Name: massively parallel reporter assays in cultured mammalian cells
Uploaded: 2014-08-17T16:00:00.000+00:00
Duration: 11 min 3 s
Description: Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Diese Arbeit wurde von der National Human Genome Research Institute der National Institutes of Health unter Preis Anzahl R01HG006785 unterstützt.

1. Sequenz Design und Synthese <ol><li> Beginnen MPRA mit dem Design und der Synthese von Sequenzen, die Marktaktivität untersucht werden. Für die Kompatibilität mit dem pMPRA Vektor-Serie, entwerfen jede Sequenz benutzen die folgende Vorlage: 5&#39;-ACTGGCCGCTTCACTG- var -GGTACCTCTAGA- Tag -AGATCGGAAGAGCGTCG-3 &#39;, wo var bezeichnet die Sequenz zu untersuchenden und Tag bedeutet ein oder mehrere Tags identifizieren. </li><li> Die beiden variablen Regionen (var und Tag) werden durch ein Paar von KpnI (GGTACC) und XbaI (TCTAGA) Restriktionsstellen getrennt, um gerichtete Ligation eines Reportergens Fragment zwischen ihnen zu erleichtern. Zusätzlich werden zwei verschiedene SfiI (GGCCNNNNNGGCC) Seiten durch PCR zugesetzt werden, um gerichtete Ligation in die pMPRA Rückgrat zulassen. Die variablen Regionen dürfen nicht zusätzliche Kopien eines dieser Restriktionsstellen enthalten. Falls erforderlich, eine oder mehrere dieser Restriktionsenzyme ersetzt werden kann, Solange die Ersatz 1) ermöglichen effizientes Schneiden in der Nähe der Enden der DNA-Moleküle, und 2) nicht an anderer Stelle in der Vektorsequenz geschnitten. Siehe Diskussion für weitere Informationen. </li><li> Rufen Sie die in Tabelle 1 von einem kommerziellen Anbieter aufgelistet erforderlich Primer. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="381"><tbody><tr><td> MPRA_SfiI_F </td><td> GCTAAGGGCCTAACTGGCCGCTTCACTG </td></tr><tr><td> MPRA_SfiI_R </td><td> GTTTAAGGCCTCCGTGGCCGACGCTCTTC </td></tr><tr><td> TAGseq_P1 </td><td> AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT </td></tr><tr><td> TAGseq_P2 </td><td> CAAGCAGAAGACGGCATACGAGAT [index] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG </td></tr></tbody></table> Tabelle 1. Primer-Sequenzen. [Index] bezeichnet eine 6 bis 8 nt Index Sequenz für Multiplex-Sequenzierung verwendet. Erhalten mindestens 8 TagSeq-P2 Primer mit unterschiedlichen Indizes. Alleder Primer sollten durch HPLC oder PAGE gereinigt werden. <ol start="4"><li> Oligonukleotid-Bibliotheken können aus einer kommerziellen Lieferanten oder Kerneinrichtung erhalten werden, oder durch Verwendung eines programmierbaren Microarray-basierte Oligonucleotidsynthesizer wie vom Hersteller beschrieben erzeugt. Resuspendieren der OLS-Produkte in 100 ul TE 0,1 Puffer. </li><li> Führen Sie die Oligonukleotid-Bibliotheken auf einem 10% TBE-Harnstoff-Denaturierung Polyacrylamid-Gel. Legen Sie ca. 1 pmol pro Bahn und Fleck mit ssDNA empfindlichen Fluoreszenzfarbstoff, um ihre Qualität (2A) zu beurteilen. </li><li> Wenn eine diskrete Bande, die den Volllängen-Oligonukleotide können visualisiert werden (Abbildung 2A, Bahnen 1 und 2), die Verbrauchs den entsprechenden Acrylamid-Gel Slice und eluieren Oligonukleotide in 100 ul TE 0,1 über Nacht bei Raumtemperatur unter Schütteln. Andernfalls fahren Sie mit der RAW OLS Aufhängung. </li><li> Verstärken und fügen SfiI Schwänze mit dem Oligonukleotid-Bibliothek mit Hilfe Emulsions-PCR 9 </<html> sup&gt;. </li><li> Bis 50 ul PCR-Reaktionsgemischen, wie in Tabelle 2 beschrieben. Dann verbinden sich mit 300 ul Öl und Tensid-Mischung aus der Emulsion und Micellula DNA Purification Kit und Vortex für 5 min bei 4 ° C ist. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="368"><tbody><tr><td> Reagens </td><td> 1x Volume (ul) </td></tr><tr><td> Herculase II Fusion DNA Polymerase </td><td> 0,5 </td></tr><tr><td> 5x Herculase II Reaktionspuffer </td><td> 10 </td></tr><tr><td> dNTP (10 mM jeweils) </td><td> 1,25 </td></tr><tr><td> BSA (20 mg / ml) </td><td> 1,25 </td></tr><tr><td> Primer MPRA_SfiI_F (25 uM) </td><td> 0,25 </td></tr><tr><td> Primer MPRA_SfiI_R (25 uM) </td><td> 0,25 </td></tr><tr><td> OLS-Vorlage (1-10 attomol) </td><td> variiert </td></tr><tr><td> Nuklease-freies Wasser </td><td> 50 </td></tr></tbody></table>ve_content &quot;&gt; Tabelle 2. Emulsion PCR-Reaktionsmischung (Wasserphase). <ol start="9"><li> Verwenden Sie die Konzentration, die die maximale Ausbeute der Amplifikation Produkte gibt ohne das Auftreten von Artefakten (siehe Abschnitt 1.12). </li><li> Abgeben der resultierenden Emulsion in PCR-Röhrchen und führen 20 Zyklen PCR (2 min bei 95 ° C, 20 x [20 sec 95 ° C, 20 sec bei 55 ° C, 30 sec bei 72 ° C], 3 min bei 95 ° C). </li><li> Pool und brechen jede 350 ul Emulsion-PCR-Reaktion durch Zugabe von 1 ml Isobutanol und kurz vortexen und dann reinigen die Verstärkung Produkt mit einem DNA-Aufreinigung Spalte. </li><li> Führen Sie einen aliquoten auf einem 2% bzw. 4% Agarose-Gel, um artefaktfreie Verstärkung (2B) zu überprüfen. </li></ol><img alt="Figur 2" src="/files/ftp_upload/51719/51719fig2highres.jpg" /> Figur 2: Herstellung von Oligonukleotid-Synthesebibliotheken. A) </sTrong&gt; Drei verschiedene rohe Oligonukleotid-Synthese-Bibliotheken (OLS) auf denaturierenden 10% TBE-Harnstoff-Polyacrylamid-Gelen laufen. Banden, die in voller Länge Oligonukleotide (*) visualisiert und aus Bibliotheken 1 ausgeschnitten werden und 2. Bibliothek 3 enthält Schadstoffe, die mit PAGE Reinigung stören. Wenn dies der Fall ist, fahren Sie mit PCR-Amplifikation. B) Die Produkte von offenen und Emulsions-PCR-Amplifikation der gleichen Oligonukleotid-Bibliothek ausgeführt auf einem Agarosegel. PCR-Amplifikation von komplexen Oligonukleotid-Bibliotheken erstellt häufig chimären Produkte und andere Artefakte, die als höhere und niedrigere Bands auftreten können. Emulsions-PCR können diese Artefakte zu minimieren. 