Diese Arbeit wurde von der National Human Genome Research Institute der National Institutes of Health unter Preis Anzahl R01HG006785 unterstützt.

1. Sequenz Design und Synthese <ol><li> Beginnen MPRA mit dem Design und der Synthese von Sequenzen, die Marktaktivität untersucht werden. Für die Kompatibilität mit dem pMPRA Vektor-Serie, entwerfen jede Sequenz benutzen die folgende Vorlage: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- Tag -AGATCGGAAGAGCGTCG-3 &#39;, wo var bezeichnet die Sequenz zu untersuchenden und Tag bedeutet ein oder mehrere Tags identifizieren. </li><li> Die beiden variablen Regionen (var und Tag) werden durch ein Paar von KpnI (GGTACC) und XbaI (TCTAGA) Restriktionsstellen getrennt, um gerichtete Ligation eines Reportergens Fragment zwischen ihnen zu erleichtern. Zusätzlich werden zwei verschiedene SfiI (GGCCNNNNNGGCC) Seiten durch PCR zugesetzt werden, um gerichtete Ligation in die pMPRA Rückgrat zulassen. Die variablen Regionen dürfen nicht zusätzliche Kopien eines dieser Restriktionsstellen enthalten. Falls erforderlich, eine oder mehrere dieser Restriktionsenzyme ersetzt werden kann, Solange die Ersatz 1) ermöglichen effizientes Schneiden in der Nähe der Enden der DNA-Moleküle, und 2) nicht an anderer Stelle in der Vektorsequenz geschnitten. Siehe Diskussion für weitere Informationen. </li><li> Rufen Sie die in Tabelle 1 von einem kommerziellen Anbieter aufgelistet erforderlich Primer. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [index] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tabelle 1. Primer-Sequenzen. [Index] bezeichnet eine 6 bis 8 nt Index Sequenz für Multiplex-Sequenzierung verwendet. Erhalten mindestens 8 TagSeq-P2 Primer mit unterschiedlichen Indizes. Alleder Primer sollten durch HPLC oder PAGE gereinigt werden. <ol start="4"><li> Oligonukleotid-Bibliotheken können aus einer kommerziellen Lieferanten oder Kerneinrichtung erhalten werden, oder durch Verwendung eines programmierbaren Microarray-basierte Oligonucleotidsynthesizer wie vom Hersteller beschrieben erzeugt. Resuspendieren der OLS-Produkte in 100 ul TE 0,1 Puffer. </li><li> Führen Sie die Oligonukleotid-Bibliotheken auf einem 10% TBE-Harnstoff-Denaturierung Polyacrylamid-Gel. Legen Sie ca. 1 pmol pro Bahn und Fleck mit ssDNA empfindlichen Fluoreszenzfarbstoff, um ihre Qualität (2A) zu beurteilen. </li><li> Wenn eine diskrete Bande, die den Volllängen-Oligonukleotide können visualisiert werden (Abbildung 2A, Bahnen 1 und 2), die Verbrauchs den entsprechenden Acrylamid-Gel Slice und eluieren Oligonukleotide in 100 ul TE 0,1 über Nacht bei Raumtemperatur unter Schütteln. Andernfalls fahren Sie mit der RAW OLS Aufhängung. </li><li> Verstärken und fügen SfiI Schwänze mit dem Oligonukleotid-Bibliothek mit Hilfe Emulsions-PCR 9 </<html> sup&gt;. </li><li> Bis 50 ul PCR-Reaktionsgemischen, wie in Tabelle 2 beschrieben. Dann verbinden sich mit 300 ul Öl und Tensid-Mischung aus der Emulsion und Micellula DNA Purification Kit und Vortex für 5 min bei 4 ° C ist. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Reagens </td><td> 1x Volume (ul) </td></tr><tr><td> Herculase II Fusion DNA Polymerase </td><td> 0,5 </td></tr><tr><td> 5x Herculase II Reaktionspuffer </td><td> 10 </td></tr><tr><td> dNTP (10 mM jeweils) </td><td> 1,25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1,25 </td></tr><tr><td> Primer MPRA_SfiI_F (25 uM) </td><td> 0,25 </td></tr><tr><td> Primer MPRA_SfiI_R (25 uM) </td><td> 0,25 </td></tr><tr><td> OLS-Vorlage (1-10 attomol) </td><td> variiert </td></tr><tr><td> Nuklease-freies Wasser </td><td> 50 </td></tr></tbody></table>ve_content &quot;&gt; Tabelle 2. Emulsion PCR-Reaktionsmischung (Wasserphase). <ol start="9"><li> Verwenden Sie die Konzentration, die die maximale Ausbeute der Amplifikation Produkte gibt ohne das Auftreten von Artefakten (siehe Abschnitt 1.12). </li><li> Abgeben der resultierenden Emulsion in PCR-Röhrchen und führen 20 Zyklen PCR (2 min bei 95 ° C, 20 x [20 sec 95 ° C, 20 sec bei 55 ° C, 30 sec bei 72 ° C], 3 min bei 95 ° C). </li><li> Pool und brechen jede 350 ul Emulsion-PCR-Reaktion durch Zugabe von 1 ml Isobutanol und kurz vortexen und dann reinigen die Verstärkung Produkt mit einem DNA-Aufreinigung Spalte. </li><li> Führen Sie einen aliquoten auf einem 2% bzw. 4% Agarose-Gel, um artefaktfreie Verstärkung (2B) zu überprüfen. </li></ol><img alt="Figur 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Figur 2: Herstellung von Oligonukleotid-Synthesebibliotheken. A) </sTrong&gt; Drei verschiedene rohe Oligonukleotid-Synthese-Bibliotheken (OLS) auf denaturierenden 10% TBE-Harnstoff-Polyacrylamid-Gelen laufen. Banden, die in voller Länge Oligonukleotide (*) visualisiert und aus Bibliotheken 1 ausgeschnitten werden und 2. Bibliothek 3 enthält Schadstoffe, die mit PAGE Reinigung stören. Wenn dies der Fall ist, fahren Sie mit PCR-Amplifikation. B) Die Produkte von offenen und Emulsions-PCR-Amplifikation der gleichen Oligonukleotid-Bibliothek ausgeführt auf einem Agarosegel. PCR-Amplifikation von komplexen Oligonukleotid-Bibliotheken erstellt häufig chimären Produkte und andere Artefakte, die als höhere und niedrigere Bands auftreten können. Emulsions-PCR können diese Artefakte zu minimieren. 2. Library Construction <ol><li> Vorbereitung eines linearisierten Plasmid-Backbone durch Verdau mit SfiI pMPRA1 Vektor bei 50 ° C für 2 Stunden, auf einem 1% igen Agarosegel aufgetrennt, die Verbrauchs das Rückgrat Band (in diesem Fall 2,5 kb) und reinigt sie mit einem Gel-Reinigung Spin-Säule. </li><li> Verdauendie Emulsions-PCR-Produkte aus Schritt 1.4 mit SfiI bei 50 ° C für 2 h und Reinigung mittels DNA-Reinigungssäulen. </li><li> Um die Promotor-Tag-Bibliothek in die linearisierte Vektor-Rückgrat ligieren, bis Reaktionen mit 100 ng des verdauten PCR-Produkt, 50 ng linearisierte Vektor-Rückgrat und T4-DNA-Ligase eingestellt. Inkubieren über Nacht bei 16 ° C und dann bei 65 ° C für 20 min, um die Ligase zu inaktivieren. </li><li> Transformation von E. coli mit dem Ligationsreaktion. Die Bibliothek Komplexität zu bewahren, wollen mindestens 10x mehr KBE erhalten, als es verschiedene Promotor-Tag-Kombinationen in der Bibliothek ausgelegt. </li><li> Wenn die Gesamtzahl von Tags ist etwa 100.000, kann die Ziel cfu typischerweise durch Ausführen 6-8 parallelen Umwandlungen pro Bibliothek erreicht werden. </li><li> Für jede Transformation, kombinieren 50 ul elektro E. coli-Zellen mit 2 ul Ligationsmischung auf Eis. Transformation durch Elektroporation, erholen die Zellen in 800 ul SOCMedium unter Schütteln bei 37 ° C für 1 h und dann kombinieren Zellen aus den parallel Transformationen. </li><li> Um die Transformationseffizienz zu bewerten, plattenReihenVerdünnungen von einem alinquot der gewonnenen Zellen auf LB-Agarplatten mit 50-100 ug / ml Carbenicillin und Inkubation über Nacht bei 37 ° C aufweist. Schätzung Gesamtkolonie wie beobachtet (cfu) x (Verdünnungsfaktor) × (V - V) / V, wobei V das Gesamtvolumen der gewonnenen Zellen und v das Volumen des Aliquots für die serielle Verdünnungen gemacht. </li><li> Gleichzeitig Verwenden der Rest der gewonnenen Zellen zur Beimpfung 200 ml LB mit 100 ug / ml Carbenicillin ergänzt. Wachsen Zellen bei 37 ° C über Nacht in einem