other OLS vendors</td>
			<td style="width:119px;">custom</td>
			<td style="width:275px;">If using OLS construction method</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">pMPRA1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49349</td>
			<td>MPRA plasmid backbone</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">pMPRAdonor1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49352</td>
			<td>luc2 ORF donor plasmid</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>OLS buffer</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">Novex TBE-Urea Gels, 10%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">EC6875BOX</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Novex TBA-Urea Sample Buffer</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">LC6876</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SYBR Gold Nucleic Acid Gel Stain</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">S-11494</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Micellula DNA Emulsion &#38; Purification Kit</td>
			<td style="width:201px;">EURx/CHIMERx</td>
			<td style="width:119px;">3600-01</td>
			<td>Library amplification by emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Herculase II Fusion DNA Polymerase</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600675</td>
			<td>Polymerase for emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SfiI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0123S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">KpnI-HF</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R3142S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">XbaI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0145S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">T4 DNA Ligase (2,000,000 units/ml)</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">M0202T</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">One Shot TOP10 Electrocomp E. coli</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">C4040-50</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">LB agar and liquid media with carbenicllin</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>Growth media for cloning</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels 1%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-01</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels, 2%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-02</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MinElute Gel Extraction Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">28604</td>
			<td>Library and backbone purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">EndoFree Plasmid Maxi Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">12362</td>
			<td>Library DNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Cell culture media</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Transfection reagents</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MicroPoly(A)Purist Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1919</td>
			<td>mRNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TURBO DNA-free Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1907</td>
			<td>Plasmid DNA removal</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SuperScript III First-Strand Synthesis System</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">18080-051</td>
			<td>cDNA synthesis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">PfuUltra II Hotstart PCR Master Mix</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600850</td>
			<td>Polymerase for Tag-Seq PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Primers (see text)</td>
			<td style="width:201px;">IDT</td>
			<td style="width:119px;">custom</td>
			<td>PAGE purify Tag-Seq primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:201px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA 고해상도, 전사 조절 요소의 시퀀스 - 활성 관계를 정량적으로 절개를 용이하게한다. 성공적인 MPRA 실험은 전형적으로 형질 라이브러리 (도 3a)에서 서열의 대부분 고도로 재현 가능한 측정 값을 수득한다. 나쁨 재현성 (도 3b)이 관찰되는 경우, 이는 정량 서열 중 하나) 낮은 절대 활성, 또는 2) 낮은 형질 감염 효율 하나에, 회수 된 RNA 샘플에서 리포터의 mRNA 너무 낮은 농도를 나타낸다. 도 4는 시금 생성 대표적인 &quot;공간 정보&quot;를 보여준다 ~ 1,2 또는 센다이 바이러스에의 노출없이 HEK293 세포에서 인간 IFNB 유전자의 상류에 145 bp의 서열의 임의의 변형 37000. 발기인 TATA 박스 알려진 근위 증강 (10)는 명확하게 정보가 풍부한 REGI으로 식별 할 수 있습니다바이러스 의존적으로 기능. <img alt="그림 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> 그림 3 태그-SEQ 재현성. 고 (A)과 낮은 (B) 재현성이 독립적 인 복제 형질에서 태그-SEQ 데이터의 예를 나타내는 산포도. 후자의 플롯은 반복에의 한 높은 mRNA의 수가 많은 아웃 라이어의 태그를 보여줍니다. 이러한 유물은 일반적으로 기자의 mRNA의 농도 인해 기자의 구조 중 낮은 절대 활동, 또는 낮은 형질 전환 효율에 하나, 정량적 PCR 증폭 너무 낮았다을 나타냅니다. <img alt="그림 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> 인간의 IFNB 전사 시작 사이트와 근위 증강의 그림 4 정보 배출량 측정. </str옹&gt; 상류 IFNB 인간 유전자의 뉴클레오티드 145 (NT) 영역의 약 37,000 랜덤 변형 (A)로 및 센다이 바이러스 (B)의 노출없이 HEK293 세포를 사용 MPRA 분석 하였다. 파란색 막대는 각 위치에서 리포터 출력 및 뉴클레오타이드 간의 상호 정보를 나타낸다. 근위 증강 및 TATA 박스는 바이러스 감염시 높은 정보 콘텐츠의 영역으로 눈에 띄는.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

배양 된 포유 동물 세포에서 대규모 병렬 리포터 분석 실험

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.4K 조회수.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

비디오: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Trypsinizing and Subculturing Mammalian Cells

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in cell death. The first step in subculturing is to detach cells from the surface of the primary culture vessel by trypsinization or mechanical means. The resultant cell suspension is then subdivided, or reseeded, into fresh cultures. Secondary cultures are checked for growth and fed periodically, and may be subsequently subcultured to produce tertiary cultures. The time between passaging of cells varies with the cell line and depends on the growth rate.