2. Library Construction <ol><li> Vorbereitung eines linearisierten Plasmid-Backbone durch Verdau mit SfiI pMPRA1 Vektor bei 50 ° C für 2 Stunden, auf einem 1% igen Agarosegel aufgetrennt, die Verbrauchs das Rückgrat Band (in diesem Fall 2,5 kb) und reinigt sie mit einem Gel-Reinigung Spin-Säule. </li><li> Verdauendie Emulsions-PCR-Produkte aus Schritt 1.4 mit SfiI bei 50 ° C für 2 h und Reinigung mittels DNA-Reinigungssäulen. </li><li> Um die Promotor-Tag-Bibliothek in die linearisierte Vektor-Rückgrat ligieren, bis Reaktionen mit 100 ng des verdauten PCR-Produkt, 50 ng linearisierte Vektor-Rückgrat und T4-DNA-Ligase eingestellt. Inkubieren über Nacht bei 16 ° C und dann bei 65 ° C für 20 min, um die Ligase zu inaktivieren. </li><li> Transformation von E. coli mit dem Ligationsreaktion. Die Bibliothek Komplexität zu bewahren, wollen mindestens 10x mehr KBE erhalten, als es verschiedene Promotor-Tag-Kombinationen in der Bibliothek ausgelegt. </li><li> Wenn die Gesamtzahl von Tags ist etwa 100.000, kann die Ziel cfu typischerweise durch Ausführen 6-8 parallelen Umwandlungen pro Bibliothek erreicht werden. </li><li> Für jede Transformation, kombinieren 50 ul elektro E. coli-Zellen mit 2 ul Ligationsmischung auf Eis. Transformation durch Elektroporation, erholen die Zellen in 800 ul SOCMedium unter Schütteln bei 37 ° C für 1 h und dann kombinieren Zellen aus den parallel Transformationen. </li><li> Um die Transformationseffizienz zu bewerten, plattenReihenVerdünnungen von einem alinquot der gewonnenen Zellen auf LB-Agarplatten mit 50-100 ug / ml Carbenicillin und Inkubation über Nacht bei 37 ° C aufweist. Schätzung Gesamtkolonie wie beobachtet (cfu) x (Verdünnungsfaktor) × (V - V) / V, wobei V das Gesamtvolumen der gewonnenen Zellen und v das Volumen des Aliquots für die serielle Verdünnungen gemacht. </li><li> Gleichzeitig Verwenden der Rest der gewonnenen Zellen zur Beimpfung 200 ml LB mit 100 ug / ml Carbenicillin ergänzt. Wachsen Zellen bei 37 ° C über Nacht in einem Schüttelinkubator und dann isolieren die Plasmid-DNA nach Standardverfahren. </li><li> Digest ein Aliquot der isolierten Plasmid-Bibliothek mit SfiI bei 50 ° C für 2 h und laufen auf einem 1% Agarose-Gel auf die Anwesenheit des Inserts zu bestätigen. </li><li> Linearisierung der Plasmid-Bibliothek von cUtting zwischen den Promotorvarianten und Tags mit KpnI und XbaI. Um die Verdauung Effizienz zu maximieren, führen Serien Aufschlüsse: </li><li> Zunächst verdauen mit KpnI bei 37 ° C für 1 h und reinigen mit magnetischen Kügelchen. Zweitens Verdau mit XbaI unter Zusatz von 1 U alkalischer Shrimp-Phosphatase bei 37 ° C für 2 h, Hitze inaktiviert bei 65 ° C für 5 min und dann unter Verwendung von magnetischen Kügelchen zu reinigen. </li><li> Führen eines Aliquots auf einem 1% Agarose-Gel, um eine vollständige Linearisierung überprüfen. Wenn ungeschnittenen Plasmid sichtbar ist, sollte das linearisierte Fragment gelgereinigt werden. </li><li> Um eine MPRA Bibliothek geeignet für die Transfektion in Säugerzellen zu erzeugen, ligieren einen ORF mit KpnI / XbaI kompatible Enden in den lineaZwischen Bibliothek. </li><li> Wenn Sie einen kompatiblen luc2 ORF-Fragment aus pMPRAdonor1 vorzubereiten, zu verdauen, die dieses Plasmid mit KpnI und XbaI bei 37 ° C für 1 h und auf einem 1% Agarose-Gel laufen. Verbrauchsteuern Das ORF-Fragment (1,7 kB in diesem Fall) und zu reinigen mit einer Gelreinigung Spinsäule. </li><li> Klonen Sie die ORF-Fragment in den lineaZwischen Bibliothek wie in den Schritten 2,3-2,8 beschrieben. </li><li> Digest eines Aliquots (entsprechend 1-2 ug) des MPRA Bibliothek mit KpnI bei 37 ° C für 1 h und auf einem 1% Agarose-Gel laufen gelassen. Wenn die Bibliothek verdaut wird als Einzelband, Abschnitt 3. vorgehen, wenn zusätzliche Banden beobachtet (in der Regel um Verschleppungen von Zwischen Konstrukte entsprechend), kann die Bibliothek weiter gereinigt wie folgt: </li><li> Verdauen 3-5 ug des kontaminierten Bibliothek mit KpnI bei 37 ° C für 1 h und auf einem 0,8% Agarose-Gel bei 4 ° C über Nacht ausgeführt. </li><li> Auszuschneiden die korrekte Bandbibliothek, reinigen die DNA unter Verwendung einer Gel-Reinigung Spin-Säule und führen die Selbstligation unter Verwendung von hoch-konzentrierten T4-DNA-Ligase bei 37 ° C für 1 Stunde. Wiederholen Sie dann die Transformation und letzte Bibliothek DNA-Isolierung, wie in Schritt 2.8 beschrieben. </li></ol> 3. Transfection, Störungs und RNA-Isolierung <ol><li> Für jede unabhängige Transfektion Kultur der erforderlichen Anzahl von Zellen (wie von der MPRA Bibliothek Komplexität bestimmt, siehe Diskussion) in geeigneten Medium. Beispielsweise Kultur HEK293T / 17 Zellen in DMEM, ergänzt mit 10% FBS und