Schüttelinkubator und dann isolieren die Plasmid-DNA nach Standardverfahren. </li><li> Digest ein Aliquot der isolierten Plasmid-Bibliothek mit SfiI bei 50 ° C für 2 h und laufen auf einem 1% Agarose-Gel auf die Anwesenheit des Inserts zu bestätigen. </li><li> Linearisierung der Plasmid-Bibliothek von cUtting zwischen den Promotorvarianten und Tags mit KpnI und XbaI. Um die Verdauung Effizienz zu maximieren, führen Serien Aufschlüsse: </li><li> Zunächst verdauen mit KpnI bei 37 ° C für 1 h und reinigen mit magnetischen Kügelchen. Zweitens Verdau mit XbaI unter Zusatz von 1 U alkalischer Shrimp-Phosphatase bei 37 ° C für 2 h, Hitze inaktiviert bei 65 ° C für 5 min und dann unter Verwendung von magnetischen Kügelchen zu reinigen. </li><li> Führen eines Aliquots auf einem 1% Agarose-Gel, um eine vollständige Linearisierung überprüfen. Wenn ungeschnittenen Plasmid sichtbar ist, sollte das linearisierte Fragment gelgereinigt werden. </li><li> Um eine MPRA Bibliothek geeignet für die Transfektion in Säugerzellen zu erzeugen, ligieren einen ORF mit KpnI / XbaI kompatible Enden in den lineaZwischen Bibliothek. </li><li> Wenn Sie einen kompatiblen luc2 ORF-Fragment aus pMPRAdonor1 vorzubereiten, zu verdauen, die dieses Plasmid mit KpnI und XbaI bei 37 ° C für 1 h und auf einem 1% Agarose-Gel laufen. Verbrauchsteuern Das ORF-Fragment (1,7 kB in diesem Fall) und zu reinigen mit einer Gelreinigung Spinsäule. </li><li> Klonen Sie die ORF-Fragment in den lineaZwischen Bibliothek wie in den Schritten 2,3-2,8 beschrieben. </li><li> Digest eines Aliquots (entsprechend 1-2 ug) des MPRA Bibliothek mit KpnI bei 37 ° C für 1 h und auf einem 1% Agarose-Gel laufen gelassen. Wenn die Bibliothek verdaut wird als Einzelband, Abschnitt 3. vorgehen, wenn zusätzliche Banden beobachtet (in der Regel um Verschleppungen von Zwischen Konstrukte entsprechend), kann die Bibliothek weiter gereinigt wie folgt: </li><li> Verdauen 3-5 ug des kontaminierten Bibliothek mit KpnI bei 37 ° C für 1 h und auf einem 0,8% Agarose-Gel bei 4 ° C über Nacht ausgeführt. </li><li> Auszuschneiden die korrekte Bandbibliothek, reinigen die DNA unter Verwendung einer Gel-Reinigung Spin-Säule und führen die Selbstligation unter Verwendung von hoch-konzentrierten T4-DNA-Ligase bei 37 ° C für 1 Stunde. Wiederholen Sie dann die Transformation und letzte Bibliothek DNA-Isolierung, wie in Schritt 2.8 beschrieben. </li></ol> 3. Transfection, Störungs und RNA-Isolierung <ol><li> Für jede unabhängige Transfektion Kultur der erforderlichen Anzahl von Zellen (wie von der MPRA Bibliothek Komplexität bestimmt, siehe Diskussion) in geeigneten Medium. Beispielsweise Kultur HEK293T / 17 Zellen in DMEM, ergänzt mit 10% FBS und L-Glutamin / Penicillin / Streptomycin. Kulturzellen von mindestens zwei unabhängigen Transfektionen für jede Bibliothek und experimentellen Bedingungen. </li><li> Transfektion der kultivierten Zellen mit Plasmiden MPRA. Die Transfektion Verfahren und Bedingungen müssen für jeden Zelltyp optimiert. Für jede Probe transfiziert sind, behalten ein Aliquot (50-100 ng) der Plasmid-DNA als eine abgestimmte Steuerung. </li><li> B. Transfektion von 0,5 x 10 7 HEK293T / 17-Zellen gezüchtet, um ~ 50% Konfluenz in einer 10 cm Kulturschale mit 10 ug Plasmid-DNA in 1 ml Opti-MEM I Reduzierte Serummedium unter Verwendung von 30 ul Lipofectamine LTX und 10 ul plus Reagenz. Entfernen Sie die Transfektion Mischung nach 5 Stunden und lassen Sie dasZellen für 24-48 Stunden zu erholen. </li><li> Optional führen Sie keine Störung erforderlich, um kontextabhängige oder Signal regulatorischen Sequenzen in der Bibliothek ausgelegt