As cells reach confluency, they must be subcultured or passaged. This video will demonstrate a procedure for subculturing both adherent and suspension cells.

포유 동물 세포를 Trypsinizing 및 Subculturing

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

연구

생물학

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

포유 동물 세포에서 RNAi 심사를위한 선교 esiRNA

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

MISSION LentiPlex Pooled shRNA Library Screening in Mammalian Cells

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies.
There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids 1. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library.
The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes 2. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 108 TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification.
Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line 3, 4. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

Here we use a human LentiPlex pooled library and traditional sequencing methods to identify gene targets promoting cell survival. We demonstrate how to set up and deconvolute a LentiPlex screen and validate the results.

임무 LentiPlex는 포유 동물 세포에서 shRNA 도서관 검사를 풀링

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to ...

Analysis of Cell Cycle Position in Mammalian Cells

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of cell proliferation underlies the pathology of diseases like cancer. As such there is great need to be able to investigate cell proliferation and quantitate the proportion of cells in each phase of the cell cycle. It is also of vital importance to indistinguishably identify cells that are replicating their DNA within a larger population. Since a cell&prime;s decision to proliferate is made in the G1 phase immediately before initiating DNA synthesis and progressing through the rest of the cell cycle, detection of DNA synthesis at this stage allows for an unambiguous determination of the status of growth regulation in cell culture experiments.
DNA content in cells can be readily quantitated by flow cytometry of cells stained with propidium iodide, a fluorescent DNA intercalating dye. Similarly, active DNA synthesis can be quantitated by culturing cells in the presence of radioactive thymidine, harvesting the cells, and measuring the incorporation of radioactivity into an acid insoluble fraction. We have considerable expertise with cell cycle analysis and recommend a different approach. We Investigate cell proliferation using bromodeoxyuridine/fluorodeoxyuridine (abbreviated simply as BrdU) staining that detects the incorporation of these thymine analogs into recently synthesized DNA. Labeling and staining cells with BrdU, combined with total DNA staining by propidium iodide and analysis by flow cytometry1 offers the most accurate measure of cells in the various stages of the cell cycle. It is our preferred method because it combines the detection of active DNA synthesis, through antibody based staining of BrdU, with total DNA content from propidium iodide. This allows for the clear separation of cells in G1 from early S phase, or late S phase from G2/M. Furthermore, this approach can be utilized to investigate the effects of many different cell stimuli and pharmacologic agents on the regulation of progression through these different cell cycle phases.
In this report we describe methods for labeling and staining cultured cells, as well as their analysis by flow cytometry. We also include experimental examples of how this method can be used to measure the effects of growth inhibiting signals from cytokines such as TGF-&beta;1, and proliferative inhibitors such as the cyclin dependent kinase inhibitor, p27KIP1. We also include an alternate protocol that allows for the analysis of cell cycle position in a sub-population of cells within a larger culture5. In this case, we demonstrate how to detect a cell cycle arrest in cells transfected with the retinoblastoma gene even when greatly outnumbered by untransfected cells in the same culture. These examples illustrate the many ways that DNA staining and flow cytometry can be utilized and adapted to investigate fundamental questions of mammalian cell cycle control.

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol. We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

포유 동물 세포의 세포주기의 위치 분석

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of ...

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum (ER). However, the visualization of these mRNAs can be challenging. This is especially true when only a fraction of the mRNA is ER-associated and their distribution to this organelle is obstructed by non-targeted (i.e. "free") transcripts. In order to monitor ER-associated mRNAs, we have developed a method in which cells are treated with a short exposure to a digitonin extraction solution that selectively permeabilizes the plasma membrane, and thus removes the cytoplasmic contents, while simultaneously maintaining the integrity of the ER. When this method is coupled with fluorescent in situ hybridization (FISH), one can clearly visualize ER-bound mRNAs by fluorescent microscopy. Using this protocol the degree of ER-association for either bulk poly(A) transcripts or specific mRNAs can be assessed and even quantified. In the process, one can use this assay to investigate the nature of mRNA-ER interactions.

Here we describe a method to visualize endoplasmic reticulum-associated mRNAs in mammalian tissue culture cells. This technique involves the selective permeabilization of the plasma membrane with digitonin to remove cytoplasmic contents followed by fluorescent in situ hybridization to detect either bulk poly(A) mRNA or specific transcripts.

포유류의 세포에서 Endoplasmic 소포체 현지화 mRNAs의 시각화

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum ...