L-Glutamin / Penicillin / Streptomycin. Kulturzellen von mindestens zwei unabhängigen Transfektionen für jede Bibliothek und experimentellen Bedingungen. </li><li> Transfektion der kultivierten Zellen mit Plasmiden MPRA. Die Transfektion Verfahren und Bedingungen müssen für jeden Zelltyp optimiert. Für jede Probe transfiziert sind, behalten ein Aliquot (50-100 ng) der Plasmid-DNA als eine abgestimmte Steuerung. </li><li> B. Transfektion von 0,5 x 10 7 HEK293T / 17-Zellen gezüchtet, um ~ 50% Konfluenz in einer 10 cm Kulturschale mit 10 ug Plasmid-DNA in 1 ml Opti-MEM I Reduzierte Serummedium unter Verwendung von 30 ul Lipofectamine LTX und 10 ul plus Reagenz. Entfernen Sie die Transfektion Mischung nach 5 Stunden und lassen Sie dasZellen für 24-48 Stunden zu erholen. </li><li> Optional führen Sie keine Störung erforderlich, um kontextabhängige oder Signal regulatorischen Sequenzen in der Bibliothek ausgelegt aktivieren. </li><li> Ernte der Zellen und Isolierung von Poly (A) + mRNA mit Standard-Oligo (dT) Cellulose-Säulen oder Kugeln mit Anweisungen des jeweiligen Herstellers. </li><li> Sicherzustellen, dass die maximale Bindungskapazität der Säulen oder Beads die Gesamtmenge an mRNA aus den geernteten Zellen erwartet überschreiten. Zum Beispiel kann die erwartete Rendite aus dem Abschnitt 3.3 ist etwa 0,5-2,5 ug mRNA. </li></ol> 4. Tag-Seq <ol><li> Verschleppung von Vektor-DNA aus den transfizierten Zelllysaten zu beseitigen, behandeln jeweils 20 ul mRNA-Probe mit 1 ul Turbo DNase (2 U) und 2,3 ul 10x Turbo DNase-Puffer bei 37 ° C für 1 h, fügen Sie 2,4 ul Turbo DNase Inaktivierung Reagenz bei RT für 5 min Mischen, Zentrifugieren bei 10.000 g für 90 sec, und dann wird die Lösung in ein frisches Röhrchen. </li><li> Überprüfen<html> Reinheit durch eine PCR, wie in Abschnitt 4.6 auf 60-100 ng jedes mRNA Probe beschrieben, und dann läuft die Produkte auf einem Agarose-Gel. Wenn bestimmte Amplikons sind sichtbar (0,25 kb bei Verwendung pMPRA1 mit luc2), Spalte reinigen die mRNA behandelt und wiederholen Sie den DNase-Behandlung. </li><li> Um Tag-Seq-Sequenzierung Bibliotheken generieren, konvertieren Reporter mRNA in cDNA und fügen Sequenzierung Adapter durch PCR. </li><li> Einrichtung mRNA / RT-Primer Mischungen, wie in Tabelle 3 beschrieben. Inkubation bei 65 ° C für 5 min auf Eis zu stellen. Parallel dazu richten Sie cDNA-Synthese-Reaktionen, wie in Tabelle 4 beschrieben. </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagens </td><td> 1x Volume (ul) </td></tr><tr><td> mRNA Probe (400-700 ng Gesamt) </td><td> 8 </td></tr><tr><td> Oligo-0DT (50 uM) </td><td> 1 </td></tr><tr><td> dNTP (10 mM jeweils) </td><td> 1 </td></tr></tbody></table>ove_content &quot;&gt; Tabelle 3. RNA / reverse Transkription Primer-Mix für die cDNA-Synthese. <table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagens </td><td> 1x Volume (ul) </td></tr><tr><td> 10x Superscript III RT Buffer </td><td> 2 </td></tr><tr><td> MgCl 2 (25 mM) </td><td> 4 </td></tr><tr><td> DTT (0,1 M) </td><td> 2 </td></tr><tr><td> RNaseOut (40 U / ul) </td><td> 1 </td></tr><tr><td> Superscript III (200 U / ul) </td><td> 1 </td></tr></tbody></table> Tabelle 4. cDNA-Synthese Reaktionsmischung. <ol start="5"><li> Sanft kombinieren mRNA / RT-Primer vermischt sich mit der cDNA-Synthese Mischungen. Inkubieren bei 50 ° C für 50 min, 85 ° C für 5 min und dann auf Eis. Schließlich Inkubation mit 2 U von Ribonuclease H bei 37 ° C für 20 min. </li><li> Bis PCR-Reaktionen wie in Tabelle 5 mit 4-6 ul beschriebencDNA Reaktionsmischung oder 50 ng Reporterplasmid als Vorlagen. Dann führen die PCR-Amplifikation (95 ° C für 2 min, 26 x [95 ° C für 30 sec, 55 ° C für 30 sec, 72 ° C für 30 sec], 72 ° C für 3 min). </li></ol><table border="0" cellpadding="0" cellspacing="0" width="428"><tbody><tr><td> Reagens </td><td> 1x Volume (ul) </td></tr><tr><td> 2x PfuUltra II HotStart PCR Master Mix </td><td> 25 </td></tr><tr><td> Primer TagSeq_P1 (25 uM) </td><td> 0,5 </td></tr><tr><td> Primer TagSeq_P2 (25 uM) </td><td> 0,5 </td></tr><tr><td> Vorlage (mRNA, cDNA-Mix oder Plasmid-DNA) </td><td> variiert </td></tr><tr><td> Nuklease-freies Wasser </td><td> 50 </td></tr></tbody></table> Tabelle 5. Tag-Seq PCR-Reaktionsmischung. <ol start="7"><li> Führen Sie die PCR-Produkte über ein 2% Agarose-Gel, Verbrauch Bands, die den Tag-Seq Bibliothek Amplikons (0,25 kb bei VerwendungpMPRA1 mit luc2) und reinigen Sie diese mit Gel-Reinigung Spin-Säulen. </li><li> Pool, denaturieren und Sequenz, die das gereinigte Tag-Seq Amplikons direkt mit einem Illumina-Sequenzierung Instrument. </li><li> Filter mit geringer Qualität liest, indem alle, dass a) eine oder mehrere Position mit einem Phred Qualitätsfaktor von weniger als 30 innerhalb des sequenzierten Tag oder b) nicht genau einen Tag ausgelegt entsprechen. Zählen Sie die Anzahl der jeweils verbleibenden Tag in jeder Bibliothek erscheint. Normalisieren die Tag zählt, um TPM (Tags pro Million sequenziert Tags) und berechnen dann das Verhältnis der mRNA-Tag zählt über Plasmid-abgeleitete Tag zählt für jedes Paar von Sequenzierungsbibliotheken. Wenn mehrere verschiedene Tags wurden zu jedem Sequenzvariante verknüpft, nutzen ihre mittlere Verhältnisse für Downstream-Analyse. </li></ol>