aktivieren. </li><li> Ernte der Zellen und Isolierung von Poly (A) + mRNA mit Standard-Oligo (dT) Cellulose-Säulen oder Kugeln mit Anweisungen des jeweiligen Herstellers. </li><li> Sicherzustellen, dass die maximale Bindungskapazität der Säulen oder Beads die Gesamtmenge an mRNA aus den geernteten Zellen erwartet überschreiten. Zum Beispiel kann die erwartete Rendite aus dem Abschnitt 3.3 ist etwa 0,5-2,5 ug mRNA. </li></ol> 4. Tag-Seq <ol><li> Verschleppung von Vektor-DNA aus den transfizierten Zelllysaten zu beseitigen, behandeln jeweils 20 ul mRNA-Probe mit 1 ul Turbo DNase (2 U) und 2,3 ul 10x Turbo DNase-Puffer bei 37 ° C für 1 h, fügen Sie 2,4 ul Turbo DNase Inaktivierung Reagenz bei RT für 5 min Mischen, Zentrifugieren bei 10.000 g für 90 sec, und dann wird die Lösung in ein frisches Röhrchen. </li><li> Überprüfen<html> Reinheit durch eine PCR, wie in Abschnitt 4.6 auf 60-100 ng jedes mRNA Probe beschrieben, und dann läuft die Produkte auf einem Agarose-Gel. Wenn bestimmte Amplikons sind sichtbar (0,25 kb bei Verwendung pMPRA1 mit luc2), Spalte reinigen die mRNA behandelt und wiederholen Sie den DNase-Behandlung. </li><li> Um Tag-Seq-Sequenzierung Bibliotheken generieren, konvertieren Reporter mRNA in cDNA und fügen Sequenzierung Adapter durch PCR. </li><li> Einrichtung mRNA / RT-Primer Mischungen, wie in Tabelle 3 beschrieben. Inkubation bei 65 ° C für 5 min auf Eis zu stellen. Parallel dazu richten Sie cDNA-Synthese-Reaktionen, wie in Tabelle 4 beschrieben. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagens </td><td> 1x Volume (ul) </td></tr><tr><td> mRNA Probe (400-700 ng Gesamt) </td><td> 8 </td></tr><tr><td> Oligo-0DT (50 uM) </td><td> 1 </td></tr><tr><td> dNTP (10 mM jeweils) </td><td> 1 </td></tr></tbody></table>ove_content &quot;&gt; Tabelle 3. RNA / reverse Transkription Primer-Mix für die cDNA-Synthese. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagens </td><td> 1x Volume (ul) </td></tr><tr><td> 10x Superscript III RT Buffer </td><td> 2 </td></tr><tr><td> MgCl 2 (25 mM) </td><td> 4 </td></tr><tr><td> DTT (0,1 M) </td><td> 2 </td></tr><tr><td> RNaseOut (40 U / ul) </td><td> 1 </td></tr><tr><td> Superscript III (200 U / ul) </td><td> 1 </td></tr></tbody></table> Tabelle 4. cDNA-Synthese Reaktionsmischung. <ol start="5"><li> Sanft kombinieren mRNA / RT-Primer vermischt sich mit der cDNA-Synthese Mischungen. Inkubieren bei 50 ° C für 50 min, 85 ° C für 5 min und dann auf Eis. Schließlich Inkubation mit 2 U von Ribonuclease H bei 37 ° C für 20 min. </li><li> Bis PCR-Reaktionen wie in Tabelle 5 mit 4-6 ul beschriebencDNA Reaktionsmischung oder 50 ng Reporterplasmid als Vorlagen. Dann führen die PCR-Amplifikation (95 ° C für 2 min, 26 x [95 ° C für 30 sec, 55 ° C für 30 sec, 72 ° C für 30 sec], 72 ° C für 3 min). </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagens </td><td> 1x Volume (ul) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> Primer TagSeq_P1 (25 uM) </td><td> 0,5 </td></tr><tr><td> Primer TagSeq_P2 (25 uM) </td><td> 0,5 </td></tr><tr><td> Vorlage (mRNA, cDNA-Mix oder Plasmid-DNA) </td><td> variiert </td></tr><tr><td> Nuklease-freies Wasser </td><td> 50 </td></tr></tbody></table> Tabelle 5. Tag-Seq PCR-Reaktionsmischung. <ol start="7"><li> Führen Sie die PCR-Produkte über ein 2% Agarose-Gel, Verbrauch Bands, die den Tag-Seq Bibliothek Amplikons (0,25 kb bei VerwendungpMPRA1 mit luc2) und reinigen Sie diese mit Gel-Reinigung Spin-Säulen. </li><li> Pool, denaturieren und Sequenz, die das gereinigte Tag-Seq Amplikons direkt mit einem Illumina-Sequenzierung Instrument. </li><li> Filter mit geringer Qualität liest, indem