Chromosome Preparation From Cultured Cells

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as fluorescence in situ hybridization (FISH), this assay has the powerful ability to analyze individual cells for aberrations that involve gains or losses of portions of the genome&#160;and rearrangements involving one or more chromosomes. In humans, chromosome abnormalities occur in approximately 1 per 160 live births1,2, 60-80% of all miscarriages3,4, 10% of stillbirths2,5, 13% of individuals with congenital heart disease6, 3-6% of infertility cases2, and in many patients with developmental delay&#160;and birth defects7. Cytogenetic analysis of malignancy is routinely used by researchers and clinicians, as observations of clonal chromosomal abnormalities have been shown to have both diagnostic and prognostic significance8,9.&#160; Chromosome isolation is invaluable for gene therapy and stem cell research of organisms including nonhuman primates and rodents10-13.
Chromosomes can be isolated from cells of live tissues, including blood lymphocytes, skin fibroblasts, amniocytes, placenta, bone marrow, and tumor specimens. Chromosomes are analyzed at the metaphase stage of mitosis, when they are most condensed and therefore more clearly visible. The first step of the chromosome isolation technique involves the disruption of the spindle fibers by incubation with Colcemid, to prevent the cells from proceeding to the subsequent anaphase stage. The cells are then treated with a hypotonic solution and preserved in their swollen state with Carnoy&#39;s fixative. The cells are then dropped on to slides and can then be utilized for a variety of procedures. G-banding involves trypsin treatment followed by staining with Giemsa to create characteristic light and dark bands. The same procedure to isolate chromosomes can be used for the preparation of cells for procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY)14,15.

Chromosomes can be isolated from live cells such as lymphocytes or skin fibroblasts, and from organisms including humans or mice. These chromosome preparations can be further utilized for routine G-banding and molecular cytogenetic procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY).

배양 세포에서 염색체 준비

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as ...

Viability Assays for Cells in Culture

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized viability assays are expensive in terms of equipment but can be faster and more objective than manual cell counts. The present report describes the use of three such viability assays. Two of these assays are infrared and one is luminescent. Both infrared assays rely on a 16&#160;bit Odyssey Imager. One infrared assay uses the DRAQ5 stain for nuclei combined with the Sapphire stain for cytosol and is visualized in the 700 nm channel. The other infrared assay, an In-Cell Western, uses antibodies against cytoskeletal proteins (&#945;-tubulin or microtubule associated protein 2) and labels them in the 800 nm channel. The third viability assay is a commonly used luminescent assay for ATP, but we use a quarter of the recommended volume to save on cost. These measurements are all linear and correlate with the number of cells plated, but vary in sensitivity. All three assays circumvent time-consuming microscopy and sample the entire well, thereby reducing sampling error. Finally, all of the assays can easily be completed within one day of the end of the experiment, allowing greater numbers of experiments to be performed within short timeframes. However, they all rely on the assumption that cell numbers remain in proportion to signal strength after treatments, an assumption that is sometimes not met, especially for cellular ATP. Furthermore, if cells increase or decrease in size after treatment, this might affect signal strength without affecting cell number. We conclude that all viability assays, including manual counts, suffer from a number of caveats, but that computerized viability assays are well worth the initial investment. Using all three assays together yields a comprehensive view of cellular structure and function.

Therapeutic compounds are often first examined in vitro with viability assays. Blind cell counts by a human observer can be highly sensitive to small changes in cell number but do not assess function. Computerized viability assays, as described here, can assess both structure and function in an objective manner.

문화의 세포에 대한 생존 분석 실험

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized ...

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

엑손 캡처 및 대규모 병렬 염기 서열 종양 검체에서 체세포 유전 변경을 검출

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Visualization of Endoplasmic Reticulum Subdomains in Cultured Cells

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and functions despite the intense interorganelle molecular traffic. The techniques described in this paper are powerful means of studying protein and lipid mobility and trafficking in vivo and in their physiological environment. Fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP) are widely used live-cell imaging techniques for studying intracellular trafficking through the exo-endocytic pathway, the continuity between organelles or subcompartments, the formation of protein complexes, and protein localization in lipid microdomains, all of which can be observed under physiological and pathological conditions. The limitations of these approaches are mainly due to the use of fluorescent fusion proteins, and their potential drawbacks include artifactual over-expression in cells and the possibility of differences in the folding and localization of tagged and native proteins. Finally, as the limit of resolution of optical microscopy (about 200 nm) does not allow investigation of the fine structure of the ER or the specific subcompartments that can originate in cells under stress (i.e. hypoxia, drug administration, the over-expression of transmembrane ER resident proteins) or under pathological conditions, we combine live-cell imaging of cultured transfected cells with ultrastructural analyses based on transmission electron microscopy.

We describe the imaging approaches we use to investigate the distribution and mobility of the transfected fluorescent proteins resident in the endoplasmic reticulum (ER) by means of the confocal imaging of living cells. We also ultrastructurally analyze the effect of their expression on the architecture of this subcellular compartment.

배양 된 세포의 소포체 하위 도메인의 시각화

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

배양 된 포유 동물 세포의 생물 학적 경로의 유비퀴틴과 유비​​퀴틴 같은 시스템 레귤레이터를 확인하는 siRNA를 상영

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...