<ol>
	<li>Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+deep+sequencing+to+characterize+the+biophysical+mechanism+of+a+transcriptional+regulatory+sequence.">Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence.</a> Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).</li><li>Melnikov, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+and+optimization+of+inducible+enhancers+in+human+cells+using+a+massively+parallel+reporter+assay.">Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay.</a> Nature Biotechnology. 30 (3), 271-277 (2012).</li><li>Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe&#8217;er, D., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+of+DNA+regulatory+elements+by+synthetic+saturation+mutagenesis.">High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis.</a> Nature Biotechnology. 27 (12), 1173-1175 (2009).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nature Biotechnology. 30 (3), 265-270 (2012).</li><li>Arnold, C. D., Gerlach, D., Stelzer, C., Bory&#324;, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+quantitative+enhancer+activity+maps+identified+by+STARR-seq.">Genome-wide quantitative enhancer activity maps identified by STARR-seq.</a> Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).</li><li>Kheradpour, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+dissection+of+regulatory+motifs+in+2000+predicted+human+enhancers+using+a+massively+parallel+reporter+assay.">Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay.</a> Genome Research. 23 (5), 800-811 (2013).</li><li>White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+in+vivo+enhancer+assay+reveals+that+highly+local+features+determine+the+cis+-regulatory+function+of+ChIP-seq+peaks.">Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks.</a> Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).</li><li>Mogno, I., Kwasnieski, J. C., Cohen, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+synthetic+promoter+assays+reveal+the+in+vivo+effects+of+binding+site+variants.">Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants.</a> Genome Research. 23 (11), 1908-1915 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+protocol+for+emulsion+polymerase+chain+reaction+and+subsequent+purification.">A streamlined protocol for emulsion polymerase chain reaction and subsequent purification.</a> Analytical Biochemistry. 410 (1), 155-157 (2011).</li><li>Panne, D., Maniatis, T., Harrison, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+model+of+the+interferon-beta+enhanceosome.">An atomic model of the interferon-beta enhanceosome.</a> Cell. 129 (6), 1111-1123 (2007).</li></ol>