alle, dass a) eine oder mehrere Position mit einem Phred Qualitätsfaktor von weniger als 30 innerhalb des sequenzierten Tag oder b) nicht genau einen Tag ausgelegt entsprechen. Zählen Sie die Anzahl der jeweils verbleibenden Tag in jeder Bibliothek erscheint. Normalisieren die Tag zählt, um TPM (Tags pro Million sequenziert Tags) und berechnen dann das Verhältnis der mRNA-Tag zählt über Plasmid-abgeleitete Tag zählt für jedes Paar von Sequenzierungsbibliotheken. Wenn mehrere verschiedene Tags wurden zu jedem Sequenzvariante verknüpft, nutzen ihre mittlere Verhältnisse für Downstream-Analyse. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Die Autoren erklären, dass sie keine finanziellen Interessen konkurrieren.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Massively Parallel Reporter Assays (MPRA) erlauben Multiplex-Messung der Transkriptionsregulationsaktivitäten Tausende bis Hunderttausende von DNA-Sequenzen 1-7. In ihrer allgemeinsten Ausführung wird durch Multiplexen Koppeln jeder Sequenz von Interesse ein synthetisches Reportergen, das eine Identifizierungssequenz Tag stromabwärts eines offenen Leserasters enthält erzielt (ORF Abbildung 1). Nach der Transfektion der RNA-Isolierung und Sequenzierung des Tief 3 &#39;Enden der Reportergen-Transkripten, können die relativen Aktivitäten der gekoppelten Sequenzen aus der relativen Häufigkeit der Ermittlung Variablen abgeleitet werden. <img alt="Figur 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> Abbildung 1. Übersicht über MPRA. Eine Bibliothek von MPRA Reporterkonstrukte durch Kopplung mutmaßlichen regulatorischen Sequenzen zu synthetischen gebautReportergene, die aus einem &quot;inerten&quot; ORF bestehen (wie GFP oder Luciferase), gefolgt von einem identifizierenden Sequenz-Tag. Die Bibliothek wird in Massen in eine Population von kultivierten Zellen transfiziert und transkribiert Reporter mRNA wird anschließend zurückgewonnen. Deep sequencing wird verwendet, um die Anzahl der Vorkommen der einzelnen Tag unter den Reporter-mRNAs und den transfizierten Plasmiden zählen. Das Verhältnis der mRNA zählt über Plasmid Zahlen können verwendet werden, um die Aktivität der entsprechenden Regulationssequenz abzuleiten. Angepasst mit Erlaubnis von Melnikow, et al 2. MPRA kann zu einer breiten Vielzahl von experimentellen Designs angepasst werden, einschließlich 1) umfassende Mutagenese einzelner Gen regulatorische Elemente, 2) Überprüfung auf neue regulatorische Elemente in einem Ort von Interesse, 3) Testen der Wirkung der natürlichen genetischen Variation in einer Menge von putativen Promotoren, Enhancer oder Silencer, und 4) semi-rationale Konstruktion von synthetischen regulatorische Elemente. Libibliotheken von Sequenzvarianten können unter Verwendung einer Vielzahl von Verfahren, einschließlich Oligonukleotid-Synthese von Bibliotheken (OLS) auf programmierbaren Mikroarrays 2,3,6,7, Montage von degenerierten Oligonukleotiden 1,4, kombinatorische Ligations 8 und Fragmentierung der genomischen DNA, 5 erzeugt werden. Dieses Protokoll beschreibt die Konstruktion einer Bibliothek von Promotorvarianten mit OLS und die pMPRA1 und pMPRAdonor1 Vektoren (Addgene IDs 49349 und 49352 sind; http://www.addgene.org) transiente Transfektion dieser Bibliothek in kultivierte Säugerzellen und die anschließende Quantifizierung der Promotor-Aktivitäten von deep sequencing der ihnen zugeordneten Tags (Tag-Seq). Frühere Versionen von diesem Protokoll wurden in der Forschung in Melnikov et al. Nature Biotechnology 30, 271-277 (2012) und in Kheradpour et al. Genome Research 23, 800-811 (2013) berichtet, verwendet.