Die Autoren erklären, dass sie keine finanziellen Interessen konkurrieren.

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency. 
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple &#8220;promoter bashing&#8221; experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test. 
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements. 
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

A correction to the author list has been made for article <a href="http://www.jove.com/video/51719">Massively Parallel Reporter Assays in Cultured Mammalian Cells</a>.

Erratum: Massively Parallel Reporter Assays in Cultured Mammalian Cells

Massively Parallel Reporter Assays (MPRA) erlauben Multiplex-Messung der Transkriptionsregulationsaktivitäten Tausende bis Hunderttausende von DNA-Sequenzen 1-7. In ihrer allgemeinsten Ausführung wird durch Multiplexen Koppeln jeder Sequenz von Interesse ein synthetisches Reportergen, das eine Identifizierungssequenz Tag stromabwärts eines offenen Leserasters enthält erzielt (ORF Abbildung 1). Nach der Transfektion der RNA-Isolierung und Sequenzierung des Tief 3 &#39;Enden der Reportergen-Transkripten, können die relativen Aktivitäten der gekoppelten Sequenzen aus der relativen Häufigkeit der Ermittlung Variablen abgeleitet werden. <img alt="Figur 1" src="/files/ftp_upload/51719/51719fig1highres.jpg" /> Abbildung 1. Übersicht über MPRA. Eine Bibliothek von MPRA Reporterkonstrukte durch Kopplung mutmaßlichen regulatorischen Sequenzen zu synthetischen gebautReportergene, die aus einem &quot;inerten&quot; ORF bestehen (wie GFP oder Luciferase), gefolgt von einem identifizierenden Sequenz-Tag. Die Bibliothek wird in Massen in eine Population von kultivierten Zellen transfiziert und transkribiert Reporter mRNA wird anschließend zurückgewonnen. Deep sequencing wird verwendet, um die Anzahl der Vorkommen der einzelnen Tag unter den Reporter-mRNAs und den transfizierten Plasmiden zählen. Das Verhältnis der mRNA zählt über Plasmid Zahlen können verwendet werden, um die Aktivität der entsprechenden Regulationssequenz abzuleiten. Angepasst mit Erlaubnis von Melnikow, et al 2. MPRA kann zu einer breiten Vielzahl von experimentellen Designs angepasst werden, einschließlich 1) umfassende Mutagenese einzelner Gen regulatorische Elemente, 2) Überprüfung auf neue regulatorische Elemente in einem Ort von Interesse, 3) Testen der Wirkung der natürlichen genetischen Variation in einer Menge von putativen Promotoren, Enhancer oder Silencer, und 4) semi-rationale Konstruktion von synthetischen regulatorische Elemente. Libibliotheken von Sequenzvarianten können unter Verwendung einer Vielzahl von Verfahren, einschließlich Oligonukleotid-Synthese von Bibliotheken (OLS) auf programmierbaren Mikroarrays 2,3,6,7, Montage von degenerierten Oligonukleotiden 1,4, kombinatorische Ligations 8 und Fragmentierung der genomischen DNA, 5 erzeugt werden. Dieses Protokoll beschreibt die Konstruktion einer Bibliothek von Promotorvarianten mit OLS und die pMPRA1 und pMPRAdonor1 Vektoren (Addgene IDs 49349 und 49352 sind; http://www.addgene.org) transiente Transfektion dieser Bibliothek in kultivierte Säugerzellen und die anschließende Quantifizierung der Promotor-Aktivitäten von deep sequencing der ihnen zugeordneten Tags (Tag-Seq). Frühere Versionen von diesem Protokoll wurden in der Forschung in Melnikov et al. Nature Biotechnology 30, 271-277 (2012) und in Kheradpour et al. Genome Research 23, 800-811 (2013) berichtet, verwendet.

<table><tbody><tr><td>Oligonucleotide library synthesis</td><td>Agilent, CustomArray, or other OLS vendors</td><td>custom</td><td>If using OLS construction method</td></tr><tr><td>pMPRA1</td><td>Addgene</td><td>49349</td><td>MPRA plasmid backbone</td></tr><tr><td>pMPRAdonor1</td><td>Addgene</td><td>49352</td><td>luc2 ORF donor plasmid</td></tr><tr><td>TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)</td><td>Generic</td><td>n/a</td><td>OLS buffer</td></tr><tr><td>Novex TBE-Urea Gels, 10%</td><td>Life Technologies</td><td>EC6875BOX</td><td>PAGE purification of OLS products</td></tr><tr><td>Novex TBA-Urea Sample Buffer</td><td>Life Technologies</td><td>LC6876</td><td>PAGE purification of OLS products</td></tr><tr><td>SYBR Gold Nucleic Acid Gel Stain</td><td>Life Technologies</td><td>S-11494</td><td>PAGE purification of OLS products</td></tr><tr><td>Micellula DNA Emulsion &amp;amp; Purification Kit</td><td>EURx/CHIMERx</td><td>3600-01</td><td>Library amplification by emulsion PCR</td></tr><tr><td>Herculase II Fusion DNA Polymerase</td><td>Agilent</td><td>600675</td><td>Polymerase for emulsion PCR</td></tr><tr><td>SfiI</td><td>New England Biolabs</td><td>R0123S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>KpnI-HF</td><td>New England Biolabs</td><td>R3142S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>XbaI</td><td>New England Biolabs</td><td>R0145S</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>T4 DNA Ligase (2,000,000 units/ml)</td><td>New England Biolabs</td><td>M0202T</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>One Shot TOP10 Electrocomp &lt;em&gt;E. coli&lt;/em&gt;</td><td>Life Technologies</td><td>C4040-50</td><td>Library cloning with pMPRA vectors</td></tr><tr><td>LB agar and liquid media with carbenicllin</td><td>Generic</td><td>n/a</td><td>Growth media for cloning</td></tr><tr><td>E-Gel EX Gels 1%</td><td>Life Technologies</td><td>G4010-01</td><td>Library verification and purification</td></tr><tr><td>E-Gel EX Gels, 2%</td><td>Life Technologies</td><td>G4010-02</td><td>Library verification and purification</td></tr><tr><td>MinElute Gel Extraction Kit</td><td>Qiagen</td><td>28604</td><td>Library and backbone purification</td></tr><tr><td>EndoFree Plasmid Maxi Kit</td><td>Qiagen</td><td>12362</td><td>Library DNA isolation</td></tr><tr><td>Cell culture media</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>Transfection reagents</td><td>n/a</td><td>n/a</td><td>Experiment-specific</td></tr><tr><td>MicroPoly(A)Purist Kit</td><td>Life Technologies</td><td>AM1919</td><td>mRNA isolation</td></tr><tr><td>TURBO DNA-free Kit</td><td>Life Technologies</td><td>AM1907</td><td>Plasmid DNA removal</td></tr><tr><td>SuperScript III First-Strand Synthesis System</td><td>Life Technologies</td><td>18080-051</td><td>cDNA synthesis</td></tr><tr><td>PfuUltra II Hotstart PCR Master Mix</td><td>Agilent</td><td>600850</td><td>Polymerase for Tag-Seq PCR</td></tr><tr><td>Primers (see text)</td><td>IDT</td><td>custom</td><td>PAGE purify Tag-Seq primers</td></tr></tbody></table>

massively parallel reporter assays in cultured mammalian cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

MPRA ermöglicht hochauflösende, quantitative Zerlegung der Sequenz-Aktivitäts-Beziehungen von transkriptionalen regulatorischen Elemente. Eine erfolgreiche MPRA Experiment ergeben typischerweise hoch reproduzierbare Messungen für die Mehrzahl der Sequenzen in der Bibliothek transfiziert (3A). Wenn schlechte Reproduzierbarkeit beobachtet (3B), ist dies ein Hinweis auf eine zu niedrige Konzentration an Reporter-mRNAs in den gewonnenen RNA-Proben aufgrund entweder 1) geringe absolute Aktivität unter den Sequenzen untersucht, oder 2) geringe Transfektionseffizienz. Figur 4 zeigt ein repräsentatives &quot;Daten-Fußabdruck&quot; 1,2 durch Bestimmung erzeugt ~ 37.000 zufällige Varianten eines 145 bp-Sequenz stromaufwärts des menschlichen IFNB Gens in HEK293-Zellen, die mit oder ohne Einwirkung von Sendai-Virus. Der Promotor TATA-Box und bekannt proximalen Enhancer 10 eindeutig als informationsreichen regi identifiziert werdenons in einem Virus-abhängige Weise. <img alt="Figur 3" src="/files/ftp_upload/51719/51719fig3highres.jpg" /> Abbildung 3. Tag-Seq Reproduzierbarkeit. Streudiagramme, die Beispiele von Tag-Seq-Daten aus zwei unabhängigen Transfektionen mit hoher Wiederholungs (A) und niedriger (B) Reproduzierbarkeit. Letztere Plot zeigt viele Ausreißer-Tags mit hoher mRNA zählt in nur einer der zwei Wiederholungen. Solche Artefakte typischerweise an, dass die Konzentrationen der Reporter-mRNAs zu niedrig für die quantitative PCR-Amplifikation entweder durch niedrige absolute Aktivitäten unter den Reporterkonstrukte oder niedrige Transfektionseffizienz. <img alt="Figur 4" src="/files/ftp_upload/51719/51719fig4highres.jpg" /> Abbildung 4. Information Footprinting des menschlichen IFNB Transkriptionsstartstelle und proximalen Enhancer. </strOng&gt; Etwa 37.000 zufällige Varianten einer 145 Nukleotid (nt)-Region stromaufwärts des menschlichen Gens wurden unter Verwendung IFNB MPRA in HEK293-Zellen, die mit (A) und ohne (B) Einwirkung von Sendai-Virus untersucht. Die blauen Balken zeigen die gegenseitige Information zwischen dem Ausgang und dem Reporter Nukleotid an jeder Position. Das proximale Enhancer und TATA-Box stehen als Regionen mit hoher Informationsgehalt auf Virusinfektion.

Watch this Scientific Journal Video about Massively Parallel Reporter Assays in Cultured Mammalian Cells at JoVE.com

Massively Parallel Reporter Assays in Cultured Mammalian Cells

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Massively Parallel Reporter Assays in kultivierte Säugerzellen

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory ...

massively-parallel-reporter-assays-in-cultured-mammalian-cells

Research

JoVE Journal

Biology

21.5K Aufrufe.  Broad Institute. The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Serie: Massively Parallel Reporter Assays in Cultured Mammalian Cells

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in vitro analysis are well suited to study of large numbers of cells (&ge;105) in milliliter-scale volumes (&ge;0.1 ml). However, there are many instances in which it is necessary or desirable to scale down culture size to reduce consumption of the cells of interest and/or reagents required for their culture, stimulation, or processing. Unfortunately, conventional approaches do not support precise and reproducible manipulation of micro-scale cultures, and the microfluidics-based automated systems currently available are too complex and specialized for routine use by most laboratories. To address this problem, we have developed a simple and versatile technology platform for automated culture, stimulation, and recovery of small populations of cells (100 - 2,000 cells) in micro-scale volumes (1 - 20 &mu;l). The platform consists of a set of fibronectin-coated microcapillaries ("cell perfusion chambers"), within which micro-scale cultures are established, maintained, and stimulated; a digital microfluidics (DMF) device outfitted with "transfer" microcapillaries ("central hub"), which routes cells and reagents to and from the perfusion chambers; a high-precision syringe pump, which powers transport of materials between the perfusion chambers and the central hub; and an electronic interface that provides control over transport of materials, which is coordinated and automated via pre-determined scripts. As an example, we used the platform to facilitate study of transcriptional responses elicited in immune cells upon challenge with bacteria. Use of the platform enabled us to reduce consumption of cells and reagents, minimize experiment-to-experiment variability, and re-direct hands-on labor. Given the advantages that it confers, as well as its accessibility and versatility, our platform should find use in a wide variety of laboratories and applications, and prove especially useful in facilitating analysis of cells and stimuli that are available in only limited quantities.

We have developed an automated cell culture and interrogation platform for micro-scale cell stimulation experiments. The platform offers simple, versatile, and precise control in cultivating and stimulating small populations of cells, and recovering lysates for molecular analyses. The platform is well suited to studies that use precious cells and/or reagents.

Eine vielseitige automatisierte Plattform für Mikro-Skala Handy Stimulation Experimente

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in ...

Forschung

Biotechnik

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

Optimierung der genetischen Einbeziehung der chemischen Sonden in GPCRs für Foto-Vernetzung-Mapping und Bioorthogonal Chemie in Live Säugerzellen

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

Chemie

A Multiplexed Luciferase-based Screening Platform for Interrogating Cancer-associated Signal Transduction in Cultured Cells

Genome-scale interrogation of gene function using RNA interference (RNAi) holds tremendous promise for the rapid identification of chemically tractable cancer cell vulnerabilities. Limiting the potential of this technology is the inability to rapidly delineate the mechanistic basis of phenotypic outcomes and thus inform the development of molecularly targeted therapeutic strategies. We outline here methods to deconstruct cellular phenotypes induced by RNAi-mediated gene targeting using multiplexed reporter systems that allow monitoring of key cancer cell-associated processes. This high-content screening methodology is versatile and can be readily adapted for the screening of other types of large molecular libraries.

Achieving a systems level understanding of cellular processes is a goal of modern-day cell biology. We describe here strategies for multiplexing luciferase reporters of various cellular function end-points to interrogate gene function using genome-scale RNAi libraries.

Ein Multiplex-Luciferase-basierte Screening-Plattform zur Abfrage Krebs-assoziierte Signaltransduktion in kultivierten Zellen

Genome-scale interrogation of gene function using RNA interference (RNAi)  holds tremendous promise for the rapid identification of chemically tractable  ...