<table border="0" cellpadding="0" cellspacing="0" width="954">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:359px;">Oligonucleotide library synthesis</td>
			<td style="width:201px;">Agilent, CustomArray or other OLS vendors</td>
			<td style="width:119px;">custom</td>
			<td style="width:275px;">If using OLS construction method</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">pMPRA1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49349</td>
			<td>MPRA plasmid backbone</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">pMPRAdonor1</td>
			<td style="width:201px;">Addgene</td>
			<td style="width:119px;">49352</td>
			<td>luc2 ORF donor plasmid</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:359px;">TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>OLS buffer</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:359px;">Novex TBE-Urea Gels, 10%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">EC6875BOX</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Novex TBA-Urea Sample Buffer</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">LC6876</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SYBR Gold Nucleic Acid Gel Stain</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">S-11494</td>
			<td>PAGE purification of OLS products</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Micellula DNA Emulsion &#38; Purification Kit</td>
			<td style="width:201px;">EURx/CHIMERx</td>
			<td style="width:119px;">3600-01</td>
			<td>Library amplification by emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Herculase II Fusion DNA Polymerase</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600675</td>
			<td>Polymerase for emulsion PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SfiI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0123S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">KpnI-HF</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R3142S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">XbaI</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">R0145S</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">T4 DNA Ligase (2,000,000 units/ml)</td>
			<td style="width:201px;">New England Biolabs</td>
			<td style="width:119px;">M0202T</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">One Shot TOP10 Electrocomp E. coli</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">C4040-50</td>
			<td>Library cloning with pMPRA vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">LB agar and liquid media with carbenicllin</td>
			<td style="width:201px;">Generic</td>
			<td style="width:119px;">n/a</td>
			<td>Growth media for cloning</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels 1%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-01</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">E-Gel EX Gels, 2%</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">G4010-02</td>
			<td>Library verification and purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MinElute Gel Extraction Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">28604</td>
			<td>Library and backbone purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">EndoFree Plasmid Maxi Kit</td>
			<td style="width:201px;">Qiagen</td>
			<td style="width:119px;">12362</td>
			<td>Library DNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Cell culture media</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Transfection reagents</td>
			<td style="width:201px;">n/a</td>
			<td style="width:119px;">n/a</td>
			<td>Experiment-specific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">MicroPoly(A)Purist Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1919</td>
			<td>mRNA isolation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TURBO DNA-free Kit</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">AM1907</td>
			<td>Plasmid DNA removal</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">SuperScript III First-Strand Synthesis System</td>
			<td style="width:201px;">Life Technologies</td>
			<td style="width:119px;">18080-051</td>
			<td>cDNA synthesis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">PfuUltra II Hotstart PCR Master Mix</td>
			<td style="width:201px;">Agilent</td>
			<td style="width:119px;">600850</td>
			<td>Polymerase for Tag-Seq PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Primers (see text)</td>
			<td style="width:201px;">IDT</td>
			<td style="width:119px;">custom</td>
			<td>PAGE purify Tag-Seq primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:201px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA ermöglicht hochauflösende, quantitative Zerlegung der Sequenz-Aktivitäts-Beziehungen von transkriptionalen regulatorischen Elemente. Eine erfolgreiche MPRA Experiment ergeben typischerweise hoch reproduzierbare Messungen für die Mehrzahl der Sequenzen in der Bibliothek transfiziert (3A). Wenn schlechte Reproduzierbarkeit beobachtet (3B), ist dies ein Hinweis auf eine zu niedrige Konzentration an Reporter-mRNAs in den gewonnenen RNA-Proben aufgrund entweder 1) geringe absolute Aktivität unter den Sequenzen untersucht, oder 2) geringe Transfektionseffizienz. Figur 4 zeigt ein repräsentatives &quot;Daten-Fußabdruck&quot; 1,2 durch Bestimmung erzeugt ~ 37.000 zufällige Varianten eines 145 bp-Sequenz stromaufwärts des menschlichen IFNB Gens in HEK293-Zellen, die mit oder ohne Einwirkung von Sendai-Virus. Der Promotor TATA-Box und bekannt proximalen Enhancer 10 eindeutig als informationsreichen regi identifiziert werdenons in einem Virus-abhängige Weise. <img alt="Figur 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Abbildung 3. Tag-Seq Reproduzierbarkeit. Streudiagramme, die Beispiele von Tag-Seq-Daten aus zwei unabhängigen Transfektionen mit hoher Wiederholungs (A) und niedriger (B) Reproduzierbarkeit. Letztere Plot zeigt viele Ausreißer-Tags mit hoher mRNA zählt in nur einer der zwei Wiederholungen. Solche Artefakte typischerweise an, dass die Konzentrationen der Reporter-mRNAs zu niedrig für die quantitative PCR-Amplifikation entweder durch niedrige absolute Aktivitäten unter den Reporterkonstrukte oder niedrige Transfektionseffizienz. <img alt="Figur 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> Abbildung 4. Information Footprinting des menschlichen IFNB Transkriptionsstartstelle und proximalen Enhancer. </strOng&gt; Etwa 37.000 zufällige Varianten einer 145 Nukleotid (nt)-Region stromaufwärts des menschlichen Gens wurden unter Verwendung IFNB MPRA in HEK293-Zellen, die mit (A) und ohne (B) Einwirkung von Sendai-Virus untersucht. Die blauen Balken zeigen die gegenseitige Information zwischen dem Ausgang und dem Reporter Nukleotid an jeder Position. Das proximale Enhancer und TATA-Box stehen als Regionen mit hoher Informationsgehalt auf Virusinfektion.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Massively Parallel Reporter Assays in kultivierte Säugerzellen