Medizin

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since several decades, the sudden burst of multi- and extensively-drug resistant strains is a serious threat for the control of tuberculosis. Therefore, it is essential to identify new targets and pathways critical for the causative agent of the tuberculosis, Mycobacterium tuberculosis (Mtb) and to search for novel chemicals that could become TB drugs. One approach is to set&#160;up methods suitable for the genetic and chemical screens of large scale libraries enabling the search of a needle in a haystack. To this end, we developed a phenotypic assay relying on the detection of fluorescently labeled Mtb within fluorescently labeled host&#160;cells using automated confocal microscopy. This in vitro assay allows an image based quantification of the colonization process of Mtb&#160;into the host and was optimized for the 384-well microplate format, which is proper for screens of siRNA-, chemical compound- or Mtb mutant-libraries. The images are then processed for multiparametric analysis, which provides read&#160;out inferring on the pathogenesis of Mtb&#160;within host cells.

Here, we describe a phenotypic assay applicable to the High-throughput/High-content screens of small-interfering synthetic RNA (siRNA), chemical compound, and Mycobacterium tuberculosis mutant libraries. This method relies on the detection of fluorescently labeled Mycobacterium tuberculosis within fluorescently labeled host&#160;cell using automated confocal microscopy.

Ein mikroskopischer phänotypischer Assay zur Quantifizierung intrazellulärer Mykobakterien angepasst für High-Throughput/High-Content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

Immunologie und Infektion

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

Ein Reporter-Assay zur Analyse der intronischen microRNA-Reifung in Säugetierzellen

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

Krebsforschung

High Throughput, Real-time, Dual-readout Testing of Intracellular Antimicrobial Activity and Eukaryotic Cell Cytotoxicity

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require several additional experimental steps prior to readout, such as cell lysis, colony forming unit determination, or reagent addition. When performing thousands of assays, for example, during high-throughput screening, the downstream effort required for these types of assays is considerable. Therefore, to facilitate high-throughput antimicrobial discovery, we developed a real-time assay to simultaneously identify inhibitors of intracellular bacterial growth and assess eukaryotic cell cytotoxicity. Specifically, real-time intracellular bacterial growth detection was enabled by marking bacterial screening strains with either a bacterial lux operon (1st generation assay) or fluorescent protein reporters (2nd generation, orthogonal assay). A non-toxic, cell membrane-impermeant, nucleic acid-binding dye was also added during initial infection of macrophages. These dyes are excluded from viable cells. However, non-viable host cells lose membrane integrity permitting entry and fluorescent labeling of nuclear DNA (deoxyribonucleic acid). Notably, DNA binding is associated with a large increase in fluorescent quantum yield that provides a solution-based readout of host cell death. We have used this combined assay to perform a high-throughput screen in microplate format, and to assess intracellular growth and cytotoxicity by microscopy. Notably, antimicrobials may demonstrate synergy in which the combined effect of two or more antimicrobials when applied together is greater than when applied separately. Testing for in vitro synergy against intracellular pathogens is normally a prodigious task as combinatorial permutations of antibiotics at different concentrations must be assessed. However, we found that our real-time assay combined with automated, digital dispensing technology permitted facile synergy testing. Using these approaches, we were able to systematically survey action of a large number of antimicrobials alone and in combination against the intracellular pathogen, Legionella pneumophila.

A high throughput, real-time assay was developed to simultaneously identify (1) eukaryotic cell-penetrant antimicrobials targeting an intracellular bacterial pathogen, and (2) assess eukaryotic cell cytotoxicity. A variation on the same technology was thereafter combined with digital dispensing technology to enable facile, high-resolution, dose-response, and two- and three-dimensional synergy studies.

Hoher Durchsatz, Echtzeit, Doppel-Ausleseprüfung intrazellulärer antimikrobieller Aktivität und eukaryotischen Zelle Zytotoxizität

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require ...

Monitoring Plasmid Replication in Live Mammalian Cells over Multiple Generations by Fluorescence Microscopy

Few naturally-occurring plasmids are maintained in mammalian cells. Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus (EBV) and Kaposi's Sarcoma-associated herpesvirus (KSHV), which cause multiple human malignancies 1-3. These two genomes are replicated in a licensed manner, each using a single viral protein and cellular replication machinery, and are passed to daughter cells during cell division despite their lacking traditional centromeres 4-8.
Much work has been done to characterize the replications of these plasmid genomes using methods such as Southern blotting and fluorescence in situ hybridization (FISH). These methods are limited, though. Quantitative PCR and Southern blots provide information about the average number of plasmids per cell in a population of cells. FISH is a single-cell assay that reveals both the average number and the distribution of plasmids per cell in the population of cells but is static, allowing no information about the parent or progeny of the examined cell.
Here, we describe a method for visualizing plasmids in live cells. This method is based on the binding of a fluorescently tagged lactose repressor protein to multiple sites in the plasmid of interest 9. The DNA of interest is engineered to include approximately 250 tandem repeats of the lactose operator (LacO) sequence. LacO is specifically bound by the lactose repressor protein (LacI), which can be fused to a fluorescent protein. The fusion protein can either be expressed from the engineered plasmid or introduced by a retroviral vector. In this way, the DNA molecules are fluorescently tagged and therefore become visible via fluorescence microscopy. The fusion protein is blocked from binding the plasmid DNA by culturing cells in the presence of IPTG until the plasmids are ready to be viewed.
This system allows the plasmids to be monitored in living cells through several generations, revealing properties of their synthesis and partitioning to daughter cells. Ideal cells are adherent, easily transfected, and have large nuclei. This technique has been used to determine that 84% of EBV-derived plasmids are synthesized each generation and 88% of the newly synthesized plasmids partition faithfully to daughter cells in HeLa cells. Pairs of these EBV plasmids were seen to be tethered to or associated with sister chromatids after their synthesis in S-phase until they were seen to separate as the sister chromatids separated in Anaphase10. The method is currently being used to study replication of KSHV genomes in HeLa cells and SLK cells. HeLa cells are immortalized human epithelial cells, and SLK cells are immortalized human endothelial cells. Though SLK cells were originally derived from a KSHV lesion, neither the HeLa nor SLK cell line naturally harbors KSHV genomes11. In addition to studying viral replication, this visualization technique can be used to investigate the effects of the addition, removal, or mutation of various DNA sequence elements on synthesis, localization, and partitioning of other recombinant plasmid DNAs.