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.3K Aufrufe.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Serie: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Trypsinizing and Subculturing Mammalian Cells

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in cell death. The first step in subculturing is to detach cells from the surface of the primary culture vessel by trypsinization or mechanical means. The resultant cell suspension is then subdivided, or reseeded, into fresh cultures. Secondary cultures are checked for growth and fed periodically, and may be subsequently subcultured to produce tertiary cultures. The time between passaging of cells varies with the cell line and depends on the growth rate.

As cells reach confluency, they must be subcultured or passaged. This video will demonstrate a procedure for subculturing both adherent and suspension cells.

Trypsinizing und Subkultivierung Säugerzellen

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

Forschung

Biologie

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

MISSION esiRNA für RNAi-Screening in Säugerzellen

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

MISSION LentiPlex Pooled shRNA Library Screening in Mammalian Cells

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies.
There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids 1. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library.
The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes 2. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 108 TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification.
Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line 3, 4. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

Here we use a human LentiPlex pooled library and traditional sequencing methods to identify gene targets promoting cell survival. We demonstrate how to set up and deconvolute a LentiPlex screen and validate the results.

MISSION LentiPlex Pooled shRNA Bibliothek Screening in Säugerzellen

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to ...

Analysis of Cell Cycle Position in Mammalian Cells

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of cell proliferation underlies the pathology of diseases like cancer. As such there is great need to be able to investigate cell proliferation and quantitate the proportion of cells in each phase of the cell cycle. It is also of vital importance to indistinguishably identify cells that are replicating their DNA within a larger population. Since a cell&prime;s decision to proliferate is made in the G1 phase immediately before initiating DNA synthesis and progressing through the rest of the cell cycle, detection of DNA synthesis at this stage allows for an unambiguous determination of the status of growth regulation in cell culture experiments.
DNA content in cells can be readily quantitated by flow cytometry of cells stained with propidium iodide, a fluorescent DNA intercalating dye. Similarly, active DNA synthesis can be quantitated by culturing cells in the presence of radioactive thymidine, harvesting the cells, and measuring the incorporation of radioactivity into an acid insoluble fraction. We have considerable expertise with cell cycle analysis and recommend a different approach. We Investigate cell proliferation using bromodeoxyuridine/fluorodeoxyuridine (abbreviated simply as BrdU) staining that detects the incorporation of these thymine analogs into recently synthesized DNA. Labeling and staining cells with BrdU, combined with total DNA staining by propidium iodide and analysis by flow cytometry1 offers the most accurate measure of cells in the various stages of the cell cycle. It is our preferred method because it combines the detection of active DNA synthesis, through antibody based staining of BrdU, with total DNA content from propidium iodide. This allows for the clear separation of cells in G1 from early S phase, or late S phase from G2/M. Furthermore, this approach can be utilized to investigate the effects of many different cell stimuli and pharmacologic agents on the regulation of progression through these different cell cycle phases.
In this report we describe methods for labeling and staining cultured cells, as well as their analysis by flow cytometry. We also include experimental examples of how this method can be used to measure the effects of growth inhibiting signals from cytokines such as TGF-&beta;1, and proliferative inhibitors such as the cyclin dependent kinase inhibitor, p27KIP1. We also include an alternate protocol that allows for the analysis of cell cycle position in a sub-population of cells within a larger culture5. In this case, we demonstrate how to detect a cell cycle arrest in cells transfected with the retinoblastoma gene even when greatly outnumbered by untransfected cells in the same culture. These examples illustrate the many ways that DNA staining and flow cytometry can be utilized and adapted to investigate fundamental questions of mammalian cell cycle control.

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol. We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

Analyse des Zellzyklus Position in Säugerzellen

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of ...

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum (ER). However, the visualization of these mRNAs can be challenging. This is especially true when only a fraction of the mRNA is ER-associated and their distribution to this organelle is obstructed by non-targeted (i.e. "free") transcripts. In order to monitor ER-associated mRNAs, we have developed a method in which cells are treated with a short exposure to a digitonin extraction solution that selectively permeabilizes the plasma membrane, and thus removes the cytoplasmic contents, while simultaneously maintaining the integrity of the ER. When this method is coupled with fluorescent in situ hybridization (FISH), one can clearly visualize ER-bound mRNAs by fluorescent microscopy. Using this protocol the degree of ER-association for either bulk poly(A) transcripts or specific mRNAs can be assessed and even quantified. In the process, one can use this assay to investigate the nature of mRNA-ER interactions.

Here we describe a method to visualize endoplasmic reticulum-associated mRNAs in mammalian tissue culture cells. This technique involves the selective permeabilization of the plasma membrane with digitonin to remove cytoplasmic contents followed by fluorescent in situ hybridization to detect either bulk poly(A) mRNA or specific transcripts.

Visualisierung von endoplasmatischen Retikulum lokalisierte mRNAs in Säugerzellen

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum ...

Chromosome Preparation From Cultured Cells

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as fluorescence in situ hybridization (FISH), this assay has the powerful ability to analyze individual cells for aberrations that involve gains or losses of portions of the genome&#160;and rearrangements involving one or more chromosomes. In humans, chromosome abnormalities occur in approximately 1 per 160 live births1,2, 60-80% of all miscarriages3,4, 10% of stillbirths2,5, 13% of individuals with congenital heart disease6, 3-6% of infertility cases2, and in many patients with developmental delay&#160;and birth defects7. Cytogenetic analysis of malignancy is routinely used by researchers and clinicians, as observations of clonal chromosomal abnormalities have been shown to have both diagnostic and prognostic significance8,9.&#160; Chromosome isolation is invaluable for gene therapy and stem cell research of organisms including nonhuman primates and rodents10-13.
Chromosomes can be isolated from cells of live tissues, including blood lymphocytes, skin fibroblasts, amniocytes, placenta, bone marrow, and tumor specimens. Chromosomes are analyzed at the metaphase stage of mitosis, when they are most condensed and therefore more clearly visible. The first step of the chromosome isolation technique involves the disruption of the spindle fibers by incubation with Colcemid, to prevent the cells from proceeding to the subsequent anaphase stage. The cells are then treated with a hypotonic solution and preserved in their swollen state with Carnoy&#39;s fixative. The cells are then dropped on to slides and can then be utilized for a variety of procedures. G-banding involves trypsin treatment followed by staining with Giemsa to create characteristic light and dark bands. The same procedure to isolate chromosomes can be used for the preparation of cells for procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY)14,15.

Chromosomes can be isolated from live cells such as lymphocytes or skin fibroblasts, and from organisms including humans or mice. These chromosome preparations can be further utilized for routine G-banding and molecular cytogenetic procedures such as fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), and spectral karyotyping (SKY).

Chromosomenpräparation aus kultivierten Zellen

Chromosome (cytogenetic) analysis is widely used for the detection of chromosome instability. When followed by G-banding and molecular techniques such as ...

Viability Assays for Cells in Culture

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized viability assays are expensive in terms of equipment but can be faster and more objective than manual cell counts. The present report describes the use of three such viability assays. Two of these assays are infrared and one is luminescent. Both infrared assays rely on a 16&#160;bit Odyssey Imager. One infrared assay uses the DRAQ5 stain for nuclei combined with the Sapphire stain for cytosol and is visualized in the 700 nm channel. The other infrared assay, an In-Cell Western, uses antibodies against cytoskeletal proteins (&#945;-tubulin or microtubule associated protein 2) and labels them in the 800 nm channel. The third viability assay is a commonly used luminescent assay for ATP, but we use a quarter of the recommended volume to save on cost. These measurements are all linear and correlate with the number of cells plated, but vary in sensitivity. All three assays circumvent time-consuming microscopy and sample the entire well, thereby reducing sampling error. Finally, all of the assays can easily be completed within one day of the end of the experiment, allowing greater numbers of experiments to be performed within short timeframes. However, they all rely on the assumption that cell numbers remain in proportion to signal strength after treatments, an assumption that is sometimes not met, especially for cellular ATP. Furthermore, if cells increase or decrease in size after treatment, this might affect signal strength without affecting cell number. We conclude that all viability assays, including manual counts, suffer from a number of caveats, but that computerized viability assays are well worth the initial investment. Using all three assays together yields a comprehensive view of cellular structure and function.

Therapeutic compounds are often first examined in vitro with viability assays. Blind cell counts by a human observer can be highly sensitive to small changes in cell number but do not assess function. Computerized viability assays, as described here, can assess both structure and function in an objective manner.

Die Lebensfähigkeit Assays für Zellen in Kultur

Manual cell counts on a microscope are a sensitive means of assessing cellular viability but are time-consuming and therefore expensive. Computerized ...

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Erkennen Somatische Genetische Veränderungen in Tumorproben von Exon-Abscheidung und-Massively Parallel Sequencing

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Visualization of Endoplasmic Reticulum Subdomains in Cultured Cells

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and functions despite the intense interorganelle molecular traffic. The techniques described in this paper are powerful means of studying protein and lipid mobility and trafficking in vivo and in their physiological environment. Fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP) are widely used live-cell imaging techniques for studying intracellular trafficking through the exo-endocytic pathway, the continuity between organelles or subcompartments, the formation of protein complexes, and protein localization in lipid microdomains, all of which can be observed under physiological and pathological conditions. The limitations of these approaches are mainly due to the use of fluorescent fusion proteins, and their potential drawbacks include artifactual over-expression in cells and the possibility of differences in the folding and localization of tagged and native proteins. Finally, as the limit of resolution of optical microscopy (about 200 nm) does not allow investigation of the fine structure of the ER or the specific subcompartments that can originate in cells under stress (i.e. hypoxia, drug administration, the over-expression of transmembrane ER resident proteins) or under pathological conditions, we combine live-cell imaging of cultured transfected cells with ultrastructural analyses based on transmission electron microscopy.

We describe the imaging approaches we use to investigate the distribution and mobility of the transfected fluorescent proteins resident in the endoplasmic reticulum (ER) by means of the confocal imaging of living cells. We also ultrastructurally analyze the effect of their expression on the architecture of this subcellular compartment.

Visualisierung des endoplasmatischen Reticulum Subdomains in kultivierten Zellen

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

siRNA Screening zu Ubiquitin und Ubiquitin-ähnlichen System Regler der biologischen Stoffwechselwege in kultivierten Säugerzellen identifizieren

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...