A method of observing individual DNA molecules in live cells is described. The technique is based on the binding of a fluorescently tagged lac repressor protein to binding sites engineered into the DNA of interest. This method can be adapted to follow many recombinant DNAs in live cells over time.

Überwachung Plasmid-Replikation in lebenden Säugerzellen über mehrere Generationen durch Fluoreszenz-Mikroskopie

Few naturally-occurring plasmids are maintained in mammalian cells.  Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus  (EBV) ...

Biologie

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with Parkinson&#39;s disease. 293T cells are transiently transfected with plasmids from an arrayed ORF expression library, together with luciferase reporter plasmids, in a one-gene-per-well microplate format. Firefly luciferase activity is assayed after 48 hr to determine the effects of each library gene upon alpha-synuclein transcription, normalized to expression from an internal control construct (a hCMV promoter directing Renilla luciferase). This protocol is facilitated by a bench-top robot enclosed in a biosafety cabinet, which performs aseptic liquid handling in 96-well format. Our automated transfection protocol is readily adaptable to high-throughput lentiviral library production or other functional screening protocols requiring triple-transfections of large numbers of unique library plasmids in conjunction with a common set of helper plasmids. We also present an inexpensive and validated alternative to commercially-available, dual luciferase reagents which employs PTC124, EDTA, and pyrophosphate to suppress firefly luciferase activity prior to measurement of Renilla luciferase. Using these methods, we screened 7,670 human genes and identified 68 regulators of alpha-synuclein. This protocol is easily modifiable to target other genes of interest.

We present a rapid and inexpensive screening method for identifying transcriptional regulators using high-throughput robotic transfections and a homemade dual-glow luciferase assay. This protocol rapidly generates direct side-by-side functional data for thousands of genes and is easily modifiable to target any gene of interest.

Hochdurchsatz-Screening mit einem Funktionshomemade Dual-Luciferase Assay-Schein

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Screening Peptides that Activate MRGPRX2 using Engineered HEK Cells

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new therapeutics. Mas related G-protein receptor-X2 (MRGPRX2) is an important receptor that regulates mast cell activation and, thus, directs the general immune response. Numerous ligands for MRGPRX2 have been identified and include endogenous peptides like PAMPs, defensins, LL-37 and other protein fragments (i.e., degraded albumin). Further identification of MRGPRX2 specific ligands requires the screening of a large number of peptides (i.e., peptide library); however, mast cells are difficult and expensive to maintain in vitro and, therefore, not economical to use for screening large numbers of molecules. The present paper demonstrates a method to design, develop, and screen a library of small peptide molecules using MRGPRX2 expressing HEK cells. This cell line is relatively easy and inexpensive to maintain and can be used for in vitro high-throughput analysis. A calcium sensitive Fura-2 fluorescent dye to mark intracellular calcium flux upon activation was used to monitor the activation. The ratio of fluorescence intensity of Fura-2 at 510 nm against excitation wavelengths of 340 and 380 nm was used to calculate calcium concentration. The peptide library used to verify this system was based on the endogenous proadrenomedullin N-terminal 12 (PAMP-12) secretagogue, which is known to bind MRGPRX2 with high specificity and affinity. Subsequent peptides were generated through amino acid truncation and alanine scanning techniques applied to PAMP-12. The method described here is simple and inexpensive yet robust for screening a large library of compounds to identify binding domains and other important parameters that play an important role in receptor activation.

Techniques for generating a library of short peptides that can activate mast cells via the MRGPRX2 receptor are described. Associated techniques are easy, inexpensive, and can be extended to other cell receptors.

Screening von Peptiden, die MRGPRX2 mit engineered HEK Cells aktivieren

Identifying ligands specific to therapeutically significant cell receptors is crucial for many applications, including the design and development of new ...

Autonomously Bioluminescent Mammalian Cells for Continuous and Real-time Monitoring of Cytotoxicity

Mammalian cell-based in vitro assays have been widely employed as alternatives to animal testing for toxicological studies but have been limited due to the high monetary and time costs of parallel sample preparation that are necessitated due to the destructive nature of firefly luciferase-based screening methods. This video describes the utilization of autonomously bioluminescent mammalian cells, which do not require the destructive addition of a luciferin substrate, as an inexpensive and facile method for monitoring the cytotoxic effects of a compound of interest. Mammalian cells stably expressing the full bacterial bioluminescence (luxCDABEfrp) gene cassette autonomously produce an optical signal that peaks at 490 nm without the addition of an expensive and possibly interfering luciferin substrate, excitation by an external energy source, or destruction of the sample that is traditionally performed during optical imaging procedures. This independence from external stimulation places the burden for maintaining the bioluminescent reaction solely on the cell, meaning that the resultant signal is only detected during active metabolism. This characteristic makes the lux-expressing cell line an excellent candidate for use as a biosentinel against cytotoxic effects because changes in bioluminescent production are indicative of adverse effects on cellular growth and metabolism. Similarly, the autonomous nature and lack of required sample destruction permits repeated imaging of the same sample in real-time throughout the period of toxicant exposure and can be performed across multiple samples using existing imaging equipment in an automated fashion.

Mammalian cells expressing the bacterial bioluminescence gene cassette (lux) produce light autonomously. The resulting bioluminescent dynamics upon chemical exposure have been demonstrated to reflect the treatment effects on cellular growth and metabolism, making these cells an inexpensive, continuous, real-time toxicity screening tool that can easily be adapted for high-throughput automation.

Autonom Bioluminescent Säugerzellen für die kontinuierliche und Echtzeit-Überwachung von Zytotoxizität

Mammalian  cell-based in vitro assays have been  widely employed as alternatives to animal testing for toxicological studies but  have been limited due to ...